Function and application of artemisia apiacea transcription factor AaMYC3

Abstract

The invention discloses an artemisia apiacea transcription factor AaMYC3 with an amino acid sequence as shown in SEQ ID NO: 2 and application of the artemisia apiacea transcription factor AaMYC3. The Artemisia apiacea transcription factor AaMYC3 not only can be combined with and activate promoters of artemisinin biosynthesis key enzyme genes CYP71AV1 and ALDH1, but also can be combined with and activate a promoter of an Artemisia apiacea glandular hair development key gene AaHD1, and can act together with AabHLH1 and AabHLH113 to activate ADS and DBR2 gene promoters. Biosynthesis of artemisinin is promoted by positively regulating and controlling artemisinin biosynthase genes and glandular hair body density, and the method is of great significance to cultivation of new varieties with high artemisinin content and large-scale production.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering, and in particular relates to the function of an artemisia annua transcription factor AaMYC3 and its application in promoting artemisinin biosynthesis and cultivating new artemisia annua varieties. Background Art

[0002] Glandular trichomes play an important role in plants and are important organs for resisting external stress and promoting the biosynthesis of various secondary metabolites (Feng et al., 2021; Handley et al., 2005; Schilmiller et al., 2008; Schuurink and Tissier, 2020). For example, tomato glandular trichomes biosynthesize a variety of terpenoids to resist pathogens and herbivores (Huang and Osbourn, 2019; Yang et al., 2021); cotton resists pests by regulating the accumulation of glandular trichome gossypol (Gao et al., 2020; Lin et al., 2023); alkane metabolism in tobacco glandular trichomes affects cold resistance (Yu et al., 2022). It is worth noting that in medicinal plants, glands play an important role in the biosynthesis of secondary metabolism (Tang et al., 2022). For example, coltsfoot synthesizes and stores polyphenols and flavonoids in its glandular trichomes (Muravnik et al., 2016). Other well-known examples of obtaining valuable natural products from glandular secretory trichomes (GSTs) include the biosynthesis of alkaloids in Withania somnifera L. (Munien et al., 2015) and the biosynthesis of artemisinin in Artemisia annua L. (Cao et al., 2023; Yan et al., 2017; Yan et al., 2018).

[0003] The molecular mechanisms of plant glandular trichome development and secondary metabolism biosynthesis form an inseparable unity (McConkey et al., 2000). The GL1-GL3 / EGL3-TTG1 (MBW) complex model activates the downstream HD-Zip gene GL2 to promote glandular trichome growth, which may represent a general mechanism for glandular trichome development (Cui et al., 2022; Wang et al., 2019), especially for non-glandular trichomes (NGTs). Despite the differences between GSTs, HD-ZIP genes still play a central role in the development of GSTs in horticultural crops such as tomato (Hua et al., 2021; Wu et al., 2024) and Artemisia annua (Xie et al., 2021b). NGTs provide mechanical protection and defense against various stresses for plants (Karabourniotis et al., 2020; Kaur and Kariyat, 2020), while GSTs mainly serve as secondary metabolism sites in most plants, especially the biosynthesis of terpenoids (Wang et al., 2008). Terpenoids secreted by hop GSTs give beer flavor and aroma, while lavender GSTs produce volatile terpenoids (Wang et al., 2008; Zhang et al., 2023). Volatile terpenoids are closely related to the development of glandular hairs in tomatoes (Spyropoulou et al., 2014). SlEOT1 is a transcription factor (TF) specifically expressed in GSTs, which directly regulates TPS5 to promote terpene biosynthesis in tomatoes (Spyropoulou et al., 2014). JA-induced SlMYC1 and SlMYC2 play dual roles in specialized metabolism induced by tomato stress (Swinnen et al., 2022). In addition, SlMYC1 actively regulates glandular trichome formation and terpene biosynthesis and is a key integrator of trichome development and terpene metabolism (Xu et al., 2018). In addition, cotton GoPGF not only regulates pigment gland activation, but also directly activates downstream targets to regulate cottonphenol biosynthesis (Ma et al., 2016).

[0004] Artemisinin is a sesquiterpene lactone synthesized in GSTs of Artemisia annua and is widely used for malaria treatment. GST cells are composed of 10 complex cells (Olofsson et al., 2012), which continuously synthesize and store artemisinin during development. Studies have shown that AaHD1 is a core factor controlling GST density, which coexists between NGT and GST (Hassani et al., 2020; Wang et al., 2019). The difference is that AaMYB16 and AaMYB5 interact with AaHD1 to promote and inhibit GST density, respectively (Xie et al., 2021b). In addition, AaGSW2 was identified as an important downstream target gene of AaHD1, which has a great influence on the initiation of GST (Xie et al., 2021a). However, these genes are not directly involved in artemisinin biosynthesis, because artemisinin biosynthesis is regulated by transcription factors (TFs) specifically expressed in GST, such as AabHLH1 and AabHLH113 (Ji et al., 2014; Yuan et al., 2023). Although the mechanisms of glandular trichome development and artemisinin biosynthesis in A. annua have been extensively studied, the relationship between them remains unclear, indicating that there is still a gap in the understanding of the regulatory network between the two. Summary of the invention

[0005] In the study of artemisinin biosynthesis, we discovered a new transcription factor, named AaMYC3, which enhances the expression of AaHD1 by binding and activating the promoter of AaHD1, thereby promoting GST density. At the same time, AaMYC3, as a TF regulating CYP71AV1 and ALDH1, promotes a specific pathway for artemisinin biosynthesis, while interacting with AabHLH1 and AabHLH113 to transcribe ADS and DBR2 as a co-activator. The results of the study revealed the genetic relationship between GSTs development and artemisinin biosynthesis, which may be a potential candidate gene for improving Artemisia annua. Based on the research results, the present invention includes the following technical solutions.

[0006] The first aspect of the present invention provides a polypeptide, wherein the polypeptide is selected from the following group:

[0007] (a) a polypeptide with an amino acid sequence as shown in SEQ ID NO: 2, which is the Artemisia annua transcription factor AaMYC3 or Artemisia annua transcription factor AabHLH78;

[0008] (b) a polypeptide derived from (a) which is formed by substituting, deleting or adding one or more amino acid residues of the amino acid sequence SEQ ID NO: 2 and has the function of the polypeptide of (a);

[0009] (c) a polypeptide derived from (a) that has 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, and more preferably 99% or more homology with the polypeptide sequence defined in (a), and has the function of the polypeptide of (a); or

[0010] (d) A derivative polypeptide having a sequence containing the polypeptide sequence described in (a) or (b) or (c).

[0011] The second aspect of the present invention provides a polynucleotide, wherein the polynucleotide is selected from the group consisting of:

[0012] (A) a polynucleotide encoding the above polypeptide;

[0013] (B) a polynucleotide encoding a polypeptide with an amino acid sequence as shown in SEQ ID NO: 2, i.e., a gene encoding the Artemisia annua transcription factor AaMYC3 or Artemisia annua transcription factor AabHLH78;

[0014] (C) a polynucleotide whose nucleotide sequence is shown in SEQ ID NO: 1;

[0015] (D) a polynucleotide having a nucleotide sequence homology of ≥95%, preferably ≥96%, preferably ≥97%, preferably ≥98%, more preferably ≥99% to the nucleotide sequence of SEQ ID NO: 1;

[0016] (E) A nucleotide sequence complementary to the nucleotide sequence described in any one of (A) to (D).

[0017] The third aspect of the present invention provides a DNA molecule comprising the polynucleotide as described above, for example, an expression cassette / expression frame of Artemisia annua transcription factor AaMYC3 or Artemisia annua transcription factor AabHLH78.

[0018] The fourth aspect of the present invention provides a recombinant plasmid comprising the above DNA molecule, wherein the recombinant plasmid is an overexpression vector formed by cloning the above DNA molecule into a plasmid vector suitable for expression in Agrobacterium, and the plasmid vector is, for example, pHB-YFP, pHB-FLAG, pBin19, fluorescent reporter vector pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121, pTF102 and other vectors for plant transgenics or modified vectors.

[0019] The fourth aspect of the present invention provides a microbial engineering bacterium, which is a transformant containing the above-mentioned recombinant plasmid, and is used to mediate the above-mentioned recombinant plasmid into a plant producing artemisinin, such as Artemisia annua or tobacco, and preferably the microorganism is Agrobacterium, such as Agrobacterium tumefaciens, Agrobacterium EHA105, Agrobacterium GV3101. For example, the above-mentioned recombinant plasmid is transferred into the Agrobacterium strain by freeze-thaw method to form a microbial engineering bacterium.

[0020] The fifth aspect of the present invention provides the use of the above-mentioned polypeptide, the above-mentioned polynucleotide, the above-mentioned DNA molecule or the above-mentioned recombinant plasmid in promoting the biosynthesis of artemisinin, or in cultivating new varieties of Artemisia annua.

[0021] In one embodiment, the above application is to promote the biosynthesis of artemisinin in an artemisinin producer such as artemisia annua or transgenic tobacco, or an artemisinin-expressing cell (such as an artemisinin plant cell or an artemisinin-expressing microbial engineered bacterium) by the following method:

[0022] (i) allowing the polynucleotides described above, such as the gene encoding the artemisinin transcription factor AaMYC3 (or AabHLH78), to directly bind to and activate the expression of the promoters of the key enzyme genes CYP71AV1 and / or ALDH1 in the biosynthesis of artemisinin, thereby positively regulating the expression of the CYP71AV1 and ALDH1 genes; and / or

[0023] (ii) allowing the polynucleotide as described above, such as the gene encoding the Artemisia annua transcription factor AaMYC3, to directly bind to and activate the expression of the promoter of the key gene AaHD1 for the development of glandular trichomes in Artemisia annua; and / or

[0024] (iii) allowing the polypeptides described above, such as the Artemisia annua transcription factor AaMYC3, to interact with AabHLH1 to activate the ADS gene promoter (Ampha-4,11-diene Synthase, ADS); and / or

[0025] (iv) allowing the polypeptides described above, such as the Artemisia annua transcription factor AaMYC3, to interact with AabHLH113 to activate the DBR2 gene promoter (Artemisinic aldehydeΔ11(13) reductase).

