Rhodotorula mucilaginosa multi-copy plasmid, Rhodotorula mucilaginosa transformation, target gene efficient overexpression Rhodotorula mucilaginosa strain and construction method thereof

Abstract

The invention provides a rhodotorula mucilaginosa multi-copy plasmid, rhodotorula mucilaginosa transformation, a target gene efficient overexpression rhodotorula mucilaginosa strain and a construction method thereof, and relates to the technical field of gene engineering. The construction method of the plasmid comprises the following steps: screening out genetics mycin as a resistance marker of wild rhodotorula mucilaginosa; carrying out amplification by taking the plasmid YEp352 as a template and P1-F / R as a primer to obtain a linearized plasmid fragment; the method comprises the following steps: amplifying by taking a DNA (Deoxyribonucleic Acid) sequence of a heredity mycin resistance expression box with a homologous arm as a template and G1-F / R as a primer to obtain a target gene segment with a homologous sequence; and assembling the linearized plasmid fragment and a target gene fragment with a homologous sequence, transforming into an escherichia coli competent cell, and finally identifying a positive bacterial colony. The multi-copy plasmid provided by the invention has multiple cloning sites and selective markers, so that genome modification in rhodotorula mucilaginosa is more flexible and convenient, and a target gene can be stably and efficiently expressed.

Description

Technical Field

[0001] The present application relates to the field of genetic engineering technology, and in particular to a multi-copy plasmid of Rhodotorula glutinosus, transformation of Rhodotorula glutinosus, a Rhodotorula glutinosus strain for efficiently overexpressing a target gene, and a construction method thereof. Background Art

[0002] In modern biotechnology, Rhodotorula mucilaginosa has attracted extensive attention due to its ability to synthesize abundant carotenoids, especially in the food and pharmaceutical industries. However, the current genetic manipulation methods for Rhodotorula mucilaginosa are still relatively limited, especially in terms of efficient overexpression of target genes. Existing technologies mainly focus on other yeast or microbial models, resulting in considerable challenges in achieving genetic modification in Rhodotorula mucilaginosa.

[0003] Currently, there is no systematic, efficient, and repeatable genetic manipulation method for Rhodotorula glutinosus (including the preparation and transformation of competent cells), nor is there a molecular tool specifically used to highly express target genes in Rhodotorula glutinosus. With the continuous improvement of the application value of Rhodotorula glutinosus, it is urgent to develop efficient genetic manipulation methods and molecular tools to study and metabolically modify Rhodotorula glutinosus strains at the molecular level. Therefore, the development of an efficient and repeatable genetic manipulation method is of great significance for improving the function and application potential of Rhodotorula glutinosus. Summary of the invention

[0004] The purpose of the present invention is to provide a genetic manipulation method and a multi-copy plasmid for overexpressing a target gene in red yeast cells. The genetic manipulation method has high conversion efficiency and is simple. The multi-copy plasmid has stable expression and a high copy number, and is suitable for popularization and application.

[0005] In order to solve the above technical problems, the technical solution adopted in this application is:

[0006] In a first aspect, the present application provides a Rhodotorula multi-copy plasmid, which is used for efficient expression of Rhodotorula genes, and the specific sequence is SEQ ID NO.2.

[0007] In a second aspect, the present application provides a method for constructing a multi-copy plasmid of Rhodotorula glutinosus, comprising the following steps:

[0008] S1, screening geneticin as a resistance marker for wild red yeast;

[0009] S2. Using plasmid YEp352 as a template and P1-F / P1-R as primers, PCR amplification was performed on plasmid YEp352 to obtain a linearized plasmid fragment; wherein the sequence of P1-F is SEQ ID NO.3, and the sequence of P1-R is SEQ ID NO.4;

[0010] S3, using the artificially synthesized DNA sequence of the geneticin resistance expression cassette with homology arms as a template, the sequence is SEQ ID NO.1, and using G1-F / G1-R as primers for amplification to obtain the target gene fragment with homology sequences; wherein the sequence of G1-F is SEQ ID NO.5, and the sequence of G1-R is SEQ ID NO.6;

[0011] S4. Assemble the above linearized plasmid fragments with the target gene fragment with homologous sequences, transform them into Escherichia coli Top10 competent cells, and finally identify positive colonies.

[0012] In a third aspect, the present application provides a method for transforming red yeast, comprising the following steps:

[0013] SA, pick a single colony of red yeast and culture it in YPD medium, then collect, centrifuge, wash and resuspend to obtain competent cells;

[0014] SB. The multi-copy plasmid prepared above was transformed into competent cells by electroporation, and after recovery treatment, it was spread on YRD agar plates containing geneticin and cultured to obtain positive single clones.

