Medicago truncatula polycardiac protein as well as coding gene and application thereof

Abstract

The invention discloses medicago truncatula polycardiac protein as well as a coding gene and application thereof. According to the invention, a Tnt1 insertion mutant with increased pericardium is found from a medicago truncatula Tnt1 insertion mutant library, and the control gene PCP of the phenotype with increased pericardium is cloned through flanking sequence analysis. In order to prove that the PCP is a multi-core control gene, the other two insertion mutants of the PCP gene are reversely screened in a mutant library, and the two mutants are found to have phenotypes which are completely the same as those of the previous mutants. The results prove that the PCP gene provided by the invention can indeed regulate and control the number of plant heart barks. The invention has important significance for research on development and evolution of floral organs and cultivation of high-yield and high-quality crops.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a Medicago truncatula multicarpel protein and a coding gene and application thereof. Background Art

[0002] The rich biological diversity of plants is reflected in the diversity of floral organ morphology. Flowers are reproductive organs unique to angiosperms. The normal development of floral organs is an important part of plant individual development and the key to reproduction. Although plant floral organs vary in appearance, their structural composition is highly specific and is generally composed of calyx, petals, stamens and carpels. Carpels, as the key to the development of female organs of angiosperms, provide an important place for the development of male and female gametophytes and the formation of fruits after fertilization, and play an important role in the establishment of yield traits. Therefore, studying the carpel development process is of great significance for high-yield and high-quality crop breeding.

[0003] Medicago truncatula belongs to the Fabaceae family, and its flowers are typical bilaterally symmetrical butterfly flowers. In the mutant library of Medicago truncatula, there are many types of floral organ mutants. Some mutants have abnormal floral organ numbers, such as loss, reduction or increase of petals, stamens, carpels and other structures; some mutants have incomplete floral organ development, such as pollen sacs that cannot open, immature pollen, incomplete carpel structure, etc., resulting in inability to fertilize and fruit. In past studies, many genes have been identified to form a complex regulatory network that is involved in the specialization of floral meristems and the formation of floral organ primordia. According to the "ABCDE" model of floral organ development, the specialization of floral organs requires the coordination of different types of genes. Functional studies of key regulatory genes in the inflorescence and flower development of legumes are essential for a better understanding of their roles in the evolutionary process. Summary of the invention

[0004] The purpose of the invention is to provide a protein related to the number of plant carpels and application thereof.

[0005] In the first aspect, the present invention protects a protein related to the number of plant carpels, the name of the protein is PCP, and the PCP protein is any one of the following (a1)-(a4):

[0006] (a1) the protein shown in Sequence 2 in the sequence listing;

[0007] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0008] (a3) a protein related to the number of plant carpels obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1);

[0009] (a4) A protein derived from alfalfa that has more than 98% identity with (a1) and is associated with the number of carpels in the plant.

[0010] In the protein described in (a2) above, the tag refers to a polypeptide or protein that is fused and expressed together with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0011] In the protein described in (a3) ​​above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0012] In the protein described in (a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated.

[0013] Any of the proteins described in (a1)-(a4) above can be synthesized artificially, or the encoding gene can be synthesized first and then expressed biologically.

[0014] In a second aspect, the present invention protects a nucleic acid molecule encoding a PCP protein.

[0015] The nucleic acid molecule is a DNA molecule as described in (b1) or (b2):

[0016] (b1) a DNA molecule shown in Sequence 1 or Sequence 3 in the sequence listing;

[0017] (b2) A DNA molecule derived from alfalfa and having 75% or more identity with (b1) and encoding the PCP protein.

[0018] A person skilled in the art can easily mutate the nucleotide sequence encoding the PCP protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the PCP nucleotide sequence isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the PCP protein and have the same function.

[0019] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0020] In a third aspect, the present invention protects an expression cassette, a recombinant vector or a recombinant microorganism containing the above-mentioned nucleic acid molecule.

[0021] The expression cassette refers to a DNA capable of expressing PCP protein in a host cell, and the DNA may include not only a promoter for initiating PCP transcription, but also a terminator for terminating PCP transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0022] The vector may be a plasmid, cosmid, phage or virus vector. The recombinant vector may be a vector containing a DNA molecule encoding PCP protein as shown in Sequence 1. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used may be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.) or chemical resistance marker genes (such as herbicide resistance genes), etc.

[0023] The recombinant microorganism may be yeast, bacteria, algae and fungi containing the above nucleic acid molecule or the above expression cassette or the above recombinant vector.