[0026] As a specific implementation, the above method (i) can be implemented by the following steps:

[0027] (i-1) connecting the polynucleotide described above, such as the nucleotide sequence of the transcription factor AaMYC3 encoding gene SEQ ID NO: 1, to a plant regulatory expression sequence vector such as pHB-YFP, to construct a plant regulatory expression vector such as pHB-YFP-AaMYC3 containing the polynucleotide, such as the transcription factor AaMYC3 encoding gene,

[0028] (i-2) The promoters ProCYP71AV1 and ProALDH1 of the key enzyme genes CYP71AV1 and ALDH1 in the biosynthesis of artemisinin were inserted into the vector pGreenII0800-LUC, respectively, to construct plant dual luciferin detection reporter vectors pGreenII0800-ProCYP71AV1-LUC and pGreenII0800-ProALDH1-LU.

[0029] (i-3) respectively transferring the plant regulatory expression vector described in step (i-1), such as pHB-YFP-AaMYC3, and the plant dual luciferin detection reporter vector described in step (i-2) into an engineering strain Agrobacterium, such as GV3101, to obtain an engineering strain containing the plant regulatory expression vector and the plant dual luciferin detection reporter vector,

[0030] (i-4) mixing the engineered strain containing the plant regulatory expression vector described in step (i-3) with the engineered strain containing the plant dual fluorescein detection reporter vector at a bacterial liquid volume ratio of approximately 1:1, injecting the mixture into tobacco, detecting the fluorescence intensity, and determining the binding and activation effect of the polynucleotide described above, such as the transcription factor AaMYC3 encoding gene SEQ ID NO:1, with the promoters of the key enzyme genes CYP71AV1 and ALDH1 in the biosynthesis of artemisinin,

[0031] (i-5) Artificially synthesized primer probes of CYP71AV1 and ALDH1 promoters, and the binding ability of MBP-AaMYC3 to CYP71AV1 and ALDH1 promoters was verified by DNA gel shift assay (EMSA).

[0032] The above method (ii) can be implemented by the following steps:

[0033] (ii-1) connecting the polynucleotide as described above, such as the nucleotide sequence of the transcription factor AaMYC3 encoding gene SEQ ID NO: 1, to a plant regulatory expression sequence vector such as pHB-YFP, to construct a plant regulatory expression vector such as pHB-YFP-AaMYC3 containing the polynucleotide, such as the transcription factor AaMYC3 encoding gene;

[0034] (ii-2) inserting the promoter ProAaHD1 of the key enzyme gene AaHD1 for the development of glandular trichomes in Artemisia annua into the vector pGreenII0800-LUC to construct the plant dual luciferin detection reporter vector pGreenII0800-ProAaHD1-LUC;

[0035] (ii-3) respectively transferring the plant regulated expression vector described in step (ii-1), such as pHB-YFP-AaMYC3, and the plant dual luciferin detection reporter vector described in step (ii-2) into an engineering strain Agrobacterium, such as GV3101, to obtain an engineering strain containing the plant regulated expression vector and the plant dual luciferin detection reporter vector;

[0036] (ii-4) mixing the engineered strain containing the plant regulatory expression vector described in step (ii-3) with the engineered strain containing the plant dual fluorescein detection reporter vector at a bacterial liquid volume ratio of approximately 1:1, injecting the mixture into tobacco, detecting the fluorescence intensity, and determining the binding and activation effect of the polynucleotide described above, such as the transcription factor AaMYC3 encoding gene SEQ ID NO: 1, and the promoter of the key enzyme gene AaHD1 for glandular trichome development in Artemisia annua;

[0037] (ii-5) The primer probe of AaHD1 promoter was artificially synthesized, and the binding ability of MBP-AaMYC3 to AaHD1 promoter was verified by DNA gel shift assay (EMSA).

[0038] The above method (iii) can be implemented by the following steps:

[0039] (iii-1) inserting the polynucleotide as described above, for example, the nucleotide sequence of the transcription factor AaMYC3 encoding gene SEQ ID NO: 1, into a protein expression vector such as pMAL-c5X to construct a recombinant protein expression vector such as pMAL-c5X-AaMYC3; inserting the gene sequence of AabHLH1 (NCBI accession number MH349477) into the protein expression vector pET-32a+ or pHB-YFP to construct an AabHLH1 protein expression vector pET-32a+-AabHLH1 or pHB-YFP-AabHLH1;

[0040] (iii-2) inserting the promoter ProADS of the key enzyme gene ADS in artemisinin biosynthesis into the vector pGreenIII0800-LUC to construct the plant dual luciferin detection reporter vector pGreenIII0800-ProADS-LUC;

[0041] (iii-3) respectively transferring the recombinant protein expression vectors described in step (iii-1), such as pMAL-c5X-AaMYC3 and the AabHLH1 protein expression vector pET-32a+-AabHLH1 or pHB-YFP-AabHLH1, and the plant dual fluorescein detection reporter vector in step (iii-2) into engineering strains Agrobacterium, such as GV3101, to obtain engineering strains containing recombinant protein expression vectors, such as pMAL-c5X-AaMYC3, the AabHLH1 protein expression vector pET-32a+-AabHLH1, and the plant dual fluorescein detection reporter vector;

[0042] (iii-4) mixing the engineered strain containing the recombinant protein expression vector such as pMAL-c5X-AaMYC3 described in step (iii-3), the engineered strain containing the AabHLH1 protein expression vector pET-32a+-AabHLH1 or pHB-YFP-AabHLH1, and the engineered strain containing the plant dual fluorescein detection reporter vector in a bacterial liquid volume ratio of approximately 1:1:2, and injecting them into tobacco, detecting the fluorescence intensity, and determining the binding and activation effect of the polynucleotide described above, such as the transcription factor AaMYC3 encoding gene SEQ ID NO:1, with the ADS promoter,

[0043] (iii-5) The primer probe of ADS promoter was artificially synthesized, and the fusion proteins MBP-AaMYC3 and His-AabHLH1 were obtained by purification. The binding ability of MBP-AaMYC3 and His-AabHLH1 to ADS promoter was verified by DNA gel shift assay (EMSA).

[0044] The above method (iv) can be implemented by the following steps:

[0045] (iv-1) inserting the polynucleotide as described above, for example, the nucleotide sequence of the transcription factor AaMYC3 encoding gene SEQ ID NO: 1, into a protein expression vector such as pMAL-c5X to construct a recombinant protein expression vector such as pMAL-c5X-AaMYC3; inserting the gene sequence of AabHLH113 (NCBI accession number OP103717) into the protein expression vector pMAL-c5X or pHB-YFP to construct an AabHLH113 protein expression vector pMAL-c5X-AabHLH113 or pHB-YFP-AabHLH113;

[0046] (iv-2) Inserting the promoter ProDBR2 of the key enzyme gene DBR2 in artemisinin biosynthesis into the vector pGreenIV0800-LUC to construct the plant dual luciferin detection reporter vector pGreenIV0800-ProDBR2-LUC;

[0047] (iv-3) respectively transferring the recombinant protein expression vectors described in step (iv-1), such as pMAL-c5X-AaMYC3 and the AabHLH113 protein expression vector pMAL-c5X-AabHLH113 or pHB-YFP-AabHLH113, and the plant dual fluorescein detection reporter vector in step (iii-2) into engineering strains Agrobacterium, such as GV3101, to obtain engineering strains containing recombinant protein expression vectors, such as pMAL-c5X-AaMYC3, the AabHLH113 protein expression vector pMAL-c5X-AabHLH113 or pHB-YFP-AabHLH113, and the plant dual fluorescein detection reporter vector;

[0048] (iv-4) mixing the engineered strain containing the recombinant protein expression vector such as pMAL-c5X-AaMYC3, the engineered strain containing the AabHLH113 protein expression vector pMAL-c5X-AabHLH113, and the engineered strain containing the plant dual fluorescein detection reporter vector described in step (iii-3) at a bacterial liquid volume ratio of approximately 1:1:2, and injecting them into tobacco, detecting the fluorescence intensity, and determining the binding and activation effect of the polynucleotide described above, such as the transcription factor AaMYC3 encoding gene SEQ ID NO:1, with the DBR2 promoter,

[0049] (iv-5) The primer probe of DBR2 promoter was artificially synthesized, and the fusion proteins MBP-AaMYC3 and MBP-AabHLH113 were obtained by purification. The binding ability of MBP-AaMYC3 and MBP-AabHLH113 to DBR2 promoter was verified by DNA gel shift assay (EMSA).

[0050] As for the primer probes used in the above application, the E-box and G-box element sequences in the CYP71AV1, ALDH1 and AaHD1 promoters and their synthetic biotin-labeled fragments can be used as probes, and the unlabeled fragments can be used as competitive probes. At the same time, these sequences can be mutated and biotin-labeled fragments can be synthesized as competitive probes, wherein

[0051] The sequence of the primer probe pCYP71AV1-Ebox-F of the CYP71AV1 promoter is as follows:

[0052] CAAGCCTCTCATGTATTATACAACTGACATCTTGTTTTTATCATCA (SEQ ID NO: 3),

[0053] The sequence of pCYP71AV1-mEbox-F is as follows:

[0054] CAAGCCTCTCATGTATTATACTTTTGACATCTTGTTTTTATCATCA(SEQ ID NO:4);

[0055] The sequence of the primer probe pALDH1-Ebox-F of the ALDH1 promoter is as follows:

[0056] CTGGCCCCACCGTAAACAATCAAATGCCTTTTGTTTTCATATTTTG (SEQ ID NO: 5);

[0057] The sequence of pALDH1-mEbox-F is as follows:

[0058] CTGGCCCCACCGTAAACAATCTTTTGCCTTTTGTTTTCATATTTTG (SEQ ID NO: 6);

[0059] The sequence of the primer probe pAaHD1-Gbox-F of the AaHD1 promoter is as follows:

[0060] AGCAAATAAGATAATGCCACGTGTATGAAACAGCCATGTAGGTCAA (SEQ ID NO: 7);

[0061] The sequence of pAaHD1-mGbox-F is as follows:

[0062] AGCAAATAAGATAATGCCTTTTGTATGAAACAGCCATGTAGGTCAA (SEQ ID NO: 8).

[0063] The E-box element sequences in the ADS and DBR2 promoters and their synthetic biotin-labeled fragments were used as probes, and the unlabeled fragments were used as competitive probes. These sequences were mutated and the biotin-labeled fragments were synthesized as competitive probes.

[0064] The sequence of the primer probe pADS-3×Ebox-F of the ADS promoter is as follows:

[0065] CATATGATTACATGTGATTACAAATG (SEQ ID NO: 9);

[0066] The sequence of the primer probe pDBR2-Ebox-F of the DBR2 promoter is as follows:

[0067] GTTAGAAATTTTTTTCGTGACATGTGAAATTTTTTTTGACCGCTTT (SEQ ID NO: 10).