[0015] In a fourth aspect, the present application provides a method for preparing a red yeast strain for efficiently overexpressing a target gene, comprising the following steps:

[0016] SI, select any target gene in Rhodotorula to synthesize a gene fragment with homology arms;

[0017] SII, using pYE-TNC as a template and P2-F / P2-R as primers for PCR amplification to obtain a linearized plasmid fragment; wherein the sequence of P2-F is SEQ ID NO.7, and the sequence of P2-R is SEQ ID NO.8;

[0018] SIII. The gene fragment with homology arms and the linearized plasmid fragment are assembled in a ratio, and then transformed into Escherichia coli Top10 competent cells. After a single clone grows on the screening plate, colony PCR verification is performed to obtain the correct transformant, which is the multi-copy gene overexpression plasmid of Rhodotorula glutinosus with a gene expression cassette;

[0019] SIV, transforming the above plasmid into Rhodotorula glutinosus by electroporation to obtain a Rhodotorula glutinosus strain with efficient overexpression of the target gene.

[0020] Compared with the prior art, the embodiments of the present application have at least the following advantages or beneficial effects:

[0021] 1. This application determined that geneticin is an available resistance marker for wild red yeast and optimized the dosage of geneticin used in the screening of engineered strains.

[0022] 2. This patent proposes a new multi-copy plasmid with a geneticin expression cassette that can be used for efficient expression of Rhodotorula genes and a method for electroporation transformation of Rhodotorula, which can efficiently transfer plasmids and DNA fragments into Rhodotorula cells. Compared with traditional methods, the method of this application significantly improves the efficiency of gene introduction by optimizing transformation conditions and designing specific plasmid vectors. In addition, the developed plasmid system has multiple cloning sites and selection markers, making genome modification in Rhodotorula more flexible and convenient. This innovative genetic manipulation method not only provides new tools for the study of Rhodotorula, but also lays the foundation for its broad potential in industrial applications. Through this technology, scientists can explore the metabolic pathways of Rhodotorula in more depth and promote its development in the fields of nutrition, health products and biomaterials. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present application and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 This is an experimental diagram of the resistance of Rhodotorula to different concentrations of Geneticin and Hygromycin;

[0025] Figure 2 This is the plasmid map of the multicopy plasmid pYE-TNC;

[0026] Figure 3 Schematic diagram of the electroporation transformation process of competent red yeast and plasmid;

[0027] Figure 4 This is a map of the multi-copy gene overexpression plasmid of Rhodotorula glutinosus carrying the GLR1 expression cassette. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the embodiments of the present application clearer, the technical scheme in the embodiments of the present application will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0029] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0030] YPD medium: This medium is composed of solute and solvent; the solute is yeast powder, peptone and glucose, and the solvent is water; the concentration of the solute is as follows: 10g / L yeast powder, 20g / L peptone, 20g / L glucose; natural pH.

[0031] The solid culture medium is made by adding 20g / L agar powder, and the other ingredients and concentrations are the same as those of the liquid culture medium. Different concentrations and types of antibiotics are added as needed.

[0032] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present application will be described in detail below with reference to specific embodiments.

[0033] A multi-copy plasmid of Rhodotorula glutinosus is used for efficient expression of Rhodotorula glutinosus genes, and the specific sequence is SEQ ID NO.2.

[0034] A method for constructing a multi-copy plasmid of Rhodotorula glutinosus comprises the following steps:

[0035] S1, screening geneticin as a resistance marker for wild red yeast;

[0036] S2. Using plasmid YEp352 as a template and P1-F / P1-R as primers, PCR amplification was performed on plasmid YEp352 to obtain a linearized plasmid fragment; wherein the sequence of P1-F is SEQ ID NO.3, and the sequence of P1-R is SEQ ID NO.4;

[0037] S3, using the artificially synthesized DNA sequence of the geneticin resistance expression cassette with homology arms as a template, the sequence is SEQ ID NO.1, and using G1-F / G1-R as primers for amplification to obtain the target gene fragment with homology sequences; wherein the sequence of G1-F is SEQ ID NO.5, and the sequence of G1-R is SEQ ID NO.6;

[0038] S4. Assemble the above linearized plasmid fragments with the target gene fragment with homologous sequences, transform them into Escherichia coli Top10 competent cells, and finally identify positive colonies.