[0024] In a fourth aspect, the present invention protects new uses of the above-mentioned PCP protein or the above-mentioned nucleic acid molecule or the above-mentioned expression cassette, recombinant vector or recombinant microorganism.

[0025] The present invention protects the use of the PCP protein or the nucleic acid molecule or the expression cassette, recombinant vector or recombinant microorganism in regulating the number of plant carpels.

[0026] In a fifth aspect, the present invention protects novel uses of substances that inhibit the above-mentioned PCP proteins.

[0027] The present invention protects the use of the substance inhibiting the PCP protein in increasing the number of plant carpels or cultivating transgenic plants with increased carpel number.

[0028] The substance that inhibits the above-mentioned PCP protein may be a substance that inhibits or reduces the activity and / or content of PCP protein in plants.

[0029] Furthermore, the substance that inhibits or reduces the activity and / or content of PCP protein in plants may be a substance that inhibits the activity of the above-mentioned PCP protein, or a substance that inhibits the expression of a gene encoding the above-mentioned PCP protein, or a substance that knocks out a gene encoding the above-mentioned PCP protein.

[0030] The substance that inhibits the activity of the above-mentioned PCP protein can be any substance that can cause the loss of the activity of the above-mentioned PCP protein in plants, such as proteins, polypeptides or small molecule compounds (such as protein activity inhibitors) that inhibit the synthesis of the above-mentioned PCP protein or promote the degradation of the above-mentioned PCP protein or inhibit the function of the above-mentioned PCP protein.

[0031] The substance that inhibits the expression of the gene encoding the PCP protein can be any substance that can prevent the gene encoding the PCP protein in the plant from being expressed, such as a substance that silences the gene encoding the PCP protein in the plant (such as miRNA, siRNA, dsRNA, shRNA, etc.).

[0032] The substance for knocking out the gene encoding the PCP protein can be any substance that enables the host cell to not produce the functional protein product of the gene in any manner, such as removing all or part of the coding gene sequence, introducing a frameshift mutation so that no functional protein is produced, removing or changing regulatory components (such as promoter editing) so that the coding gene sequence is not transcribed, preventing translation by binding to mRNA, etc. Usually, the knockout is performed at the genomic DNA level, so that the offspring of the cell also permanently carry the knockout.

[0033] Furthermore, the substance for knocking out the gene encoding the above-mentioned PCP protein may be any substance that can cause the gene encoding the above-mentioned PCP protein in the plant to mutate (the mutation may be in the form of deletion mutation and / or insertion mutation and / or base substitution) and thereby lose its activity, such as zinc finger protein ZFN gene editing system or TALENs gene editing system or CRISPR / Cas9 gene editing system or biological mutagenesis system, etc.

[0034] Furthermore, the biological mutagenesis system may be a substance for T-DNA insertion, a substance for transposon insertion or a substance for retromer insertion.

[0035] In a specific embodiment of the present invention, the substance for retrotranscript insertion is a substance for Tnt1 retrotranscript insertion.

[0036] In a sixth aspect, the present invention protects a method for cultivating a transgenic plant with an increased number of carpels.

[0037] The method for cultivating transgenic plants with increased carpel number protected by the present invention comprises the steps of reducing the content and / or activity of PCP protein in a recipient plant to obtain a transgenic plant; the transgenic plant has a higher carpel number than the recipient plant.

[0038] Furthermore, the method for reducing the content and / or activity of PCP protein in a recipient plant comprises introducing the above-mentioned substance for reducing the content and / or activity of PCP protein into the recipient plant.

[0039] Furthermore, the substance that reduces the content and / or activity of PCP protein is a substance used for Tnt1 retrotransposon insertion.

[0040] In a specific embodiment of the present invention, the transgenic plant is a pcp-1 homozygous mutant or a pcp-2 homozygous mutant or a pcp-2 homozygous mutant.

[0041] The difference between the pcp-1 homozygous mutant and the wild-type Medicago truncatula R108 genome sequence is that the Tnt1 sequence is inserted between the 251st and 252nd positions of the PCP gene genome sequence (sequence 3), and the Tnt1 sequence is shown in sequence 4 in the sequence listing.

[0042] The difference between the pcp-2 homozygous mutant and the wild-type Medicago truncatula R108 genome sequence is that the Tnt1 sequence is inserted between the 656th and 657th positions of the PCP gene genome sequence (sequence 3), and the Tnt1 sequence is shown in sequence 4 in the sequence listing.