[0068] In one embodiment, the above application is to transform Artemisia annua plants with a plant overexpression vector containing the gene encoding the Artemisia annua transcription factor AaMYC3 to obtain transgenic plants to achieve the creation of new Artemisia annua varieties with high artemisinin yields. Specifically, the cultivation of new Artemisia annua varieties with high artemisinin yields is achieved by a method comprising the following steps, which is used to create Artemisia annua germplasm resources with high artemisinin yields:

[0069] (I) connecting the polynucleotide as described above, such as the nucleotide sequence of the transcription factor AaMYC3 encoding gene SEQ ID NO: 1, to a plant overexpression sequence vector such as pHB-FLAG, to construct a plant overexpression vector such as pHB-FLAG-AaMYC3 containing the polynucleotide, such as the nucleotide sequence of the transcription factor AaMYC3 encoding gene SEQ ID NO: 1;

[0070] (II) transferring the plant overexpression vector described in step (I) into a host strain Agrobacterium, such as EHA105, to obtain an engineered strain containing the plant overexpression vector, such as pHB-FLAG-AaMYC3, and transforming the initial Artemisia annua plant through Agrobacterium-mediated transformation to obtain a regenerated Artemisia annua plant;

[0071] (III) screening the transgenic positive plants of the regenerated Artemisia annua described in step (II) to obtain overexpression transgenic plants whose artemisinin content is increased by more than 10%, preferably more than 20%, preferably more than 30%, preferably more than 40%, preferably more than 50%, more preferably more than 100% as compared with the initial Artemisia annua plants and / or whose glandular trichome density is increased by more than 10%, preferably more than 15%, preferably more than 20%, preferably more than 25%, preferably more than 30%, more preferably more than 50% as compared with the initial Artemisia annua plants.

[0072] Optionally, the above method further comprises a comparative method for verifying the function of transcription factor AaMYC3, comprising the following steps:

[0073] (I') connecting the polynucleotide as described above, such as the nucleotide sequence of the transcription factor AaMYC3 encoding gene SEQ ID NO: 1, to a plant RNA interference sequence vector such as pBin19, to construct a plant RNA interference expression vector such as pBin19-AaMYC3 containing the polynucleotide, such as the nucleotide sequence of the transcription factor AaMYC3 encoding gene SEQ ID NO: 1;

[0074] (II') transferring the plant RNA interference expression vector described in step (I') into a host strain Agrobacterium, such as EHA105, to obtain an engineered strain containing the plant RNA interference expression vector, such as pBin19-AaMYC3, and transforming the initial Artemisia annua plant through Agrobacterium-mediated transformation to obtain a regenerated Artemisia annua plant;

[0075] (III') screening the transgenic positive plants of the regenerated Artemisia annua described in step (II') to obtain RNA interference transgenic plants whose artemisinin content and / or glandular trichome density are lower than those of the initial Artemisia annua plants.

[0076] Preferably, the method of transferring the host strain in step (II) or (II') above adopts freeze-thaw method; and / or

[0077] In the above step (III) or (III'), hygromycin is used to screen the regenerated Artemisia annua.

[0078] Regarding the mixing ratio between the above-mentioned engineering strains containing different expression vectors, it should be understood that when expressing numerical characteristics herein, the term "approximately" or "around" means that the represented number may have an error range or floating range of ±10%, ±9%, ±8%, ±7%, ±6% or ±5%.

[0079] The newly discovered artemisia annua transcription factor AaMYC3 or artemisia annua transcription factor AabHLH78 of the present invention can not only positively regulate the artemisinin biosynthetic enzyme genes CYP71AV1 and ALDH1 to regulate the biosynthesis of artemisinin, but also regulate the density increase of artemisinin glandular trichomes, and jointly promote the accumulation of artemisinin in artemisia annua; in addition, AaMYC3 and AabHLH1 jointly activate the ADS gene promoter, and can also jointly activate the DBR2 gene promoter with AabHLH113, and the activity after this joint activation is significantly stronger than the activity of AabHLH1 and AabHLH113 activating the ADS and DBR2 gene promoters separately, indicating that AaMYC3 is a very advantageous gene for creating artemisinin-rich artemisinin germplasm resources. Therefore, the transcription factor AaMYC3 provided by the present invention can be used as a metabolic engineering breeding target for artemisia annua, which is of great significance for cultivating new varieties with high artemisinin content and large-scale production. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Figure 1A schematic diagram showing that transient transformation of tobacco with AaMYC3 significantly enhanced the dual luciferase activity of the CYP71AV1 gene promoter, ALDH1 gene promoter, and AaHD1 gene promoter, as well as the binding effect on these three promoters. A: AaMYC3 activates the dual luciferase activity of the CYP71AV1 gene promoter; B: AaMYC3 activates the dual luciferase activity of the ALDH1 gene promoter; C: AaMYC3 activates the dual luciferase activity of the AaHD1 gene promoter; D: AaMYC3 binds to the CYP71AV1 gene promoter; E: AaMYC3 binds to the ALDH1 gene promoter; F: AaMYC3 binds to the AaHD1 gene promoter.

[0081] Figure 2 A schematic diagram of the transient transformation of tobacco AaMYC3 by acting together with AabHLH1 and AabHLH113 or acting alone to activate the dual luciferase activity of the ADS and DBR2 gene promoters, as well as the binding effect on the two promoters. A: AaMYC3 activates the dual luciferase activity of the ADS gene promoter by acting together with AabHLH1 or acting alone; B: AaMYC3 activates the dual luciferase activity of the DBR2 gene promoter by acting together with AabHLH113 or acting alone; C: AaMYC3 acts together with AabHLH1 and AabHLH113 on the ADS gene promoter and the binding effect on the DBR2 gene promoter.

[0082] Figure 3 The following are the gene expression detection diagrams and artemisinin content diagrams of AaMYC3 transgenic Artemisia annua plants. A: Relative expression of AaMYC3 gene in AaMYC3 overexpressing transgenic Artemisia annua (OE-AaMYC3) and wild-type Artemisia annua (WT); B: Artemisinin content of AaMYC3 gene in AaMYC3 overexpressing transgenic Artemisia annua and wild-type Artemisia annua; C: Relative expression of AaMYC3 gene in RNA interference AaMYC3 transgenic Artemisia annua (RNAi-AaMYC3) and wild-type Artemisia annua (WT); D: Artemisinin content of AaMYC3 gene in RNA interference AaMYC3 transgenic Artemisia annua and wild-type Artemisia annua).

[0083] Figure 4The density observation and statistics of glandular trichomes in AaMYC3 transgenic A. annua plants. A: The density of glandular trichomes in AaMYC3 transgenic A. annua plants with overexpression and RNA interference and wild-type A. annua plants were observed by fluorescence microscope, scale: 200 mm; B: The density statistics of glandular trichomes in AaMYC3 transgenic A. annua plants with overexpression and RNA interference and wild-type A. annua plants; C: The density statistics of glandular trichomes in AaMYC3 transgenic A. annua plants with RNA interference and wild-type A. annua plants. DETAILED DESCRIPTION

[0084] We discovered for the first time that the transcription factor AaMYC3, or Artemisia annua transcription factor AabHLH78 (amino acid sequence as shown in SEQ ID NO: 2, nucleotide sequence of the encoding gene as shown in SEQ ID NO: 1), promotes the biosynthesis of artemisinin by positively regulating artemisinin biosynthetic enzyme genes and glandular trichome density, suggesting that the transcription factor AaMYC3 can be used as a metabolic engineering breeding target for Artemisia annua.

[0085] The results showed that AaMYC3 can positively regulate the artemisinin biosynthetic enzyme genes CYP71AV1 and / or ALDH1 and thus regulate the biosynthesis of artemisinin, increase the density of glandular trichomes in Artemisia annua, thereby promoting the accumulation of artemisinin in Artemisia annua and increasing artemisinin yield, activate the ADS gene promoter together with AabHLH1, and activate the DBR2 gene promoter together with AabHLH113, indicating that AabHLH1 has a synergistic effect with AabHLH1 and / or AabHLH113 in activating the ADS gene promoter and the DBR2 gene promoter.

[0086] In the description of the technical solutions of the present invention, the term "and / or" used in terms such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0087] As used herein, the terms "(artemisinin yield / artemisia annua glandular trichome density) increase", "enhance" or "enhance" may mean an increase of at least 10% compared to a reference level (such as a wild-type Artemisia annua plant / initial plant), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100% increase, or any increase between 10%-100%, or at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0088] It is easy for those skilled in the art to understand that the use of AaMYC3 alone or in combination with CYP71AV1, ALDH1, AabHLH1 and / or AabHLH113 is not only suitable for the improvement of Artemisia annua plants, but may also be suitable for the fermentation culture of Artemisia annua plant cells, and may be suitable for the construction and fermentation culture of microbial engineered bacteria such as Escherichia coli or yeast that express artemisinin.

[0089] In this article, for the sake of simplicity of description, a certain protein, such as the transcription factor AaMYC3, is sometimes used interchangeably with the name of its coding gene (DNA), AaMYC3. Those skilled in the art should understand that they represent different types of substances in different description occasions. Those skilled in the art can easily understand their meanings based on the context. For example, for AaMYC3, when used to describe the function or category of a transcription factor, it refers to the protein; when described as a gene, it refers to the coding gene of the protein.

[0090] When AaMYC3 is used to improve Artemisia annua plants, it can be transferred into Artemisia annua plants through Agrobacterium-mediated method. For this purpose, it is necessary to construct a recombinant Agrobacterium engineering strain expressing AaMYC3, AabHLH1 and / or AabHLH113.

[0091] The terms "recombinant bacteria (strains)" and "(genetically) engineered bacteria (strains)" herein have the same meaning, and both refer to strains that have been genetically modified for wild-type Agrobacterium, such as Agrobacterium tumefaciens, and contain AaMYC3, AabHLH1 and / or AabHLH113 overexpression vectors.

