Cellulose degradation bacillus subtilis, cellulase secreted by cellulose degradation bacillus subtilis and application of cellulose degradation bacillus subtilis

Abstract

The invention discloses cellulose degradation bacillus subtilis, cellulase secreted by the cellulose degradation bacillus subtilis and application of the cellulose degradation bacillus subtilis, and belongs to the technical field of microorganisms. The preservation number of the strain is CCTCC (China Center For Type Culture Collection) NO: M 20242073, and the preservation date is September 25, 2024. The enzyme activity of the cellulase secreted and produced by the strain is 10.93 U / mL. The invention also provides application of the strain in degradation of cellulose. The bacillus subtilis has the beneficial effects that the bacillus subtilis with efficient cellulose degradation capability is provided, and the effectiveness of the bacillus subtilis in the aspect of filter paper degradation is verified. The filter paper degradation rate of the strain reaches 28.7%, so that the strain has a better application prospect in the field of cellulose degradation.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a cellulose-degrading Bacillus subtilis strain and the cellulase secreted by the strain and application thereof. Background Art

[0002] Cellulose is the most abundant organic polysaccharide polymer in nature, which is formed by linear connection of glucose units through β-1,4-glycosidic bonds. It is the main component of plant cell walls and is widely found in agricultural waste, wood, paper and other biomass. The effective degradation and utilization of cellulose is of great significance for resource recycling, environmental protection and the development of biomass energy. The complex molecular structure of cellulose and its high crystallinity make its degradation process in nature very slow.

[0003] At present, chemical and physical methods are mostly used for the pretreatment and degradation of cellulose, but these methods often require high energy consumption, chemical reagents and expensive equipment, and may cause secondary pollution to the environment. Therefore, biodegradation, especially the use of microorganisms to degrade cellulose, has become a hot topic in research and application.

[0004] Therefore, the development of microbial resources with efficient cellulose degradation capabilities and their further application in agricultural waste treatment, paper degradation, biomass energy conversion and other fields have important application value and practical significance.

[0005] The Chinese patent application document with publication number CN116463238A discloses a strain of Bacillus subtilis that can degrade cellulose. The enzyme activities of endoglucanase, β-glucosidase, filter paper enzyme, xylanase and PASC enzyme of the strain are 4.06, 1.97, 0.74, 17.61 and 4.12 U / mL respectively. Experiments have shown that the cellulose-degradable Bacillus subtilis can significantly destroy the fiber structure of wheat straw, reduce the neutral detergent fiber and acid detergent fiber content of wheat straw by 5.8% and 11.3% respectively, and reduce the cellulose crystallinity by 3.3%. It can be used for biodegradation of crop straw and bio-fermented feed. However, the degradation efficiency of cellulose by the strain of the patent is still low, so it needs to be further improved. Summary of the invention

[0006] The technical problem to be solved by the present invention is how to provide a strain that can efficiently degrade cellulose under normal temperature.

[0007] The present invention solves the above technical problems through the following technical means:

[0008] The first aspect of the present invention provides a Bacillus subtilis, whose preservation number is CCTCC NO: M 20242073 and the preservation date is September 25, 2024.

[0009] Preferably, the 16S rRNA sequence of the strain is as shown in SEQ ID NO.1.

[0010] The second aspect of the present invention provides a cellulase, which is secreted and produced by the above-mentioned Bacillus subtilis.

[0011] Preferably, the enzyme activity of the filter paper enzyme in the culture broth of the strain is 10.93 U / mL.

[0012] A second aspect of the present invention provides a microbial agent for degrading cellulose, wherein the microbial agent comprises the above-mentioned Bacillus subtilis.

[0013] The third aspect of the present invention provides a method for preparing a microbial agent, comprising the following steps: inoculating the above-mentioned Bacillus subtilis into a culture medium, and culturing to obtain the microbial agent.

[0014] The fourth aspect of the present invention provides the use of the above-mentioned Bacillus subtilis, cellulase or microbial agent in degrading cellulose.