[0039] In some embodiments of the present application, the PCR amplification system in the above step S2 is: PrimeSTAR Max Premix (2x) 25 μL, 1.5 μL of upstream and downstream primers, 10 ng of plasmid YEp352, and the system is supplemented to 50 μL with deionized water and mixed.

[0040] In some embodiments of the present application, the above-mentioned PCR reaction conditions are: 98°C / 3min, 1 cycle; 98°C / 10sec, 55°C / 10sec, 72°C / 30sec, 32 cycles; 72°C / 5min.

[0041] In some embodiments of the present application, the above step S4 is reacted at 50° C. for 1-4 hours after assembly.

[0042] A method for transforming red yeast rice comprises the following steps:

[0043] SA, pick a single colony of red yeast and culture it in YPD medium, then collect, centrifuge, wash and resuspend to obtain competent cells;

[0044] SB. The multi-copy plasmid of claim 1 is transformed into competent cells by electroporation, and after recovery treatment, the cells are spread on YRD agar plates containing geneticin and cultured to obtain positive single clones.

[0045] In some embodiments of the present application, the parameters of the electric shock conversion in the above SB step are set to 50μF, 100-129Ω, 1.5kV, and the pulse duration is 4-5ms.

[0046] A method for preparing a red yeast strain for efficiently overexpressing a target gene comprises the following steps:

[0047] SI, select any target gene in Rhodotorula to synthesize a gene fragment with homology arms;

[0048] SII, using pYE-TNC as a template and P2-F / P2-R as primers for PCR amplification to obtain a linearized plasmid fragment; wherein the sequence of P2-F is SEQ ID NO.7, and the sequence of P2-R is SEQ ID NO.8;

[0049] SIII. The gene fragment with homology arms and the linearized plasmid fragment are assembled in a ratio, and then transformed into Escherichia coli Top10 competent cells. After a single clone grows on the screening plate, colony PCR verification is performed to obtain the correct transformant, which is the multi-copy gene overexpression plasmid of Rhodotorula glutinosus with a gene expression cassette;

[0050] SIV, transforming the above plasmid into Rhodotorula glutinosus by electroporation to obtain a Rhodotorula glutinosus strain with efficient overexpression of the target gene.

[0051] In some embodiments of the present application, the target gene in the above-mentioned SI step is the glutathione reductase encoding gene GLR1 of Rhodotorula glutinosus, and the gene fragment sequence with homology arms is SEQ ID NO.9; the sequence of the Rhodotorula glutinosus multi-copy gene overexpression plasmid with a gene expression cassette in the SIII step is SEQ ID NO.10.

[0052] The features and performance of the present application are further described in detail below in conjunction with the embodiments.

[0053] Example 1

[0054] This example is about the screening of resistance markers for Rhodotorula glutinosus, and the process is as follows:

[0055] Prepare 0 μg / ml, 25 μg / ml, 50 μg / ml, 75 μg / ml of YPD plates with geneticin resistance and 0 μg / ml, 25 μg / ml, 50 μg / ml, 75 μg / ml of YPD plates with hygromycin resistance respectively for later use;

[0056] Pick a single colony of R. glutinosus on the plate into a test tube containing 3 ml of YPD medium, and activate it in a shaker at 28°C and 200 rpm for 24 hours. Take 30 μL of the activated bacterial solution and transfer it to 3 ml of YPD medium, and culture it in a shaker at 28°C and 200 rpm for 24 hours. Take 1 ml of the bacterial solution and transfer it to a 1.5 ml centrifuge tube. Use a high-speed centrifuge to centrifuge at 5000×g for 5 minutes to enrich the bacteria. Add 1 ml of sterile water, use a 1000 μl pipette to blow and aspirate evenly, and then centrifuge at 5000×g for 5 minutes to enrich the bacteria. After repeating the bacterial washing process 3 times, add 1 ml of sterile water to the centrifuge tube containing the bacteria, blow and aspirate evenly to obtain the R. glutinosus bacterial solution, and dilute the solution by 10 -2 , 10 -3 , 10 -4 5 μL of three different concentrations of diluted bacterial solution were spotted onto YPD plates with geneticin resistance at 0 μg / ml, 25 μg / ml, 50 μg / ml, and 75 μg / ml and hygromycin resistance at 0 μg / ml, 25 μg / ml, 50 μg / ml, and 75 μg / ml, respectively. The plates with the spotted bacterial solution were placed in a constant temperature incubator at 28°C and cultured for 48 hours. The results are shown in Figure 1 As shown in the figure, R.mucilaginosa represents red yeast, S.cerevisiae represents brewer's yeast, Geneticin is geneticin, and Hygromycin is hygromycin. Figure 1 It can be seen that 25 μg / L geneticin and 50 μg / L hygromycin can effectively inhibit the growth of red yeast; therefore, this application selects geneticin as a resistance marker for wild red yeast.