[0092] Based on the function of transcription factor AaMYC3 (also known as AabHLH78), it can be used to promote artemisinin biosynthesis in Artemisia annua plants, to optimize and transform artemisinin metabolic pathways, and to create Artemisia annua germplasm resources with high artemisinin content. Specifically, the technical solution of the present invention can produce the following beneficial effects:

[0093] 1. The transcription factor AaMYC3 has a significant activation effect on the promoters of the artemisinin biosynthesis enzyme genes CYP71AV1 and ALDH1, as well as the promoter of the key gene AaHD1 for the development of Artemisia annua glandular trichomes, and the transcription factor binds to and activates the promoters of the ADS and DBR2 genes by binding to AabHLH1 and AabHLH113, respectively. These activation effects can significantly increase the artemisinin content and the density of Artemisia annua glandular trichomes in the plant.

[0094] 2. The constructed plant regulatory expression vector of the Artemisia annua transcription factor AaMYC3 can regulate the artemisinin content and increase the density of glandular trichomes.

[0095] 3. The use of plant overexpression vectors containing the transcription factor AaMYC3 can create transgenic Artemisia annua plants with increased artemisinin content and glandular trichome density, which is of great significance for the breeding of new varieties with high artemisinin content and large-scale production.

[0096] The present invention is further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0097] Example

[0098] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages described therein, unless otherwise specified, are all by mass percentages.

[0099] In the examples herein, if no specific description is given for the reaction temperature or the operating temperature, the temperature generally refers to room temperature (15-30° C.).

[0100] The molecular biology experiments in the embodiments include plasmid construction, enzyme digestion, competent cell preparation, transformation, etc., mainly with reference to "Molecular Cloning Experiment Guide" (3rd edition), compiled by J. Sambrook, DW Russell (USA), translated by Huang Peitang, etc., Science Press, Beijing, 2002). For example, the competent cell transformation method and the competent preparation method are all carried out with reference to "Molecular Cloning Experiment Guide" (3rd edition), Chapter 1, page 96. If necessary, the specific experimental conditions can be determined by simple experiments.

[0101] PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. If necessary, adjustments could be made through simple experiments.

[0102] The primer synthesis and gene sequencing in the examples were commissioned to Sangon Biotechnology (Shanghai) Co., Ltd.

[0103] HPLC detection method for artemisinin content in Artemisia annua: The HPLC instrument is SPD20A system controller, evaporative light scattering detector (ELSD). Use Waters C18 column, mobile phase: acetonitrile and water, volume ratio 60%: 40%, flow rate: 1mL / min; ELSD detection system is water alliance2420, evaporative light scattering detector drift tube temperature is 40℃, carrier gas pressure is 5bar; standard sample injection 20mL, each sample injection 20mL, repeat injection 3 times. The peak time of artemisinin standard is 8.345min, and the retention time of the sample is 8.295min.

[0104] Example 1: Cloning of the gene encoding the transcription factor AaMYC3 in Artemisia annua

[0105] 1.1 Extraction and detection of total RNA

[0106] Use RNAprep Pure Plant Total RNA Extraction Kit (DP432) from Tiangen Biochemical Technology (Beijing) Co., Ltd. and follow the instructions. Turn on the clean bench and UV lamp, and burn the mortar, key, and scissors with ethanol. Take 100 mg of Artemisia annua leaves, grind them into powder in liquid nitrogen, and dispense them into 2 ml centrifuge tubes. After the liquid nitrogen evaporates, add 0.45 ml of lysis solution RL, immediately shake vigorously or pipette 5-8 times, transfer to an RNase-Free centrifuge tube with filter column CS, and centrifuge at 13400g for 5 minutes; mix the collected solution with 0.5 times the volume of pre-cooled anhydrous ethanol, transfer it to the adsorption column CR3 with the collection tube, and centrifuge it at 4°C and 13400g for 1 minute; add 0.35 ml of deproteinization solution RW1 to CR3 for cleaning, and centrifuge it at 4°C and 13400g for 1 minute; add 0.5 ml of derinsing solution RW to CR3 for cleaning. Wash, let stand at room temperature for 2 minutes, centrifuge at 4℃, 13400g for 1 minute, and put it back into the collection tube. Repeat this process twice; discard the waste liquid and centrifuge CR3 at 4℃, 13400g for 2 minutes, then open the lid of CR3 and let stand at room temperature for 5 minutes until the ethanol evaporates completely; finally, put CR3 into a new RNase-Free centrifuge tube, add 0.04mlRNase-FreeddH2O to the center of the adsorption membrane, let stand at room temperature for 2 minutes, centrifuge at 4℃, 13400g for 2 minutes, use 1.0% agarose gel electrophoresis to detect the integrity of RNA, and use Eppendorf nucleic acid quantifier to determine the A260, A280 ratio and concentration. Store in a -80℃ refrigerator for later use.

[0107] 1.2 Reverse transcription and cDNA synthesis

[0108] The extracted Artemisia annua RNA was converted into cDNA using the FastKing cDNA First-Strand Synthesis Kit (Genomic Depleted) (KR116) provided by Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0109] 1.3 Cloning of the gene encoding the Artemisia annua transcription factor AaMYC3

[0110] Design PCR amplification primers based on the Artemisia annua genome:

[0111] The upstream primer is: 5'-ATGGAGCTTCTATTC-3',

[0112] The downstream primer is: 5'-TTGGGGCAGACCCGT-3'.

[0113] The PCR amplification conditions were as follows: pre-denaturation at 98°C for 1 minute; denaturation at 98°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 60 seconds, for a total of 30 cycles; and a final extension at 72°C for 2 minutes.

[0114] The PCR product was purified using Axygen's Agarose Gel Fragment Recovery Kit Ver.2.0 and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The nucleotide sequence of the gene encoding the transcription factor AaMYC3 was confirmed to be as shown in SEQ ID NO:1, and the amino acid sequence encoded by it was as shown in SEQ ID NO:2.

[0115] The transcription factor AaMYC3 can also be named AabHLH78, and the same is true below. The former refers to the naming of the Arabidopsis transcription factor AtMYC3.

[0116] Example 2: Construction of plant expression vector and protein expression vector containing AaMYC3, AabHLH1 and AabHLH113 genes

[0117] 1. Construction of plant regulated expression vector pHB-YFP-AaMYC3

[0118] According to the AaMYC3 gene sequence obtained in Example 1, the restriction sites on its coding region and pHB-YFP vector were analyzed, and XhoI and XhaI were selected as restriction endonuclease sites for vector construction. The XhoI restriction site was introduced upstream of the full-length AaMYC3, and the XhaI restriction site was introduced downstream of the full-length AaMYC3. The primer sequences are as follows:

[0119] AaMYC3-F-XhoI:5'-GCCTCGAGATGGAGCTTCTATTC-3',

[0120] AaMYC3-R-XhaI: 5'-GCTCTAGATTGGGGCAGACCCGT-3'.

[0121] The PCR amplification conditions were as follows: pre-denaturation at 98°C for 1 minute; denaturation at 98°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 60 seconds, for a total of 30 cycles; and a final extension at 72°C for 2 minutes.

[0122] The PCR product was purified using Agarose Gel Fragment Recovery Kit Ver.2.0 from Axygen.

[0123] The fast-digest enzymes FastDigestXhoI and FastDigest XhaI (Thermo Scientific) were used. TM ) was used to digest the pHB-YFP vector, and then the digestion product was purified using Axygen's Agarose Gel Fragment Recovery Kit Ver.2.0.

[0124] The purified PCR product was ligated with the purified enzyme digestion product using the T4 DNA ligase kit (5 U / μL) (EL0014) from Thermo Fisher Scientific (CN) to obtain the plasmid pHB-YFP-AaMYC3.

[0125] 2. Construction of plant overexpression vector pHB-Flag-AaMYC3

[0126] According to the AaMYC3 gene sequence obtained in Example 1, the restriction sites on its coding region and pHB-FLAG vector were analyzed, and PstI and XhaI were selected as restriction endonuclease sites for vector construction. The PstI restriction site was introduced upstream of the full-length AaMYC3, and the XhaI restriction site was introduced downstream of the full-length AaMYC3. The primer sequences are as follows:

[0127] AaMYC3-F-PstI:5'-GCCTGCAGATGAGCTTCTATTC-3',

[0128] AaMYC3-R-XhaI: 5'-GCTCTAGATTGGGGCAGACCCGT-3'.

[0129] The PCR amplification conditions were as follows: pre-denaturation at 98°C for 1 minute; denaturation at 98°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 60 seconds, for a total of 30 cycles; and a final extension at 72°C for 2 minutes.

[0130] The PCR product was purified using Agarose Gel Fragment Recovery Kit Ver.2.0 from Axygen.

[0131] The fast-digest enzymes FastDigest PstI and FastDigest XhaI (Thermo Scientific) were used. TM ) was used to digest the pHB-Flag vector, and then the digestion product was purified using Axygen's Agarose Gel Fragment Recovery Kit Ver.2.0.

[0132] The purified PCR product was ligated with the purified enzyme digestion product using the T4 DNA ligase kit (5U / μL) (EL0014) from Thermo Fisher Scientific (CN) to obtain the plasmid pHB-Flag-AaMYC3.

[0133] 3. Construction of plant regulated expression vectors pHB-YFP-AabHLH1 and pHB-YFP-AabHLH113

[0134] According to the gene sequences of AabHLH1 (NCBI accession number MH349477) and AabHLH113 (NCBI accession number OP103717) of Artemisia annua in the NCBI database, the restriction sites in the coding region and pHB-YFP vector were analyzed, and XhoI and XhaI were selected as restriction endonuclease sites for vector construction. XhoI restriction sites were introduced upstream of full-length AabHLH1 and AabHLH113, and XhaI restriction sites were introduced downstream of full-length AabHLH1 and AabHLH113. The primer sequences are as follows:

[0135] AabHLH1-F-XhoI:5'-GCCTCGAGATGACGGAGTACCGCA-3',

[0136] AabHLH1-R-XhaI:5'-GCTCTAGAAATGGATCGGAAAATC-3',

[0137] AabHLH113-F-XhoI:5'-GCCTCGAGATGCACCAACCAAAC-3',

[0138] AabHLH113-R-XhaI: 5'-GCTCTAGATTACAAGCATCTGCC-3'.

[0139] Plasmids pHB-YFP-AabHLH1 and pHB-YFP-AabHLH113 were constructed in the same manner as in step 1 above.