[0043] The difference between the pcp-3 homozygous mutant and the wild-type Medicago truncatula R108 genome sequence is that the Tnt1 sequence is inserted between the 759th and 760th positions of the PCP gene genome sequence (sequence 3), and the Tnt1 sequence is shown in sequence 4 in the sequence listing.

[0044] In a seventh aspect, the present invention provides a method for preparing a transgenic plant.

[0045] The method for preparing the transgenic plant provided by the present invention can be any one of the following c1)-c3):

[0046] c1) replacing the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule A to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule A is a DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 251 and 252 of sequence 3;

[0047] c2) replacing the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule B to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule B is a DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 656 and 657 of sequence 3;

[0048] c3) replacing the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule C to obtain a transgenic plant; the number of carpels in the transgenic plant is higher than that of the recipient plant; the DNA molecule C is a DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 759 and 760 of sequence 3.

[0049] Any of the above substitutions is a homozygous substitution, that is, the same substitution occurs in the homologous chromosome.

[0050] In any of the above uses or methods, the plant is any one of the following d1)-d5):

[0051] d1) monocots;

[0052] d2) dicotyledons;

[0053] d3) Leguminosae;

[0054] d4) Alfalfa;

[0055] d5) Medicago truncatula.

[0056] The present invention finds a Tnt1 insertion mutant with increased carpels from the Tnt1 insertion mutant library of Medicago truncatula, and clones the control gene PCP of the increased carpel phenotype through flanking sequence analysis. In order to prove that PCP is the control gene of multiple carpels, two other insertion mutants of the PCP gene were screened in the mutant library, and it was found that these two mutants showed the same phenotype as the previous mutants. The above results prove that the PCP gene in the present invention can indeed regulate the number of plant carpels. The present invention is of great significance for the research on the development and evolution of floral organs and the cultivation of high-yield and high-quality crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 The structure diagram of the PCP gene and the detection of PCP gene expression in mutants. A is the structure diagram of the PCP gene and the insertion position of the Tnt1 retrotransposon in three pcp mutants. B is the DNA level identification of pcp mutants. C is the RT-PCR detection of the expression of the PCP gene in wild-type Medicago truncatula R108 and pcp mutants.

[0058] Figure 2 The flower organ phenotypes of wild-type Medicago truncatula R108 and pcp mutants. A and C are top views of mature flowers of wild-type Medicago truncatula R108 and pcp mutants, respectively; B and D are side views of young flowers of wild-type Medicago truncatula R108 and pcp mutants, respectively; EI is an anatomical diagram of a mature flower of wild-type Medicago truncatula R108, with side views of sepals (E), standard petals (F), keel petals and wing petals (G), stamens (H) and carpels (I); JN is an anatomical diagram of a mature flower of a pcp mutant, with side views of sepals (J), standard petals (K), keel petals and wing petals (L), stamens (M) and carpels (N).

[0059] Figure 3 The results of carpel number statistics of wild-type Medicago truncatula R108 and pcp mutant. Error bars represent standard deviation (n=30), ** represents P≤0.01, which is extremely significant. DETAILED DESCRIPTION

[0060] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0061] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0062] The wild type Medicago truncatula R108 in the following examples is described in the document “WOX family transcriptional regulators modulate cytokinin homeostasis during leaf blade development in Medicago truncatula and Nicotiana sylvestris”.

[0063] Example 1. Obtaining PCP protein and its encoding gene

[0064] 1. RNA Extraction

[0065] The RNA of wild-type Medicago truncatula R108 was extracted by the following steps:

[0066] 1. Take about 0.1g of plant material and quickly put it into liquid nitrogen. After grinding the sample into powder with liquid nitrogen, immediately add 1mL Trizol and shake to mix. If there are a lot of samples, put them on ice first and wait for subsequent samples.

[0067] 2. Add 200 μL of chloroform, shake well, let stand at room temperature for 2 min, and centrifuge at 4°C and 12,000 × g for 10 min.

[0068] 3. Pipette the supernatant into a new 1.5 mL centrifuge tube, add 500 μL of isopropanol, mix by inversion, let stand at room temperature for 5 min, and centrifuge at 4°C and 12,000 × g for 15 min.

[0069] 4. Discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate, centrifuge at 7500 × g for 5 min at 4°C, and repeat this process.