[0057] Example 2

[0058] This example constructs a multi-copy plasmid, and the process is as follows:

[0059] Plasmid YEp352 was used as a template (reference for the construction of YEp352: Hill, JE, Myers, AM, Koerner, TJ, Tzagoloff, A. (1986) Yeast / E. coli shuttle vectors with multiple unique restriction sites. Yeast 2: 163-167.), and P1-F / P1-R were used as primers to perform PCR amplification on plasmid YEp352 to obtain a linearized plasmid fragment. The sequence of P1-F is SEQ ID NO.3: catcaggcgccattcgcc, and the sequence of P1-R is SEQ ID NO.4: gctcttgttacccatcattgaattttgaac. The PCR amplification system is: PrimeSTARMaxPremix (2x) 25 μL, 1.5 μL of upstream and downstream primers, 10 ng of plasmid YEp352, and the system is supplemented to 50 μL with deionized water and mixed. PCR reaction conditions: 98°C / 3 min, 1 cycle; 98°C / 10 sec, 55°C / 10 sec, 72°C / 30 sec, 32 cycles; 72°C / 5 min.

[0060] The DNA sequence of the geneticin resistance expression cassette with homology arms (SEQ ID NO.1) was artificially synthesized at GenScript, and the sequence fragment was amplified using the artificially synthesized DNA sequence of the geneticin resistance expression cassette with homology arms as a template and G1-F / G1-R as primers to obtain the target gene fragment with homology sequences; wherein the sequence of G1-F is SEQ ID NO.5: cctgaatggcgaatggcgcctgatgGAATCCTTACATCACAC, and the sequence of G1-R is SEQ ID NO.6: gatgggtaacaagagcttGCAAATTAAAGCCTTCG. The PCR amplification system is: PrimeSTARMax Premix (2x) 25 μL, 1.5 μL of upstream and downstream primers, 10 ng of the DNA sequence of the geneticin resistance expression cassette with homology arms, and the system is supplemented to 50 μL with deionized water and mixed. PCR reaction conditions: 98°C / 3 min, 1 cycle; 98°C / 10 sec, 55°C / 10 sec, 72°C / 30 sec, 32 cycles; 72°C / 5 min.

[0061] The linear vector and the target gene fragment with homologous sequence were assembled according to the system in the GenBuilder Cloning Kit User Manual of GenScript Company, reacted at 50℃ for 1-4h, and directly transformed into E. coli Top10 competent cells after the reaction. After a single clone grew on the screening plate, colony PCR was performed to verify the correct transformant, and the plasmid was named pYE-TNC. Its plasmid map is shown in Figure 2 As shown, the sequence is SEQ ID NO.2.

[0062] Example 3

[0063] This example proposes a method for constructing the expression of Rhodotorula glutinosus, including the preparation of Rhodotorula glutinosus competent cells and the electroporation transformation process, specifically:

[0064] Pick a single colony of Rhodotorula glutinosus and culture it in 5 ml YPD medium at 30°C and 200 rpm shaking overnight. Subsequently, inoculate 100 μl of the overnight culture into 100 ml YPD medium and continue to culture at 30°C and 200 rpm for 8 hours. The cells were collected by centrifugation at 5000 g for 5 minutes at 4°C. The cell pellet was washed with 100 ml pre-cooled sterile water and then centrifuged at 5000 g for 5 minutes. The cells were resuspended in 5 ml pre-cooled 1 mol / L sorbitol solution and centrifuged again at 5000 g for 5 minutes. The final pellet was resuspended with 1 ml pre-cooled 1 mol / L sorbitol solution to obtain Rhodotorula glutinosus competent cells;

[0065] Mix 200 μl of resuspended cells with 10 μg of plasmid pYE-TNC (volume not exceeding 10 μl) and transfer to a pre-cooled 0.2 cm electroporation cuvette. Use a Bio-Rad electroporator for electroporation, with parameters set to 50 μF, 100-129Ω, 1.5 kV, and a pulse duration of 4-5 milliseconds. Immediately after electroporation, add 1 ml of pre-cooled sorbitol solution to the electroporation cuvette and transfer the mixture to a 1.5 ml microcentrifuge tube. The electroporation transformation process is as follows: Figure 3 shown.

