Method for improving citrus canker resistance by using CsSERK1 gene

Abstract

The invention relates to the technical field of agricultural biological genes, and discloses a method for improving citrus canker resistance by using a CsSERK1 gene, and the citrus canker resistance of citrus plants is improved by adjusting the expression level of CsSERK1 protein in citrus plants. The method specifically comprises the following steps: (1) cloning a citrus CsSERK1 gene sequence; (2) constructing an overexpression vector; and (3) transforming the overexpression vector into citrus to obtain a transgenic plant with an up-regulated CsSERK1 gene expression level. By cloning a coding sequence of the citrus CsSERK1 gene, constructing an overexpression vector and then transforming the citrus, the canker attack degree of the obtained CsSERK1 overexpression transgenic plant can be reduced to 51.74% of that of the existing citrus to the maximum extent, the canker attack degree can be effectively and remarkably reduced, the scab area is reduced, the phenotype of the transgenic plant is not influenced, and the application prospect is broad. The gene has a great application value for canker-resistant breeding of citrus, and can be used as a candidate gene for canker-resistant breeding with a plurality of canker-resistant and susceptible genes.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological gene technology, and in particular to a method for improving resistance to citrus canker disease by utilizing the CsSERK1 gene. Background Art

[0002] Citrus is the main economic pillar of the southern mountainous areas. In recent years, citrus planting has been expanded every year. However, with the development of the industry, citrus is also very susceptible to diseases. One of the most common diseases is citrus canker (Citrus Bacteria Canker, CBC). Citrus canker is the main bacterial disease in citrus producing areas. It is caused by the plant pathogen Xanthomonas citri subsp. citrus ( Xanthomonas citri subsp. Citri, Xcc ) triggered. Xcc It can infect above-ground parts such as leaves, fruits, branches and sepals; Xcc The fruits may turn yellow and fall off. The premature falling and discoloration of the fruits will cause huge economic losses. Studies have found that different citrus varieties have different resistance to citrus canker. Sour oranges and sweet oranges are the most susceptible to the disease, followed by lemons, pomeloes, and grapefruits, and kumquats are the most resistant.

[0003] Up to now, there is no cure for citrus canker. Physical control, chemical control and integrated control are mainly used to prevent the occurrence of canker. However, the large-scale use of chemical agents will cause irreversible pollution to the environment. Strict epidemic prevention systems can prevent the spread of pathogens, but they cannot completely eliminate diseased trees. Therefore, new disease-resistant varieties can be cultivated in citrus canker epidemic areas to enhance the ability of citrus to resist canker, thereby achieving the effect of prevention and control. The long hybrid breeding cycle makes breeding efficiency low. With the rise of molecular biology, people began to study the pathogens themselves and the disease resistance of plants from the direction of disease-resistant gene engineering. With the continuous discovery of disease-resistant genes, new ideas have been provided for citrus molecular breeding. CsBZIP40 overexpression affects the production of salicylic acid and the expression of genes related to its signaling pathway. Defense genes can be activated through the SA signaling pathway, which plays an important role in improving resistance to citrus canker. After overexpression or interference expression of transcription factors such as CitMYB20, CsWRKY61, CsAP2-09, and CsLOB1 in citrus, the resistance of transgenic citrus to ulcer disease changed, indicating that these transcription factors are related to ulcer disease. CRISPR / Cas9-mediated genome editing of CsWRKY22 and interference mutation of CsDMR6 significantly reduced susceptibility to citrus ulcer disease.

[0004] Somatic embryogenesis receptor kinases (SERKs) are members of subfamily II LRR-RLKs, originally discovered in carrots, and have been found to have a wider range of functions in plant growth, development, and defense responses. For example, in Arabidopsis, AtSERKs interact with ERf to coordinate the development of the female gametophyte and surrounding sporophyte; Arabidopsis AtSERK4 plays a negative regulatory role in leaf senescence; and in cotton, GhSERK positively regulates GRF7-mediated innate immune responses and improves plant resistance to Verticillium wilt infection. At present, there is no research and application of using SERKs to improve citrus resistance to citrus canker.