[0070] 5. Leave it in the air for 2 minutes, use the gun tip to absorb all the ethanol, dry it at room temperature for 10 minutes or blow dry the ethanol on a clean bench.

[0071] 6. Add 30-50 μL DEPC H2O to dissolve. If the precipitate is large, oscillate to aid dissolution.

[0072] 7. After the precipitate is completely dissolved, take 1 μL and use NANO DROP 2000 to detect the concentration and purity of RNA. The remaining RNA is stored at -80°C.

[0073] 2. Reverse Transcription

[0074] The RNA extracted in step 1 was used as a template and reverse transcribed into cDNA using a kit from TRANS. The specific steps are as follows:

[0075] Add 5000ng RNA and 1μL Primer Oligo(dTs) to a 200μL centrifuge tube, add DEPC H2O to 8μL, mix well, and react in a PCR instrument. The reaction conditions are as follows: denaturation at 65℃ for 5min, ice bath for 2min. After the reaction is completed, add the following components in sequence: 2×Ts Uni Reaction Mix 10μL, RI Enzyme Mix 1μL, GDNA Remover 1μL, mix well, incubate at 50℃ for 30min, react at 85℃ for 5s, and store at -20℃ for later use.

[0076] 3. PCR Amplification

[0077] Using the cDNA obtained in step 2 as a template, a primer pair consisting of primer PCP-F and primer PCP-R was used for PCR amplification to obtain a PCR amplification product. The primer sequences are as follows:

[0078] PCP-F: 5'-ATGGCTTCATCAAATAGACACTG-3';

[0079] PCP-R: 5'-TTACATATTTAAGTCAACAAAGTCA-3'.

[0080] IV. PCR amplification product detection

[0081] The PCR amplification product obtained in step three is connected to the T vector and sequenced to obtain the coding region sequence (CDS sequence) of the PCP gene. The sequence is shown in sequence 1 in the sequence table, and its encoding sequence is the PCP protein shown in sequence 2 in the sequence table. The PCP protein consists of 458 amino acid residues.

[0082] The CDS sequence of the PCP gene was compared on the alfalfa website (http: / / blast.jcvi.org / Medicago-Blast / ) to obtain the genomic sequence of the PCP gene, which is shown as Sequence 3 in the sequence listing.

[0083] Example 2. Acquisition of pcp mutants and phenotypic analysis

[0084] The present invention finds a Tnt1 insertion mutant with increased carpels from the Tnt1 insertion mutant library of Medicago truncatula, and clones the control gene PCP of the increased carpel phenotype through flanking sequence analysis. In order to prove that PCP is the control gene of multiple carpels, two other insertion mutants of the PCP gene are screened in the mutant library, and it is found that these two mutants have the same phenotype as the previous mutants, indicating that the PCP gene is indeed the control gene of multiple carpels.

[0085] 1. Obtaining pcp mutants

[0086] 1. Obtaining multicarpel mutants

[0087] Three multicarpel mutants were obtained from the Medicago truncatula Tnt1 insertion mutant library (medicago-mutant.dasnr.okstate.edu), and the mutant numbers were NF15814, NF17106, and NF11628. The insertion positions of the Tnt1 retrotransposon in the three multicarpel mutants are shown in Figure 1 A.

[0088] 2. Screening of homozygous pcp mutants

[0089] The mutant seeds numbered NF15814, NF17106 and NF11628 purchased from the mutant library were gently ground with sandpaper and soaked in water for 1-2 days. After the roots appeared, they were planted in the soil. After growing for 3 weeks, genomic DNA was extracted and amplified with gene primers F / R and gene primers F or R and Tnt1 upper primer LRT, respectively, and homozygous mutants were screened according to the amplification results.

[0090] The sequence of the amplification primer (F+R / R+6) of the mutant numbered NF15814 is as follows:

[0091] Primer F:CTTGCCACAGAACCCCTT;

[0092] Primer R:GCAAACAGATGTTCAGATGTG;

[0093] LRT6:GCTACCAACCAAACCAAGTCAA.

[0094] If Primer F and Primer R do not expand the band, and Primer R and LRT6 expand the band, the mutant is a homozygous mutant numbered NF15814 and is recorded as pcp-1.

[0095] The sequence of the amplification primer (F+R / F+6) of the mutant numbered NF11036 is as follows:

[0096] Primer F:AGAAGTCCTGAGCCAAAGC;

[0097] Primer R:GCAAACAGATGTTCAGATGTG;

[0098] LRT6:GCTACCAACCAAACCAAGTCAA.