[0140] 4. Construction of protein expression vectors pMAL-c5X-AaMYC3, pET-32a+-AabHLH1 and pMAL-c5X-AabHLH113

[0141] According to the AaMYC3 gene sequence obtained in Example 1, and according to the AabHLH1 (NCBI accession number MH349477) and AabHLH113 (NCBI accession number OP103717) gene sequences of Artemisia annua in the NCBI database, the coding region and the restriction sites on the pMAL-c5X or pET-32a+ vector were analyzed. BamHI and PstI were selected as restriction endonuclease sites for vector construction, BamHI restriction sites were introduced upstream of full-length AaMYC3 and AabHLH113, and PstI restriction sites were introduced downstream of full-length AaMYC3 and AabHLH113. BamHI and XhoI were selected as restriction endonuclease sites for vector construction, BamHI restriction sites were introduced upstream of full-length AabHLH1, and XhoI restriction sites were introduced downstream of full-length AabHLH113. The primer sequences are as follows:

[0142] AaMYC3-F-BamHI:5'-GCGGATCCATGGAGCTTCTATTC-3',

[0143] AaMYC3-R-PstI: 5'-GCCTGCAGTTGGGGCAGACCCGT-3',

[0144] AabHLH1-F-BamHI:5'-GCGGATCCTGACGGAGTACCGCA-3',

[0145] AabHLH1-R-XhoI:5'-GCCTCGAGAATGGATCGGAAAATC-3',

[0146] AabHLH113-F-BamHI:5'-GCGGATCCATGCACCAACCAAAC-3',

[0147] AabHLH113-R-PstI: 5'-GCCTGCAGTTACAAGCATCTGCC-3'.

[0148] According to the same method as in step 2 above, plasmids pMAL-c5X-AaMYC3, pET-32a+-AabHLH1 and pMAL-c5X-AabHLH113 were constructed respectively.

[0149] Example 3: Construction of dual luciferase reporter vectors containing the key enzyme genes ADS, CYP71AV1, DBR2, ALDH1 and AaHD1 promoters for artemisinin biosynthesis

[0150] 1. PCR amplification of the promoters of the key enzyme genes ADS, CYP71AV1, DBR2, ALDH1 and AaHD1 of artemisinin biosynthesis. According to the sequence information of the promoters of ADS (GeneBank: AY528931), CYP71AV1 (GeneBank: FJ870128), DBR2 (GeneBank: KC118523), ALDH1 (GeneBank: KU214890) and AaHD1 (KU744606) of Artemisia annua in the NCBI database, specific primers for amplification of the promoters of ADS, CYP71AV1, DBR2, ALDH1 and AaHD1 genes were designed respectively.

[0151] The ADS promoter-specific forward and reverse primers contain KpnI and PstI restriction sites, respectively. The primer sequences are as follows:

[0152] ProADS-F-KpnI:5'-GCGGTACCTATGGTGTTTCAACGCTTAT-3',

[0153] ProADS-R-PstI: 5'-GCCTGCAGACTAGAGTTGCCTTAGC-3'.

[0154] The forward and reverse primers specific for the CYP71AV1 promoter contain KpnI and PstI restriction sites, respectively. The primer sequences are as follows:

[0155] ProCYP71AV1-F-KpnI:5'-GCGGTACCTTTTTCTGACCTGCCAACC-3',

[0156] ProCYP71AV1-R-PstI: 5'-GCCTGCAGCATGCTTTTTAGTATACTC-3'.

[0157] The DBR2 promoter-specific forward and reverse primers contain KpnI and PstI restriction sites, respectively. The primer sequences are as follows:

[0158] ProDBR2-F-KpnI: 5'-GCGGTACCCCCCAATGGGTTGGTCTA-3',

[0159] ProDBR2-R-PstI: 5'-GCCTGCAGTAAACAGCCCTTGTTTTGCA-3'.

[0160] The ALDH1 promoter-specific forward and reverse primers contain KpnI and PstI restriction sites, respectively. The primer sequences are as follows:

[0161] ProALDH1-F-KpnI: 5'-GCGGTACCAAGGGAAGGAGTATTATACTATTAGATTGAGAT-3',

[0162] ProALDH1-R-PstI: 5'-GCCTGCAGAGGGTCGAATGATGACTTAAGGCT-3'.

[0163] The forward and reverse primers specific for the AaHD1 promoter contain KpnI and PstI restriction sites, respectively. The primer sequences are as follows:

[0164] ProAaHD1-F-KpnI: 5'-GCGGTACCCACAATTTCAATATTATATA-3',

[0165] ProAaHD1-R-PstI: 5'-GCCTGCAGGTGGTAAATGAGAACTTAAA-3'.

[0166] The three promoter fragments were amplified by PCR using the genomic DNA of Artemisia annua as a template and then recovered and purified.

[0167] 2. Insert the promoter fragment into the dual luciferase reporter vector. The above PCR product and pGreenII0800-LUC vector were double-digested with KpnI and PstI, respectively, and the digested PCR product fragments and digested vector fragments were recovered, and T4 ligase was used to construct plant dual luciferase detection reporter vectors pGreenII0800-ProADS-LUC, pGreenII0800-ProCYP71AV1-LUC, pGreenII0800-ProDBR2-LUC, pGreenII0800-ProALDH1-LUC and pGreenII0800-ProAaHD1-LUC.

[0168] Taking pGreenII0800-ProADS-LUC as an example, its construction method includes the following steps:

[0169] The PCR amplification conditions were as follows: pre-denaturation at 98°C for 1 minute; denaturation at 98°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 120 seconds, for a total of 30 cycles; and a final extension at 72°C for 2 minutes.

[0170] The PCR product was purified using Agarose Gel Fragment Recovery Kit Ver.2.0 from Axygen.

[0171] The vector pGreenII0800 was digested with the fast-digest enzymes FastDigest KpnI and FastDigest PstI (Thermo Scientific™) from Thermo Fisher Scientific (Thermo Fisher Scientific-CN), and then the digested products were purified using Agarose Gel Fragment Recovery Kit Ver. 2.0 from Axygen.

[0172] The purified PCR product was ligated with the purified enzyme digestion product using the T4 DNA ligase kit (5 U / μL) (EL0014) from Thermo Fisher Scientific (CN) to obtain the plasmid pGreenII0800-ProADS-LUC.

[0173] Example 4: Detection of the activation and binding effect of transcription factor AaMYC3 on CYP71AV1 and ALDH1 promoters

[0174] The activation and binding effects of transcription factor AaMYC3 on CYP71AV1 and ALDH1 promoters were detected by performing plasmid transient transformation and EMSA in tobacco, including the following steps.

[0175] 1. Obtaining the engineered strain GV3101 Agrobacterium

[0176] The pHB-YFP empty vector (as a control) and the plant regulated expression vector pHB-YFP-AaMYC3 constructed in Example 2 were transferred into the engineering strain Agrobacterium GV3101 by the freeze-thaw method; and the plant dual-luciferase detection reporter vector constructed in Example 3 was transferred into the Agrobacterium GV3101 engineering bacteria carrying the pSoup19 auxiliary plasmid by the freeze-thaw method, and engineering strains containing the empty vector (control), the AaMYC3 gene, and the CYP71AV1, ALDH1 and AaHD1 gene promoters were obtained respectively.

[0177] 2. Transient Transformation of Tobacco

[0178] The positive strains of the above four engineering strains were inoculated into 5 ml YEP liquid medium containing 5 mg / L rifampicin (Rif) + 20 mg / L gentamicin (Gen) + 50 mg / L kanamycin (Kan), and cultured overnight at 28°C and 220 rpm. The cells were collected by centrifugation at 4000 rpm for 10 minutes. The cells were resuspended in MS liquid medium and the OD of the bacterial solution was adjusted. 600 The pH value was 0.6, 200 mmol / L acetosyringone (AS) and 10 mmol / L MES (pH = 5.8) were added, and the mixed Agrobacterium culture was placed at 28°C for 3 h.

[0179] The engineered strains containing the plant regulated expression vector pHB-YFP-AaMYC3 and the pHB-YFP empty vector were mixed with the engineered strains containing the plant dual luciferase detection reporter vectors pGreenII0800-ProCYP71AV1-LUC, pGreenII0800-ProALDH1-LUC and pGreenII0800-ProAaHD1-LUC at a ratio of 1:1, and then injected into tobacco leaves grown for 35 days by injection infection. The tobacco leaves were cultured in the dark for 48 hours.

[0180] The tobacco leaves were quickly frozen with liquid nitrogen and then ground into powder. The fluorescence intensity was detected using the Dual-Luciferase detection kit of Promega Company, and the operation was performed according to the instructions of Promega Company.

[0181] 3. Purification and acquisition of fusion protein MBP-AaMYC3

[0182] The protein expression vector pMAL-c5X-AaMYC3 in Example 2 was transferred into the engineering strain Escherichia coli BL21 by freeze-thaw method, and the protein purification experiment was carried out using the His tag protein purification kit of Beyotime Biotechnology (Beyotime Biotechnology, Shanghai, China), according to the instructions of Beyotime Biotechnology.

[0183] The E-box and G-box element sequences in the CYP71AV1, ALDH1 and AaHD1 promoters in Example 3 and their synthetic biotin-labeled fragments were used as probes, and the unlabeled fragments were used as competitive probes. At the same time, these sequences were mutated and biotin-labeled fragments were synthesized as competitive probes (Boshang Biotechnology (Shanghai) Co., Ltd.), and the sequences are as follows:

[0184] pCYP71AV1-Ebox-F: CAAGCCTCTCATGTATTATACAACTGACATCTTGTTTTTATCATCA,

[0185] pALDH1-Ebox-F:CTGGCCCCACCGTAAACAATCAAATGCCTTTTTGTTTTCATATTTTG,

[0186] pAaHD1-Gbox-F: AGCAAATAAGATAATGCCACGTGTATGAAACAGCCATGTAGGTCAA,

[0187] pCYP71AV1-mEbox-F:CAAGCCTCTCATGTATTATACTTTTGACATCTTGTTTTTATCATCA,

[0188] pALDH1-mEbox-F:CTGGCCCCACCGTAAACAATCTTTTGCCTTTTGTTTTCATATTTTG,

[0189] pAaHD1-mGbox-F: AGCAAATAAGATAATGCCTTTTGTATGAAACAGCCATGTAGGTCAA.

[0190] The chemiluminescent EMSA kit developed by Shanghai Bio-Tech Biotechnology Co., Ltd. was used for gel shift assay (EMSA) according to the instructions of the kit.