[0066] The mixed solution containing Rhodotorula cells was placed in a 30°C constant temperature incubator for 3 hours to recover, then centrifuged at 5000g for 5 minutes, the supernatant was removed to obtain the bacterial precipitate, resuspended with 50 μl sterile water, and spread on a YPD agar plate containing geneticin. The plate was incubated at 30°C for 48 hours to obtain a positive single clone.

[0067] Example 4

[0068] In order to verify the high copy function of the plasmid prepared in Example 2, this example provides a method for preparing a Rhodotorula glutinosus strain with high-efficiency overexpression of a target gene, and the specific steps are as follows:

[0069] Select any target gene (in this example, the glutathione reductase encoding gene GLR1 of Rhodotorula glutinosus) and artificially synthesize a GLR1 expression cassette sequence with homology arms according to the nucleotide sequence of the glutathione reductase encoding gene GLR1 of Rhodotorula glutinosus reported in GenBank (GenBank: MF124332.1) and the TEF1 promoter and SUP4 terminator, the sequence of which is SEQ ID NO.9;

[0070] The multi-copy plasmid pYE-TNC prepared in Example 2 was used as a template and P2-F / P2-R were used as primers to perform PCR amplification to obtain a linearized plasmid fragment; wherein the sequence of P2-F is SEQ ID NO.7: gaattcgtaatcatggtcat, and the sequence of P2-R is SEQ ID NO.8: gagctcgcatgcccg;

[0071] PCR amplification system: PrimeSTAR Max Premix (2x) 25 μL, upstream and downstream primers 1.5 μL each, plasmid pYE-TNC 10 ng, add deionized water to the system to 50 μL, and mix well.

[0072] PCR reaction conditions: 98°C / 3 min, 1 cycle; 98°C / 10 sec, 55°C / 10 sec, 72°C / 30 sec, 32 cycles; 72°C / 5 min.

[0073] The linearized plasmid fragment and the target gene fragment with homologous sequence were assembled according to the system in the GenBuilder Cloning Kit User Manual of GenScript Company, reacted at 50℃ for 1-4h, and directly transformed into Escherichia coli Top10 competent cells after the reaction. After a single clone grows on the screening plate, colony PCR verification is performed to obtain the correct transformant, which is the multi-copy gene overexpression plasmid of Rhodotorula glutinosae with a gene expression cassette, named pYE-TNC-GLR1, and its structure is as follows Figure 4 As shown, the sequence is SEQ ID NO.10;

[0074] The electroporation transformation method of Example 3 was used to transform the Rhodotorula multi-copy gene overexpression plasmid carrying the GLR1 expression cassette into Rhodotorula Rm4 to obtain the strain Rm4-TGS.

[0075] In this example, two control groups were set up. Control group 1 was Rhodotorula glutinosus strain Rm4 without the plasmid transferred into it; and control group 2 was Rhodotorula glutinosus strain Rm4-TNC transferred into the plasmid pYE-TNC.

[0076] Rm4-TGS, Rm4 and Rm4-TNC were measured. The measurement method was as follows: total RNA of strains Rm4, Rm4-TNC and Rm4-TGS was extracted, reverse transcribed using a qRT-PCR kit (SYBR Green I), and the corresponding cDNA was obtained. This was used as a template, and the primer pair R1-F / R was used to perform relative quantitative analysis of the expression level of the GLR1 gene by Quant two-step fluorescence quantitative qRT-PCR (SYBR Green I). The experimental data were collected by LightCycler96 softwareSW 1.1 (Roche); the expression level differences of each gene were analyzed by the ΔCT calculation method. The ACT1 gene of Saccharomyces cerevisiae was used as a control, and normalization was finally performed. Each experiment was repeated three times. The results are shown in Table 1.

[0077] Table 1 Transcription levels of GLR1 in different strains

[0078] strains Rm4 Rm4-TNC Rm4-TGS GLR1 transcript levels 1.00±0.10 1.09±0.12 6.70±0.38

[0079] As can be seen from Table 1, the expression level of GLR1 in strain Rm4-TGS is 6.7 and 6.15 times that of the control strains Rm4 and Rm4-TNC, respectively, that is, compared with Rm4 and Rm4-TNC, the relative transcription level of GLR1 in strain Rm4-TGS is significantly increased, indicating that GLR1 expression is enhanced in strain Rm4-TGS. It further illustrates that the multi-copy plasmid constructed in this application can be used as a target gene overexpression plasmid of Rhodotorula glutinosus.