[0099] If Primer F and Primer R do not expand the band, and Primer F and LRT6 expand the band, the mutant is a homozygous mutant numbered NF11036 and is recorded as pcp-2.

[0100] The sequence of the amplification primer (F+R / R+6) of the mutant numbered NF11628 is as follows:

[0101] Primer F:AGAAGTCCTGAGCCAAAGC

[0102] Primer R:GCAAACAGATGTTCAGATGTG

[0103] LRT6:GCTACCAACCAAACCAAGTCAA

[0104] If Primer F and Primer R do not expand the band, and Primer R and LRT6 expand the band, the mutant is a homozygous mutant numbered NF11628 and is recorded as pcp-3.

[0105] The difference between the pcp-1 homozygous mutant and the wild-type Medicago truncatula R108 genome sequence is that the Tnt1 sequence is inserted between the 251st and 252nd positions of the PCP gene genome sequence (SEQ ID NO: 3). The Tnt1 sequence is shown in SEQ ID NO: 4 in the sequence listing.

[0106] The difference between the pcp-2 homozygous mutant and the wild-type Medicago truncatula R108 genome sequence is that the Tnt1 sequence is inserted between the 656th and 657th positions of the PCP gene genome sequence (sequence 3). The Tnt1 sequence is shown in sequence 4 in the sequence listing.

[0107] The difference between the pcp-3 homozygous mutant and the wild-type Medicago truncatula R108 genome sequence is that the Tnt1 sequence is inserted between the 759th and 760th positions of the PCP gene genome sequence (sequence 3). The Tnt1 sequence is shown in sequence 4 in the sequence listing.

[0108] 2. Molecular identification of pcp mutants

[0109] 1. Extraction of genomic DNA

[0110] 1) Take an appropriate amount of plant leaves (wild-type Medicago truncatula R108, pcp-1 homozygous mutant, pcp-2 homozygous mutant and pcp-3 homozygous mutant) and put them in a 2 mL centrifuge tube, add 100 μL CTAB to the centrifuge tube, and then grind the sample into powder at room temperature using a plant tissue grinder.

[0111] 2) Add 400 μL of CTAB to the centrifuge tube, mix thoroughly, and place in a 65°C water bath or air bath for 30 min, inverting the tube several times.

[0112] 3) After the mixture has cooled to room temperature, 500 μL of chloroform was added, the mixture was mixed by inversion, and centrifuged at 12,000 × g for 10 min.

[0113] 4) Pipette 400 μL of supernatant into a 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix by inversion, and centrifuge at 12,000 × g for 10 min.

[0114] 5) Discard the supernatant, add 1 mL of 75% ethanol, and centrifuge at 12,000 × g for 5 min.

[0115] 6) Discard the supernatant, centrifuge at 12000×g for 2 min, aspirate all the ethanol with a pipette, air-dry the precipitate, and dissolve it with 50 μL ddH2O.

[0116] 2. PCR amplification

[0117] Using the genomic DNA obtained in step 1 as a template, PCP F / R and PCP-F / LRT were used for PCR amplification. The primer sequences are as follows:

[0118] PCP-F:ATGGCTTCATCAAATAGACACTG;

[0119] PCP-R:TTACATATTTAAGTCAACAAAGTCA;

[0120] LRT6:GCTACCAACCAAACCAAGTCAA;

[0121] LRT31: CTCCTCTCTCGGGGTCGTGGTT.

[0122] The results are as follows Figure 1 As shown in B, PCP-F / PCP-R only amplified bands in wild-type Medicago truncatula R108; PCP-F / LRT amplified bands in three mutants. Compared with wild-type Medicago truncatula R108, pcp-1 homozygous mutant amplified a fragment of 711 bp using Tnt1 specific primer (LRT31) and PCP gene primer (PCP-F); pcp-2 homozygous mutant amplified a fragment of 1189 bp using Tnt1 specific primer (LRT6) and PCP gene primer (PCP-F); pcp-3 homozygous mutant amplified a fragment of 1219 bp using Tnt1 specific primer (LRT31) and PCP gene primer (PCP-F).