[0015] The fifth aspect of the present invention provides the use of the above-mentioned Bacillus subtilis, cellulase or microbial agent in the preparation of degraded cellulose products.

[0016] A sixth aspect of the present invention provides a method for degrading cellulose, comprising the following steps:

[0017] The above-mentioned microbial agent is mixed with the cellulose-containing material to be degraded.

[0018] Preferably, after mixing, the method further comprises: culturing the mixture at 25-30° C. and 100-150 rpm.

[0019] The beneficial effects of the present invention are:

[0020] The present invention proposes a strain of Bacillus subtilis with high cellulose degradation ability, which is obtained by screening from the rotten wood environment of Baimafeng, Jinzhai County, Lu'an City, Anhui Province. It has a high filter paper enzyme activity at 28°C, with a maximum of 10.93U / mg. The cellulose-degrading bacteria has important application value for promoting the resource utilization of fiber-rich filter paper. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a diagram of the purified growth morphology of cellulose degrading bacteria in Example 1 of the present invention;

[0022] Figure 2 This is a standard curve of glucose concentration in Example 1 of the present invention;

[0023] Figure 3 This is a curve diagram of enzyme activity changes during 7 days of fermentation in Example 1 of the present invention;

[0024] Figure 4 This is a microscopic examination image of Bacillus subtilis in Example 1 of the present invention;

[0025] Figure 5 is the Eootstrap phylogenetic tree of Bacillus subtilis in Example 1 of the present invention;

[0026] Figure 6 This is a graph showing the degradation rate of Bacillus subtilis filter paper in Example 2 of the present invention. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0029] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the art or according to the product instructions.

[0030] The culture medium used in the examples is:

[0031] Screening medium (CMC medium): weigh 25.3 g of cellulose Congo red plate medium powder, add distilled water to 1 L, stir to dissolve, and sterilize at 121°C for 15 minutes. Add 15 g agar to solid medium and 7.5 g agar to semi-solid medium.

[0032] Expanded medium (LB): 5 g Yeast extract, 10 g Peptone, 10 g NaCl, add deionized water to 1 L, sterilize at 115 ° C for 30 min.

[0033] Fermentation enzyme production medium: 3g Peptone, 2g (NH4)2SO4, 0.3g CaCl2.2H2O, 0.3g MgSO4, 4g KH2PO4, 1% Tween-80, 40g microcrystalline cellulose, add deionized water to 1L, adjust the pH to 5.5, and sterilize at 121°C for 20min.

[0034] Filter paper strip disintegration medium: 1.0g (NH4)2SO4, 0.5g MgSO4·7H2O, 1g K2HPO4, 1g yeast extract powder, add deionized water to 1L, filter paper strip (1×6cm 2 ) 3 strips / conical flask, sterilize at 121℃ for 20min.

[0035] Preparation of reagents used in the examples:

[0036] DNS reagent: Accurately weigh 10.6g of 3,5-dinitrosalicylic acid and 19.8g of NaOH and place them in a beaker. Add 1416mL of deionized water and heat to 45°C in a water bath. Stir with a glass rod to dissolve. After dissolution, add 306g of potassium sodium tartrate, 7.6ml of phenol, and 8.3g of sodium sulfite. Continue to stir and dissolve at 45°C. After all the added substances are dissolved, place in a brown bottle away from light for one week before use. It can be stored for 6 months at room temperature.

[0037] Citric acid buffer (0.05M, pH 4.8): Accurately weigh 210 g of monohydrated citric acid into a beaker, add 750 mL of deionized water and stir to dissolve; after all dissolved, add 60 g of NaOH until the pH value is about 4.3, and then dilute to 1 L with deionized water.

[0038] Whatman No. 1 filter paper strips: Cut Whatman No. 1 filter paper into 1×6 cm strips.

[0039] 1% glucose standard solution: Accurately weigh 0.1 g of glucose that has been dried to constant weight, dilute to 10 mL with deionized water, and prepare before use.