[0080] The embodiments described above are part of the embodiments of the present application, rather than all of the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the present application for protection, but merely represents the selected embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present application.

Claims

1. A multi-copy plasmid of Rhodotorula glutinosus, characterized in that: The multi-copy plasmid of Rhodotorula glutinosus is used for efficient expression of Rhodotorula glutinosus genes, and the specific sequence is SEQ ID NO.

2.

2. A method for constructing a multi-copy plasmid of Rhodotorula glutinosus according to claim 1, characterized in that: The following steps are involved: S1, screening geneticin as a resistance marker for wild red yeast; S2. Using plasmid YEp352 as a template and P1-F / P1-R as primers, PCR amplification was performed on plasmid YEp352 to obtain a linearized plasmid fragment; wherein the sequence of P1-F is SEQ ID NO.3, and the sequence of P1-R is SEQ ID NO.4; S3, using the DNA sequence of the artificially synthesized geneticin resistance expression cassette with homology arms as a template, the sequence is SEQ ID NO.1, and using G1-F / G1-R as primers for amplification to obtain the target gene fragment with homology sequences; wherein the sequence of G1-F is SEQ ID NO.5, and the sequence of G1-R is SEQ ID NO.6; S4. Assemble the above linearized plasmid fragments with the target gene fragment with homologous sequences, transform them into Escherichia coli Top10 competent cells, and finally identify positive colonies.

3. The method for constructing a multi-copy plasmid of Rhodotorula glutinosus according to claim 2, characterized in that: The PCR amplification system in step S2 is: PrimeSTAR Max Premix (2x) 25 μL, upstream and downstream primers 1.5 μL each, plasmid YEp352 10 ng, the system is supplemented to 50 μL with deionized water and mixed.

4. The method for constructing a multi-copy plasmid of Rhodotorula glutinosus according to claim 3, characterized in that: The PCR reaction conditions are: 98°C / 3min, 1 cycle; 98°C / 10sec, 55°C / 10sec, 72°C / 30sec, 32 cycles; 72°C / 5min.

5. The method for constructing a multi-copy plasmid of Rhodotorula glutinosus according to claim 2, characterized in that: After the assembly in step S4, the reaction is carried out at 50° C. for 1-4 hours.

6. A method for transforming Rhodotorula glutinosus, characterized in that: The following steps are involved: SA, pick a single colony of red yeast and culture it in YPD medium, then collect, centrifuge, wash and resuspend to obtain competent cells; SB. The multi-copy plasmid of claim 1 is transformed into competent cells by electroporation, and after recovery treatment, the cells are spread on YRD agar plates containing geneticin and cultured to obtain positive single clones.

7. The method for converting red yeast rice according to claim 6, characterized in that: The parameters of the electroporation in the SB step were set to 50 μF, 100-129 Ω, 1.5 kV, and a pulse duration of 4-5 ms.

8. A method for preparing a red yeast strain for efficiently overexpressing a target gene, characterized in that: The following steps are involved: SI, select any target gene in Rhodotorula to synthesize a gene fragment with homology arms; SII, using pYE-TNC as a template and P2-F / P2-R as primers for PCR amplification to obtain a linearized plasmid fragment; wherein the sequence of P2-F is SEQ ID NO.7, and the sequence of P2-R is SEQ ID NO.8; SIII. The gene fragment with homology arms and the linearized plasmid fragment are assembled in a ratio, and then transformed into Escherichia coli Top10 competent cells. After a single clone grows on the screening plate, colony PCR verification is performed to obtain the correct transformant, which is the multi-copy gene overexpression plasmid of Rhodotorula glutinosus with a gene expression cassette; SIV, transform the above plasmid into Rhodotorula glutinosus by electroporation to obtain a Rhodotorula glutinosus strain with high efficiency overexpression of the target gene.

9. The method for preparing the target gene highly-efficiently over-expressing Rhodotorula glutinosus strain according to claim 8, characterized in that: The target gene in the SI step is the glutathione reductase encoding gene GLR1 of Rhodotorula glutinosus, and the gene fragment sequence with homology arms is SEQ ID NO.9; the sequence of the Rhodotorula glutinosus multi-copy gene overexpression plasmid with a gene expression cassette in the SIII step is SEQ ID NO.10.

Images