[0191] The results are as follows Figure 1 As shown, AaMYC3 increased the relative luciferase activities of the CYP71AV1, ALDH1 and AaHD1 gene promoters, and the binding effect of AaMYC3 on the CYP71AV1, ALDH1 and AaHD1 gene promoters was significantly enhanced (A in the figure is the dual luciferase activity of AaMYC3 activating the CYP71AV1 gene promoter; B is the dual luciferase activity of AaMYC3 activating the ALDH1 gene promoter; C is the dual luciferase activity of AaMYC3 activating the AaHD1 gene promoter; D is the binding effect of AaMYC3 on the CYP71AV1 gene promoter; E: the binding effect of AaMYC3 on the ALDH1 gene promoter; F is the binding effect of AaMYC3 on the AaHD1 gene promoter), indicating that the Artemisia annua transcription factor AaMYC3 can positively regulate the biosynthesis of artemisinin and the density of glandular trichomes.

[0192] Example 5: Detection of the synergistic effect of transcription factors AaMYC3 with AabHLH1 and AabHLH113

[0193] The method comprises the following steps, by performing plasmid transient transformation and EMSA in tobacco, detecting the co-action of transcription factor AaMYC3 and AabHLH1 or AabHLH113, and showing the effect of binding to and activating the promoters of ADS and DBR2 genes.

[0194] 1. Obtaining the engineered strain GV3101 Agrobacterium

[0195] The pHB-YFP empty vector and the plant regulated expression vectors pHB-YFP-AaMYC3, pHB-YFP-AabHLH1 and pHB-YFP-AabHLH113 constructed in Example 2 were respectively transferred into the Agrobacterium GV3101 engineering strain by the freeze-thaw method, and the plant dual-luciferase detection reporter vector constructed in Example 3 was transferred into the Agrobacterium GV3101 engineering strain carrying the pSoup19 auxiliary plasmid by the freeze-thaw method, and engineering strains containing the empty vector, AaMYC3 gene, AabHLH1 gene, AabHLH113 gene and ADS and DBR2 gene promoters were obtained respectively.

[0196] 2. Transient Transformation of Tobacco

[0197] The positive strains of the above four engineering strains were inoculated into 5 ml YEP liquid medium containing 5 mg / L rifampicin (Rif) + 20 mg / L gentamicin (Gen) + 50 mg / L kanamycin (Kan), and cultured overnight at 28°C and 220 rpm. The cells were collected by centrifugation at 4000 rpm for 10 minutes. The cells were resuspended in MS liquid medium and the OD of the bacterial solution was adjusted. 600 The pH value was 0.6, 200 mmol / L acetosyringone (AS) and 10 mmol / L MES (pH = 5.8) were added, and the mixed Agrobacterium culture was placed at 28°C for 3 h.

[0198] The engineering strains containing the plant regulated expression vectors pHB-YFP-AaMYC3, pHB-YFP-AabHLH1, pHB-YFP-AabHLH113 or pHB-YFP empty vector were mixed with the engineering strains containing the plant dual luciferase detection reporter vector pGreenII0800-ProADS-LUC or pGreenII0800-ProDBR2-LUC in a 1:1 ratio, pHB-YFP-AaMYC3 and pHB-YFP-AabHLH1 were mixed with the plant dual luciferase detection reporter vector pGreenII0800-ProADS-LUC in a 1:1:2 ratio, and pHB-YFP-AaMYC3 and pHB-YFP-AabHLH113 were mixed with the plant dual luciferase detection reporter vector pGreenII0800-ProDBR2-LUC in a 1:1:2 ratio, and injected into tobacco leaves grown for 35 days by injection infection. Tobacco leaves were incubated in the dark for 48 h.

[0199] The tobacco leaves were quickly frozen with liquid nitrogen and then ground into powder. The fluorescence intensity was detected using the Dual-Luciferase detection kit of Promega Company, and the operation was performed according to the method in the instruction manual of the kit of Promega Company.

[0200] 3. Purification and acquisition of fusion proteins MBP-AabHLH113 and His-AabHLH1

[0201] The protein expression vectors pET-32a+-AabHLH1 and pMAL-c5X-AabHLH113 in Example 2 were transferred into the engineered strain Escherichia coli BL21 by freeze-thawing method, and protein purification experiments were performed using MBP tag protein purification kit (Foinde Technology (Wuhan) Co., Ltd.) and His tag protein purification kit (Shanghai Beyotime Biotechnology Co., Ltd.), according to the methods in the kit instructions of Beyotime Biotechnology and Foinde Technology (Wuhan) Co., Ltd., respectively.

[0202] The E-box element sequences in the ADS and DBR2 promoters in Example 3 and their synthetic biotin-labeled fragments were used as probes, and the unlabeled fragments were used as competitive probes. These sequences were mutated and the biotin-labeled fragments were synthesized as competitive probes (Biosune Biotechnology Co., Shanghai, China). The sequences are as follows:

[0203] pADS-3×Ebox-F:CATATGATTACATGTGATTACAAATG,

[0204] pDBR2-Ebox-F:GTTAGAAATTTTTTTCGTGACATGTGAAATTTTTTTTGACCGCTTT.

[0205] Gel shift assay (EMSA) was performed using a chemiluminescent EMSA kit developed by Shanghai Biotech Co., Ltd. (Shanghai Biotech Co., Ltd.) according to the instructions of the kit.

[0206] The results are as follows Figure 2 As shown, AaMYC3 binds to and activates the promoters of ADS and DBR2 genes respectively by acting together with AabHLH1 and AabHLH113. (In the figure, A is the dual luciferase activity of AaMYC3 activating the ADS gene promoter by acting together with AabHLH1 or acting alone; B is the dual luciferase activity of AaMYC3 activating the DBR2 gene promoter by acting together with AabHLH113 or acting alone; C is the binding effect of AaMYC3 on the ADS gene promoter and the DBR2 gene promoter by acting together with AabHLH1 and AabHLH113).

[0207] Example 6: Determination of artemisinin content in transgenic Artemisia annua with overexpression and RNA interference of AaMYC3 gene

[0208] The acquisition of transgenic Artemisia annua with overexpression and RNA interference of AaMYC3 gene and the determination of artemisinin content include the following steps.

[0209] 1. Germination of sterile seedlings of Artemisia annua

[0210] Soak the Artemisia annua seeds in 75% ethanol for 1 minute, then soak them in 20% sodium hypochlorite for 20 minutes, rinse with sterile water for 3-4 times, remove excess water and spread the seeds on MS solid culture medium, culture them at 4°C in the dark for 48 hours, culture them at 25°C, 16h / 8h (light / darkness) for about 25 days, and cut the first pair of true leaves for transformation.

[0211] 2. Genetic transformation of Artemisia annua

[0212] The plant overexpression vector pHB-Flag-AaMYC3 constructed in Example 2 was transferred into Agrobacterium EHA105 by freeze-thaw method; the cells were screened on resistance plates (Rif+Kan), and monoclonal plaques were picked for PCR detection to obtain positive strains; 50 mL YEP (Rif+Kan) culture solution was added to a 250 mL Erlenmeyer flask, and cultured overnight at 28°C and 200 rpm; the engineered bacteria solution was cultured to an OD of 0. 600 When the OD is about 0.6, centrifuge at 4000rpm for 5min to collect the bacteria. Resuspend the bacterial precipitate in 1 / 2MS liquid medium to an OD of600 0.3-0.5, 28℃, 200rpm culture for 30min; infect the leaf explants of Artemisia annua with the cultured bacterial solution for 20min, and spread them on MS plates (MS+NAA 0.1mg / L+6-BA1.0mg / L). Culture them in the dark at 25℃ for 2d, and transfer them to differentiation plates (MS+NAA 0.1mg / L+6-BA 1.0mg / L+Hygr) after 2d. Replace the screening medium every 10 days. After one month, a large number of clustered buds grow from the differentiation medium plate; cut off the clustered buds and transfer them to the seedling medium and rooting medium in turn until a complete plant is formed; transplant the rooted Artemisia annua plants into the soil for growth.

[0213] 3. PCR detection of transgenic Artemisia annua plants

[0214] According to the gene sequence of AaMYC3 and the plant pHB-FLAG vector sequence, the forward detection primer and the reverse detection primer were designed respectively. The primer sequences are as follows:

[0215] AaMYC3-F: 5'-ATGGAGCTCTATTC-3',

[0216] Rbcs-R: 5'-TCAGTAGGATTCTGGTGTGTG-3'.

[0217] According to the gene sequence of AaMYC3, fluorescent quantitative PCR detection primers were designed to detect the expression level of the AaMYC3 gene in transgenic Artemisia annua plants. The primer sequences are as follows:

[0218] AaMYC3-qF: 5'-GCGCATCAAACGCGAAAAAG-3',

[0219] AaMYC3-qR: 5'-AATCCTTTGGTGCTTCGGGT-3'.

[0220] 4. Extraction of artemisinin from transgenic Artemisia annua and determination of artemisinin content

[0221] The whole transgenic Artemisia annua plant, which had grown for about 3 months, was removed and placed in a 40°C oven and dried overnight to constant weight. All leaves of the dried Artemisia annua were then removed and ground into powder. About 0.2 g of dry powder was weighed and placed in a 50 ml centrifuge tube. 25 ml of petroleum ether was added and ultrasonicated at 80 Hz at 50°C for 40 minutes; filtered with filter paper and collected in a 50 ml beaker; the filter residue was washed with 25 ml of petroleum ether and collected again in the same beaker. The liquid was poured into a 100 ml evaporating flask, and the petroleum ether was completely evaporated under reduced pressure in a 50°C water bath; dissolved in 1 ml of HPLC grade methanol and transferred to a 1.5 ml centrifuge tube; centrifuged at 12,000 rpm for 10 minutes; filtered with a 0.25 mm filter head and transferred to a sample injection bottle.

[0222] 5. Detect the content of artemisinin in the sample by HPLC. Calculate the content of artemisinin in the sample based on the concentration and peak area of ​​the standard, and then divide it by the dry weight of Artemisia annua powder to calculate the content of artemisinin in the dry weight of the sample.

[0223] The results are as follows Figure 3 As shown, the gene expression level of AaMYC3 in transgenic Artemisia annua overexpressing the AaMYC3 gene was significantly increased, and the content of artemisinin was significantly increased; the gene expression level of AaMYC3 in transgenic Artemisia annua with RNA interference of the AaMYC3 gene was significantly decreased, and the content of artemisinin was significantly decreased, and the differences were significant.