[0040] Crystal violet solution: Solution A: 2g crystal violet, 20mL ethanol (95%); Solution B: 0.8g ammonium oxalate, 80mL distilled water. Mix solution A and solution B and set aside.

[0041] Lugo's iodine solution: 1g iodine tablet, 2g potassium iodide. First dissolve the potassium iodide in a small amount of distilled water, then add the iodine tablet. After dissolution, add water to 300mL.

[0042] 0.5% Shahuang solution: 20mL Shahuang alcohol solution (2.5%), 80mL distilled water, 2.5% Shahuang alcohol solution is stored in a brown bottle as the mother solution and diluted when used.

[0043] Embodiment 1:

[0044] 1. Sample Processing

[0045] Weigh 4 g of the rotten wood sample from Baimafeng, Jinzhai County, Lu'an City, Anhui Province, dissolve it in sterile water, mix it well and place it at 28°C overnight. Take a sterile centrifuge tube and process the sample by gradient dilution to a dilution concentration of 10 -1 , 10-2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 For backup.

[0046] 2. Initial screening

[0047] Take 100 μL of each of the 7 dilution samples, apply them to the screening medium, and invert and culture at 28°C for 1 to 7 days. The 7 gradient-coated plates are used to preliminarily identify the colonies according to their shape, color, wetness, concavity, transparency, and number and size in the plate. A cellulose-degrading bacterium is preliminarily screened out. The selected strain is picked up with an inoculation loop and streaked on the screening medium plate for purification (such as Figure 1 After repeated streaking for secondary purification, the purified proteins were numbered and stored in a 4°C refrigerator.

[0048] 3. Rescreening

[0049] The strain obtained in the initial screening was inoculated into 50 mL of LB medium, and cultured at 28°C, 120 rpm for 3 days. The seed liquid of the expanded culture was inoculated into 100 mL of liquid enzyme production medium at a 5% inoculation rate, and cultured at 28°C, 120 rpm. The cellulose filter paper enzyme activity was measured, and the high cellulase-producing strain was selected based on the changes in enzyme activity.

[0050] Preparation of crude enzyme solution: inoculate the screened strain into the seed culture medium, culture at 28°C, 120rpm shaking, take 2mL of fermentation liquid every day, centrifuge at 12000rpm for one minute, and take the supernatant as the crude enzyme solution.

[0051] Cellulose filter paper enzyme activity test:

[0052] Prepare the standard solution of glucose according to the dilution ratio in Table 1 below.

[0053] Table 1 Glucose standard solution

[0054]

[0055] Take 1.00mL of glucose solution in Table 1 and add it to the graduated test tube, add 2.00mL of deionized water and 2.00mL of DNS, vortex for 5s, boil in water bath for 5min, cool to room temperature with running water, make up to 25mL, adjust the blank sample to zero, measure the absorbance of the solution at 540nm, and draw a glucose standard curve. (e.g. Figure 2 (shown)

[0056] Take 0.5 mL of enzyme solution and add it to a 5 mL EP tube with a filter paper strip (60 mm × 10 mm), add 2.0 mL of citric acid buffer, react at 50 ° C for 30 min, add 2.5 mL of DNS reagent, vortex and oscillate for 5 seconds, and place in a water bath at 100 ° C for 5 minutes. OD 540 Determine its absorbance and calculate the enzyme activity in U / mL. After 5 days of fermentation, the enzyme activity reached 10.93U / mL. Figure 3 (shown)

[0057] In comparison, the filter paper enzyme (FPA) activity of the cellulose-degrading bacteria C8 screened out in [Chen Huan, Shi Zihao, Wu Chunhui, et al. Screening and mutation breeding of high-yield cellulose-degrading bacteria and study of their straw degradation effects [J]. Journal of Animal Nutrition, 2024, 36(12): 8126-8136] was 3.96 U / mL, and this strain was 6.31 U / mL.

[0058] The filter paper enzyme activity of Bacillus subtilis HS6-2 screened from [Annie, Xu Ruiyang, Wu Xi, et al. Screening, identification and whole genome analysis of a straw-promoting Bacillus subtilis [J]. Bulletin of Microbiology, 2024] was 3.48U / mL.