[0123] 3. Detection of expression level of pcp mutant

[0124] The cDNA of wild-type Medicago truncatula R108, pcp-1 homozygous mutant, pcp-2 homozygous mutant and pcp-3 homozygous mutant were used as templates, PCP-F / PCP-R primers were used for PCR amplification, and MtActin was used as an internal reference gene to detect the expression of PCP genes. The primer sequences are as follows:

[0125] PCP-F:CTTGCCACAGAAACCCCTT;

[0126] PCP-R:GGTCCAGATGCAACCTCA;

[0127] RT-MtActin-F:TCTTACTCTCAAGTACCCCATTGAGC;

[0128] RT-MtActin-R:GTGGGAGTGCATAACCCTCATAGATT.

[0129] The results are as follows Figure 1 As shown in C, compared with the wild-type Medicago truncatula R108, the PCP gene was not expressed in the three pcp mutants.

[0130] 4. Phenotypic analysis of pcp mutants

[0131] Flower buds with sepals flush with petals during the flowering period of wild-type Medicago truncatula R108 and three pcp mutants (pcp-1 homozygous mutant, pcp-2 homozygous mutant and pcp-3 homozygous mutant) were collected and dissected under a stereomicroscope. After a cut from the base of the flower, the sepals and petals were gently peeled off separately with hybrid tweezers. The carpel was wrapped in the middle of the stamen, and the carpel was carefully peeled off from the middle part of the stamen. Each organ was photographed, and the number of carpels was counted.

[0132] Phenotypic observations Figure 2 As shown in the figure, it can be seen that compared with the wild-type Medicago truncatula R108, the number of carpels of the pcp mutant has increased. Further statistical analysis of the number of carpels of the wild-type Medicago truncatula R108 and the pcp mutant found that the number of carpels of the wild-type Medicago truncatula R108 was 1, the number of carpels of the pcp-1 homozygous mutant was 3, the number of carpels of the pcp-2 homozygous mutant was 3.1, and the number of carpels of the pcp-3 homozygous mutant was 2.5. Compared with the wild-type Medicago truncatula R108, the number of carpels of the three pcp mutants increased significantly ( Figure 3 ).

[0133] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A protein, which is the protein described in any one of the following (a1)-(a4): (a1) the protein shown in Sequence 2 in the sequence listing; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) a protein related to the number of plant carpels obtained by substituting and / or deleting and / or adding one or more amino acid residues in (a1); (a4) A protein derived from alfalfa that has more than 98% identity with (a1) and is associated with the number of carpels in the plant.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is a DNA molecule as described in (b1) or (b2): (b1) a DNA molecule shown in Sequence 1 or Sequence 3 in the sequence listing; (b2) A DNA molecule derived from alfalfa and having 75% or more identity with (b1) and encoding the protein.

4. An expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1, the nucleic acid molecule according to claim 2, or the expression cassette, recombinant vector or recombinant microorganism according to claim 3 in regulating the number of plant carpels.

6. Use of a substance that inhibits the protein described in claim 1 in increasing the number of plant carpels or cultivating transgenic plants with increased carpel numbers; the substance that inhibits the protein described in claim 1 is a substance that inhibits or reduces the activity and / or content of the protein described in claim 1 in plants.

7. A method for cultivating transgenic plants with increased carpel number, comprising the step of reducing the content and / or activity of the protein according to claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant.

8. The method according to claim 7, characterized in that: The method for reducing the content and / or activity of the protein of claim 1 in a recipient plant comprises introducing a substance that reduces the content and / or activity of the protein of claim 1 into the recipient plant; Alternatively, the substance that reduces the content and / or activity of the protein according to claim 1 is a substance that inhibits the activity of the protein according to claim 1 or a substance that inhibits the expression of the gene encoding the protein according to claim 1 or a substance that knocks out the gene encoding the protein according to claim 1.

9. A method for preparing a transgenic plant, which is any one of the following c1) to c3): c1) replacing the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule A to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule A is a DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 251 and 252 of sequence 3; c2) replacing the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule B to obtain a transgenic plant; the transgenic plant has a higher number of carpels than the recipient plant; the DNA molecule B is a DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 656 and 657 of sequence 3; c3) replacing the DNA molecule shown in sequence 3 in the recipient plant with DNA molecule C to obtain a transgenic plant; the number of carpels in the transgenic plant is higher than that of the recipient plant; the DNA molecule C is a DNA molecule obtained by inserting the DNA molecule shown in sequence 4 between positions 759 and 760 of sequence 3.

10. The use according to claim 5 or 6 or the method according to any one of claims 7 to 9, characterized in that: The plant is any one of the following d1)-d5): d1) monocots; d2) dicotyledons; d3) Leguminosae; d4) Alfalfa; d5) Medicago truncatula.

Images