[0224] Example 7: Observation and statistics of glandular trichome density in transgenic Artemisia annua with overexpression and RNA interference of AaMYC3 gene

[0225] 1. The mature leaves (leaf 9, the ninth leaf from the terminal bud) of transgenic and wild-type Artemisia annua plants with a growth period of about 3 months were picked and the density of glandular trichomes was observed and photographed using a fluorescence microscope. The image of the front surface of each leaf was obtained under 460 nm excitation light using a fluorescence microscope (Leica DM2500, Leica Microsystems, Germany).

[0226] 2. Leaf area was measured and counted using ImageJ (http: / / rsb.info.nih.gov / ij). Three biological replicates were performed for all lines.

[0227] The results are as follows Figure 4 As shown, the density of glandular trichomes in transgenic Artemisia annua overexpressing the AaMYC3 gene was significantly increased, while the density of glandular trichomes in transgenic Artemisia annua with RNA interference of the AaMYC3 gene was significantly decreased.

[0228] The above embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Any equivalent substitution or change made by a person skilled in the art based on the present invention is within the protection scope of the present invention.

[0229] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be regarded as an admission that the document is prior art or common knowledge.

[0230] Main references

[0231] Cao,J.,Chen,Z.,Wang,L.,Yan,N.,Lin,J.,Hou,L.,Zhao,Y.,Huang,C.,Wen,T.,Li,C.,Rahman,Su,Liu,Z.,Qiao,J.,Zhao,J.,Wang,J.,Shi,Y.,Qin,W.,Si,T.,Wang,Y.and Tang,K.(2023)Graphene enhances artemisinin production in traditional medicinal plant Artemisia annua via dynamic physiological progress and miRNAregulation.Plant Communications,100742.

[0232] Cui,W.,Chen,Z.,Shangguan,X.,Li,T.,Wang,L.,Xue,X.and Cao,J.(2022)TRYintron2 determined its expression in inflorescence activated by SPL9 andMADS-box genes in Arabidopsis.Plant Science 321,111311.

[0233] Gao,W.,Xu,FC,Long,L.,Li,Y.,Zhang,JL,Chong,L.,Botella,JRandSong,CP(2020)The gland localized controls gland pigmentation and gossypolaccumulation in cotton.Plant Biotechnology Journal 18,1573-1584.

[0234] Handley,R.,Ekbom,B.and J.(2005)Variation in trichome density andresistance against a specialist insect herbivore in natural populationsof.Ecol Entomol 30,284-292.

[0235] Hassani,D.,Fu,X.,Shen,Q.,Khalid,M.,Rose,J.K.C.and Tang,K.(2020)Parallel Transcriptional Regulation of Artemisinin and FlavonoidBiosynthesis.Trends Plant Sci 25,466-476.

[0236] Hua,B.,Chang,J.,Xu,Z.,Han,X.,Xu,M.,Yang,M.,Yang,C.,Ye,Z.and Wu,S.(2021)HOMEODOMAIN PROTEIN8 mediates jasmonate-triggered trichome elongationin tomato.New Phytol 230,1063-1077.

[0237] Huang,A.C.and Osbourn,A.(2019)Plant terpenes that mediate below-ground interactions:prospects for bioengineering terpenoids for plantprotection.Pest Manag Sci 75,2368-2377.

[0238] Ji,Y.P.,Xiao,J.W.,Shen,Y.L.,Ma,D.M.,Li,Z.Q.,Pu,G.B.,Li,X.,Huang,L.L.,Liu,B.Y.,Ye,H.C.and Wang,H.(2014)Cloning and Characterization of AabHLH1,abHLH Transcription Factor that Positively Regulates Artemisinin Biosynthesisin.Plant and Cell Physiology 55,1592-1604.

[0239] Karabourniotis,G.,Liakopoulos,G.,Nikolopoulos,D.and Bresta,P.(2020)Protective and defensive roles of non-glandular trichomes against multiplestresses:structure-function coordination.J Forestry Res 31,1-12.

[0240] Kaur,I.and Kariyat,R.R.(2020)Eating barbed wire:Direct and indirectdefensive rolesof non-glandular trichomes.Plant Cell and Environment 43,2015-2018.

[0241] Lin,J.L.,Fang,X.,Li,J.X.,Chen,Z.W.,Wu,W.K.,Guo,X.X.,Liu,N.J.,Huang,J.F.,Chen,F.Y.,Wang,L.J.,Xu,B.F.,Martin,C.,Chen,X.Y.and Huang,J.Q.(2023)Dirigentgene editing of gossypol enantiomers for toxicity-depleted cottonseeds.Nature Plants 9,605-+.

[0242] Ma , YN , Xu , DB , Li , L , Zhang , F , Fu , XQ , Shen , Q , Lyu , XY , Wu , ZK , Pan , QF , Shi , P , Hao , XL , Y an, TX, Chen, MH, Liu, P., He, Q., Xie, LH, Zhong, YJ, Tang, YL, Zhao, JY, Zhang, LD, Sun, XFand Tang,KX(2018)Jasmonate promotes sartemisinin biosynthesis by activating the TCP14-ORA complex in Artemisiaannua.Sci Adv 4,eaas9357.

[0243] McConkey,ME,Gershenzon,J.and Croteau,RB(2000)Developmentalregulation ofmonoterpene biosynthesis in the glandular trichomes ofpeppermint.Plant Physiology 122,215-223.

[0244] Munien,P.,Naidoo,Y.and Naidoo,G.(2015)Micromorphology,histochemistryand ultrastructure of the foliar trichomes of Withania somnifera(L.)Dunal(Solanaceae).Plant242,1107-1122.

[0245] Muravnik,LE,Kostina,OVand Shavarda,AL(2016)Glandular trichomesofTussilago Farfara(Senecioneae,Asteraceae).Plant 244,737-752.

[0246] Olofsson,L.,Lundgren,A.and Brodelius,P.E.(2012)Trichome isolationwith andwithout fixation using laser microdissection and pressure catapultingfollowed by RNAamplification:Expression of genes of terpene metabolism inapical and sub-apical trichomecells of L.Plant Science 183,9-13.

[0247] Schilmiller,A.L.,Last,R.L.and Pichersky,E.(2008)Harnessing planttrichomebiochemistry for the production of useful compounds.Plant Journal 54,702-711.

[0248] Schuurink,R.and Tissier,A.(2020)Glandular trichomes:micro-organs withmodelstatus?New Phytologist 225,2251-2266.

[0249] Spyropoulou,E.A.,Haring,M.A.and Schuurink,R.C.(2014)Expression ofTerpenoids1,a glandular trichome-specific transcription factor from tomatothat activates the terpenesynthase 5 promoter.Plant Molecular Biology 84,345-357.

[0250] Tang,H.,Jiang,Q.,Liu,H.Y.,Zhang,F.,Liu,Q.,Pu,G.,Li,J.,Wang,L.andZhang,Y.(2022)Glandular trichomes of medicinal plants:types,separation andpurification,biological activities.Biol Plantarum 66,219-227.

[0251] Wang,G.D.,Tian,L.,Aziz,N.,Broun,P.,Dai,X.B.,He,J.,King,A.,Zhao,P.X.andDixon,R.A.(2008)Terpene Biosynthesis in Glandular Trichomes ofHop.Plant physiology148,1254-1266.

[0252] Wang,Z.,Yang,Z.and Li,F.(2019)Updates on molecular mechanisms inthedevelopment of branched trichome in Arabidopsis and nonbranched incotton.PlantBiotechnol J 17,1706-1722.

[0253] Wu,M.,Bian,X.,Hu,S.,Huang,B.,Shen,J.,Du,Y.,Wang,Y.,Xu,M.,Xu,H.,Yang,M.and Wu,S.(2024)Agradient of the HD-Zip regulator Woolly regulatesmulticellulartrichome morphogenesis in tomato.Plant Cell.

[0254] Xie, L., Yan, T., Li, L., Chen, M., Ma, Y., Hao, X., Fu, X., Shen, Q., Huang, Y., Qin, W., Liu, H., Chen, T., Hassani, D., Kayani, SL, Rose, JKCand Tang, K. (2021a)TheWRKYtranscription factor AaGSW2 promotes glandular trichome initiation inArtemisia annua.JExp Bot 72,1691–1701.

[0255] Xu,JS,van Herwijnen,ZO, DB,Sui,C.,Haring,MAandSchuurink,RC(2018)SlMYC1 Regulates Type VI Glandular Trichome Formation andTerpeneBiosynthesis in Tomato Glandular Cells.Plant Cell 30,2988-3005.

[0256] Yan, TX, Chen, MH, Shen, Q., Li, L., Fu, XQ, Pan, QF, Tang, YL, Shi, P., Lv, ZY, Jiang, WM, Ma, YN, Hao, XL, Sun, XFand Tang, KX(2017)HOMEODOMEN PROTEIN 1 is required for jasmonate-mediated glandular trichomeinitiation in. NewPhytologist 213,1145–1155.

[0257] Yan, TX, Li, L., Xie, LH, Chen, MH, Shen, Q., Pan, QF, Fu, XQ, Shi, P., Tang, YL, Huang, HY, Huang, YW, Huang, YRand Tang, KX(2018)Anovel HD-ZIPIV / MIXTAcomplex promotes glandular trichome initiation and cuticle developmentin.NewPhytologist 218,567-578.

[0258] Yang,CQ,Marillonnet,S.and Tissier,A.(2021)The scarecrow-like transcription factor SlSCL3 regulates volatile terpene biosynthesis andglandular trichome size in tomato.Plant Journal 107,1102-1118.

[0259] Yu, J., Lei, B., Zhao, HN, Wang, B., Kakar, KU, Guo, YS, Zhang, XL, Jia, MA, Yang, H. and Zhao, DG(2022)Cloning, characterization and functional analysis of genereveals its role in wax alkane biosynthesis of tobaccotrichomes and stress tolerance Plant Science 13 .

[0260] Yuan,M.,Shu,G.,Zhou,J.,He,P.,Xiang,L.,Yang,C.,Chen,M.,Liao,Z.andZhang,F.(2023)AabHLH113 integrates jasmonic acid and abscisic acid signalingto positivelyregulate artemisinin biosynthesis in Artemisia annua.NewPhytologist 237,885-899.