[0059] [Ran Yizhi, Linghu Meilin, Ma Shijin, et al. Screening of a straw-degrading strain and study of its degradation effect [J]. Journal of Guizhou University (Natural Science Edition), 2024, 41(05): 118-124] The filter paper enzyme activity of the strain TP-125 with straw degradation function reached the highest on the 5th day, which was 16.76U / mL.

[0060] [Li Guanxi, Guo Shuai, Zhu Nianlei, et al. A cellulose-degrading bacterium and its application [P]. Shandong Province: CN202210496458.5, 2023-08-22] A Bacillus bacterium with cellulose-degrading ability was screened out from Agaricus bisporus cultivation material, and the filter paper enzyme activity was 1.88U / mL.

[0061] [Yu Meixia, Zhu Yu, Cheng Dan, et al. Screening and identification of cellulose-degrading bacteria in wine lees sludge [J]. Journal of Fuyang Normal University (Natural Science Edition), 2021, 38(2): 58-62] The filter paper enzyme activity of Bacillus Velezii screened in the experiment reached 8.436 U / mL on the fifth day of culture.

[0062] Enzyme activity was defined as: 1 mL of crude enzyme solution hydrolyzed the substrate to produce 1 μmol of reducing sugar per minute, which was 1 enzyme unit.

[0063] The enzyme activity calculation formula is:

[0064]

[0065] Enzyme activity calculation references:

[0066] Chen Huan et al., Screening and breeding of high-yield cellulose-degrading bacteria and study on their straw degradation effects. Journal of Animal Nutrition, 2024, 36(12): 8126-8136.

[0067] n—sample dilution multiple.

[0068] 5. Identification

[0069] Morphological identification of strains (e.g. Figure 4 (shown)

[0070] Bacterial cells are extremely small and transparent. When observed under an optical microscope using a water-immersion slide, only their general shape and movement can be seen. If you want to observe their detailed shape and main structure under an optical microscope, they must be stained.

[0071] (1) The rescreened strain Bacillus subtilis was inoculated into LB liquid culture medium and cultured at 28°C and 200 rpm for 20 hours.

[0072] (2) Place a drop of sterile water in the center of a clean glass slide. Use a sterile inoculation loop to take a small amount of the bacteria to be observed, mix it thoroughly with the water drop, and apply it to form a very thin bacterial film.

[0073] (3) After the smear has dried in the air, hold the slide at one end with the biofilm facing up and pass it over low heat three times to cool.

[0074] (4) Staining: Primary staining: add crystal violet solution and stain for 1 to 1.5 minutes; Mordanting: add Lugo's iodine solution and stain for 1 to 2 minutes; wash with water; Decolorization: add 95% ethanol, shake, pour off the ethanol, repeat 2 to 3 times; wash with water; Restaining: add safranin and stain for 1 minute to several minutes; wash with water; dry.

[0075] (5) Microscopic examination.

[0076] Molecular biological identification of strains

[0077] Take the fermentation broth of Bacillus subtilis strain cultured overnight at 28°C and 200rpm, centrifuge to obtain the bacteria, extract with AxyPrep bacterial genome extraction kit, and amplify the 16S gene of the strain with primers 27F (5′~3′ sequence: AGAGTTTGATCTGGCTCAG) and 1492R (5′~3′ sequence: GGCTACCTTGTTACGACTT). The PCR amplification program is: 94°C pre-denaturation reaction for 5 minutes, 55°C annealing for 2 minutes, 72°C extension for 2 minutes, 94°C denaturation for 1 minute, 55°C annealing for 50 seconds, 72°C extension for 55 seconds, the number of cycles is set to 30 times, 72°C reaction for 5 minutes, and storage at 4°C. The PCR product was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequence detection. The measured sequence was aligned by Blast on NCBI, and the phylogenetic tree was drawn with MEGA 11 (such as Figure 5 The result showed that the strain was Bacillus subtilis, and the deposit date was September 25, 2024, the deposit unit was China Center for Type Culture Collection, the deposit number was CCTCC NO: M 20242073, and the classification name was: Bacillus subtilis Rottenwood-LA. The 16S rRNA sequence of the strain is shown in SEQ ID NO.1:

[0078] GCATGCGGGGTGCTATACATGCAGTCGAGCGGACAGATGGGAGCTTGCTCCCTGAT

[0079] GTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATA

[0080] ACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAACA

[0081] TAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCGGCGCATTAGCTAGTTG

[0082] GTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCG

[0083] GCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGA

[0084] ATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGT

[0085] TTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCG

[0086] GTACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGC

[0087] GGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAG

[0088] GCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGG

[0089] AAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGCGGTG

[0090] AAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCGACTCTCTGGTCTGTA

[0091] ACTGACGCTGAGGAGCGAAAGCGTGGGGAGCGAACAGGATTAGATACCCTGGTA

[0092] GTCCACGCCGTAAACGATGAGTGCTAAGTGTTAGGGGGTTTCCGCCCCTTAGTGCT

[0093] GCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGGTCGCAAGACTGAAACTC

[0094] AAAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGC

[0095] AACGCGAAGAACCTTACCAGGTCTTGACATCCTCTGACAATCCTAGAGATAGGAC

[0096] GTCCCCTTCGGGGGCAGAGTGACAGTGTGCATGGTTGTCGTCAGCTCGTGTCGTG

[0097] AGATGTTGGGTTAGTCCCGCACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAGTTGGGCACCTTCTA(SEQ ID NO.1)

[0098] Example 2: Degradation capacity during Bacillus subtilis fermentation

[0099] The Bacillus subtilis of Example 1 was inoculated into LB liquid culture medium and cultured at 28°C and 120rpm. During the 1-7 days of culture, the bacterial solution was aspirated on a clean bench every 24 hours and transferred to 100mL disintegration culture medium containing about 0.4g filter paper strips at a 1% inoculum amount. The reaction was carried out at 28°C and 120rpm for 30min. The filter paper was weighed before preparing the filter paper strip disintegration culture medium. After the culture was completed, the filter paper was taken out of the fermentation liquid and dried and weighed. The degradation rate of the filter paper was calculated based on the weight loss of the filter paper. The degradation rate of the filter paper by Bacillus subtilis reached the highest on the fifth day, with a degradation rate of 28.7%. (As shown in Figure 6 (shown)

[0100] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Bacillus subtilis, characterized in that Its deposit number is CCTCC NO: M 20242073, and the deposit date is September 25, 2024.

2. The Bacillus subtilis according to claim 1, characterized in that The 16S rRNA sequence of the strain is shown as SEQ ID NO.

1.

3. A cellulase, characterized in that The cellulase is secreted and produced by the Bacillus subtilis according to claim 1, and the enzymatic activity of the cellulase is 10.93 U / mL.

4. A microbial agent for degrading cellulose, characterized in that: The microbial agent comprises the Bacillus subtilis according to claim 1.

5. A method for preparing a microbial agent, characterized in that: The method comprises the following steps: inoculating the Bacillus subtilis described in claim 1 into a culture medium, and culturing to obtain the microbial agent.

6. Use of the Bacillus subtilis according to claim 1, the cellulase according to claim 3 or the microbial agent according to claim 4 in degrading cellulose.

7. Use of the Bacillus subtilis according to claim 1, the cellulase according to claim 3 or the microbial agent according to claim 4 in the preparation of degraded cellulose products.

8. A method for degrading cellulose, characterized in that: The following steps are involved: The microbial agent according to claim 4 is mixed with the cellulose-containing material to be degraded.

9. The method for degrading cellulose according to claim 8, characterized in that: After mixing, the method further comprises: culturing the mixture at 25-30° C. and 100-150 rpm.

10. The method for degrading cellulose according to claim 9, characterized in that: The mixture was incubated at 28°C and 120 rpm.

Images