[0261] Zhang,Y.N.,Wang,D.,Li,H.,Bai,H.T.,Sun,M.Y.and Shi,L.(2023)Formationmechanism of glandular trichomes involved in the synthesis andstorage of terpenoids inlavender.Bmc Plant Biol 23 。

Claims

1. A polypeptide, wherein the polypeptide is selected from the group consisting of: (a) a polypeptide with an amino acid sequence as shown in SEQ ID NO: 2; (b) a polypeptide derived from (a) which is formed by substituting, deleting or adding one or more amino acid residues of the amino acid sequence SEQ ID NO: 2 and has the function of the polypeptide of (a); (c) a polypeptide derived from (a) that has 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, and more preferably 99% or more homology with the polypeptide sequence defined in (a), and has the function of the polypeptide of (a); or (d) A derivative polypeptide having a sequence containing the polypeptide sequence described in (a) or (b) or (c).

2. A polynucleotide selected from the group consisting of: (A) a polynucleotide encoding the polypeptide of claim 1; (B) a polynucleotide encoding a polypeptide whose amino acid sequence is shown in SEQ ID NO: 2; (C) a polynucleotide whose nucleotide sequence is shown in SEQ ID NO: 1; (D) a polynucleotide having a nucleotide sequence homology of ≥95%, preferably ≥96%, preferably ≥97%, preferably ≥98%, more preferably ≥99% to the nucleotide sequence of SEQ ID NO: 1; (E) A nucleotide sequence complementary to the nucleotide sequence described in any one of (A) to (D).

3. A DNA molecule, characterized in that Comprising the polynucleotide as claimed in claim 2.

4. A recombinant plasmid, characterized in that: Comprising the DNA molecule as described in claim 3.

5. A microbial engineering bacterium, characterized in that: The transformant comprises the recombinant plasmid as claimed in claim 4, and is used for mediating the transfer of the recombinant plasmid as claimed in claim 4 into a plant producing artemisinin.

6. Use of the polypeptide according to claim 1, the polynucleotide according to claim 2, the DNA molecule according to claim 3 or the recombinant plasmid according to claim 4 in promoting the biosynthesis of artemisinin, or in cultivating new varieties of Artemisia annua.

7. The use according to claim 6, characterized in that The biosynthesis of artemisinin is promoted in artemisinin-producing plants such as Artemisia annua or transgenic tobacco, or artemisinin-expressing cells by the following methods: (i) allowing the polynucleotide according to claim 2 to bind to and activate the expression of the promoter of the key enzyme gene CYP71AV1 and / or ALDH1 in the biosynthesis of artemisinin; and / or (ii) allowing the polynucleotide according to claim 2 to bind to and activate the expression of the promoter of the key gene AaHD1 for glandular trichome development in Artemisia annua; and / or (iii) allowing the polypeptide according to claim 1 to interact with AabHLH1 to activate the ADS gene promoter; and / or (iv) allowing the polypeptide according to claim 1 to interact with AabHLH113 to activate the DBR2 gene promoter.

8. The use according to claim 6, characterized in that Method (i) is implemented by the following steps: (i-1) connecting the polynucleotide according to claim 2 to a plant regulatory expression sequence vector to construct a plant regulatory expression vector containing the polynucleotide, (i-2) The promoters ProCYP71AV1 and ProALDH1 of the key enzyme genes CYP71AV1 and ALDH1 in the biosynthesis of artemisinin were inserted into the vector pGreenII0800-LUC, respectively, to construct plant dual luciferin detection reporter vectors pGreenII0800-ProCYP71AV1-LUC and pGreenII0800-ProALDH1-LU. (i-3) respectively transferring the plant regulatory expression vector described in step (i-1) and the plant dual luciferin detection reporter vector described in step (i-2) into the engineering strain Agrobacterium to obtain an engineering strain containing the plant regulatory expression vector and the plant dual luciferin detection reporter vector, (i-4) mixing the engineered strain containing the plant regulatory expression vector described in step (i-3) with the engineered strain containing the plant dual fluorescein detection reporter vector in a bacterial liquid volume ratio of 1:1, injecting the mixture into tobacco, detecting the fluorescence intensity, and determining the binding and activation effect of the polynucleotide according to claim 2 with the promoters of the key enzyme genes CYP71AV1 and ALDH1 in the biosynthesis of artemisinin, (i-5) Artificially synthesized primer probes of CYP71AV1 and ALDH1 promoters, and used DNA gel shift assay (EMSA) to verify the binding ability of MBP-AaMYC3 to CYP71AV1 and ALDH1 promoters; Method (ii) is implemented by the following steps: (ii-1) connecting the polynucleotide according to claim 2 to a plant regulatory expression sequence to construct a plant regulatory expression vector containing the polynucleotide; (ii-2) inserting the promoter ProAaHD1 of the key enzyme gene AaHD1 for the development of glandular trichomes in Artemisia annua into the vector pGreenII0800-LUC to construct the plant dual luciferin detection reporter vector pGreenII0800-ProAaHD1-LUC; (ii-3) respectively transferring the plant regulatory expression vector described in step (ii-1) and the plant dual fluorescein detection reporter vector described in step (ii-2) into the engineering strain Agrobacterium to obtain an engineering strain containing the plant regulatory expression vector and the plant dual fluorescein detection reporter vector; (ii-4) mixing the engineered strain containing the plant regulatory expression vector described in step (ii-3) with the engineered strain containing the plant dual fluorescein detection reporter vector in a bacterial liquid volume ratio of 1:1, injecting the mixture into tobacco, detecting the fluorescence intensity, and determining the binding and activation effect of the polynucleotide described in claim 2 with the promoter of the key enzyme gene AaHD1 for the development of glandular trichomes in Artemisia annua; (ii-5) Artificially synthesize primer probes of AaHD1 promoter and use DNA gel shift assay (EMSA) to verify the binding ability of MBP-AaMYC3 to AaHD1 promoter; Method (iii) is implemented by the following steps: (iii-1) inserting the polynucleotide as claimed in claim 2 into a protein expression vector to construct a recombinant protein expression vector; inserting the gene sequence of AabHLH1 (NCBI accession number MH349477) into the protein expression vector pET-32a+ or pHB-YFP to construct an AabHLH1 protein expression vector pET-32a+-AabHLH1 or pHB-YFP-AabHLH1; (iii-2) inserting the promoter ProADS of the key enzyme gene ADS in artemisinin biosynthesis into the vector pGreenIII0800-LUC to construct the plant dual luciferin detection reporter vector pGreenIII0800-ProADS-LUC; (iii-3) respectively transferring the recombinant protein expression vector and the AabHLH1 protein expression vector pET-32a+-AabHLH1 or pHB-YFP-AabHLH1 described in step (iii-1) and the plant dual fluorescein detection reporter vector in step (iii-2) into the engineering strain Agrobacterium to obtain engineering strains containing the recombinant protein expression vector, the AabHLH1 protein expression vector pET-32a+-AabHLH1 or pHB-YFP-AabHLH1 and the plant dual fluorescein detection reporter vector; (iii-4) mixing the engineered strain containing the recombinant protein expression vector described in step (iii-3), the engineered strain containing the AabHLH1 protein expression vector pET-32a+-AabHLH1 or pHB-YFP-AabHLH1, and the engineered strain containing the plant dual fluorescein detection reporter vector in a bacterial liquid volume ratio of 1:1:2, injecting them into tobacco, detecting the fluorescence intensity, and determining the binding and activation effect of the polynucleotide described in claim 2 with the ADS promoter, (iii-5) Artificially synthesizing primer probes of the ADS promoter, obtaining fusion proteins MBP-AaMYC3 and His-AabHLH1 by purification, and using DNA gel shift assay (EMSA) to verify the ability of MBP-AaMYC3 and His-AabHLH1 to bind to the ADS promoter; Method (iv) is implemented by the following steps: (iv-1) inserting the polynucleotide as claimed in claim 2 into a protein expression vector to construct a recombinant protein expression vector; inserting the gene sequence of AabHLH113 (NCBI accession number OP103717) into the protein expression vector pMAL-c5X or pHB-YFP to construct the AabHLH113 protein expression vector pMAL-c5X-AabHLH113 or pHB-YFP-AabHLH113; (iv-2) Inserting the promoter ProDBR2 of the key enzyme gene DBR2 in artemisinin biosynthesis into the vector pGreenIV0800-LUC to construct the plant dual luciferin detection reporter vector pGreenIV0800-ProDBR2-LUC; (iv-3) respectively transferring the recombinant protein expression vector and the AabHLH113 protein expression vector pMAL-c5X-AabHLH113 or pHB-YFP-AabHLH113 described in step (iv-1) and the plant dual fluorescein detection reporter vector in step (iii-2) into the engineering strain Agrobacterium to obtain engineering strains containing the recombinant protein expression vector, the AabHLH113 protein expression vector pMAL-c5X-AabHLH113 or pHB-YFP-AabHLH113 and the plant dual fluorescein detection reporter vector; (iv-4) mixing the engineered strain containing the recombinant protein expression vector described in step (iii-3), the engineered strain containing the AabHLH113 protein expression vector pMAL-c5X-AabHLH113 or pHB-YFP-AabHLH113, and the engineered strain containing the plant bifluorescent detection reporter vector in a bacterial liquid volume ratio of 1:1:2, injecting them into tobacco, detecting the fluorescence intensity, and determining the binding and activation effect of the polynucleotide described in claim 2 with the DBR2 promoter, (iv-5) The primer probe of DBR2 promoter was artificially synthesized, and the fusion proteins MBP-AaMYC3 and MBP-AabHLH113 were obtained by purification. The binding ability of MBP-AaMYC3 and MBP-AabHLH113 to DBR2 promoter was verified by DNA gel shift assay (EMSA).

9. The use according to claim 6, characterized in that The method comprises the following steps to cultivate new varieties of Artemisia annua: (I) connecting the polynucleotide according to claim 2 to a plant overexpression sequence vector such as pHB-FLAG to construct a plant overexpression vector containing the polynucleotide; (II) transferring the plant overexpression vector described in step (I) into a host strain Agrobacterium to obtain an engineered strain containing the plant overexpression vector, and transforming the initial Artemisia annua plant through Agrobacterium-mediated transformation to obtain a regenerated Artemisia annua plant; (III) Screening the transgenic positive plants of the regenerated Artemisia annua described in step (II) to obtain overexpression transgenic plants with artemisinin content increased by more than 10% and / or glandular trichome density increased by more than 10% compared with the initial Artemisia annua plants.

10. The use according to claim 9, characterized in that The method of transferring the host strain in step (II) is freeze-thaw method; and / or In the step (III), hygromycin is used to screen the regenerated Artemisia annua.

Images