[0005] In view of this, this application is hereby filed. Summary of the invention

[0006] The present invention provides a method for improving the resistance of citrus to canker disease by utilizing the CsSERK1 gene. The method comprises integrating a CsSERK1 gene overexpression vector of a citrus somatic embryogenesis receptor kinase into citrus to promote the accumulation of CsSERK1 protein in citrus, thereby significantly improving the resistance of citrus to canker disease without affecting the phenotype of transgenic plants. The method has great application value in breeding citrus to resist canker disease, and can be used as a candidate gene to carry out breeding for canker disease resistance together with multiple canker disease resistance and susceptible genes.

[0007] The present invention is achieved through the following technical solutions: In a first aspect, the present invention provides a method for improving resistance to citrus canker using the CsSERK1 gene, wherein the resistance of citrus plants to citrus canker is improved by regulating the expression level of the CsSERK1 gene in citrus plants. The nucleotide sequence of the CsSERK1 gene is shown in SEQ ID NO: 1.

[0008] In a specific embodiment, the specific method for regulating the expression level of the CsSERK1 gene is: upregulating the expression level of the CsSERK1 gene in citrus plants.

[0009] In a specific embodiment, the method of up-regulating the expression level of CsSERK1 gene in citrus plants is: using an overexpression vector to up-regulate the expression level of CsSERK1 gene in citrus cells.

[0010] In a specific embodiment, a method for improving resistance to citrus canker using the CsSERK1 gene comprises the following steps: (1) Cloning the coding sequence of the citrus CsSERK1 gene; (2) Construction of CsSERK1 gene overexpression vector; (3) The CsSERK1 gene overexpression vector was used to transform citrus to obtain transgenic plants with improved resistance to ulcer disease.

[0011] In a specific embodiment, in step (1), the cloning method of the citrus CsSERK1 gene coding sequence is: extracting citrus total RNA, then reverse transcribing it into cDNA, and finally amplifying the CsSERK1 gene coding sequence DNA fragment by PCR.

[0012] In a specific embodiment, in step (1), the primers used for PCR amplification are OE-CsSERK1-F and OE-CsSERK1-R, and their nucleotide sequences are SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0013] In a specific embodiment, in step (2), the method for constructing the CsSERK1 overexpression vector is: the CsSERK1 coding sequence DNA fragment recovered by digestion with KpnⅠ and SalI is ligated to the pLGNe vector recovered by digestion with KpnⅠ and SalI to construct the overexpression vector pLGNe-CsSERK1.

[0014] In a specific embodiment, in step (3), the method for transforming citrus with the CsSERK1 overexpression vector is as follows: the overexpression vector pLGNe-CsSERK1 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens. The explant cells after genetic transformation are identified by GUS staining, micrografting, field grafting, PCR identification, and qRT-PCR analysis of the CsSERK1 expression level to obtain transgenic plants.

[0015] In a specific embodiment, the transgenic plants were verified by PCR using primers ID-CsSERK1-F and ID-CsSERK1-R, whose nucleotide sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0016] In a specific embodiment, the expression level of CsSERK1 gene is detected by qRT-PCR, and the primers used are RT-CsSERK1-F and RT-CsSERK1-R, whose nucleotide sequences are SEQ ID NO: 6 and SEQ ID NO: 7, respectively.

[0017] In a specific embodiment, after the transgenic plants are obtained, the resistance of the transgenic plants is evaluated to determine that overexpression of CsSERK1 improves resistance to citrus canker.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: 1. A method for improving resistance to citrus canker using the CsSERK1 gene provided in an embodiment of the present invention comprises cloning the coding sequence of the citrus CsSERK1 gene, constructing an overexpression vector, and then transforming the citrus epicotyls using the Agrobacterium tumefaciens-mediated method. The degree of canker in the obtained CsSERK1 overexpressing transgenic plants can be reduced to 51.74% of that in existing citrus plants at most, which can effectively and significantly reduce the degree of canker and reduce the area of ​​lesions. 2. A method for improving resistance to citrus canker using the CsSERK1 gene provided in an embodiment of the present invention, by integrating the CsSERK1 gene overexpression vector of citrus somatic embryogenesis receptor kinase into citrus, promoting the accumulation of CsSERK1 protein in citrus, and significantly improving resistance to citrus canker without affecting the phenotype of transgenic plants; 3. The embodiment of the present invention provides a method for improving citrus canker resistance by utilizing the CsSERK1 gene. By overexpressing the CsSERK1 gene, the resistance of transgenic plants to canker can be greatly improved. The method has great application value in citrus canker resistance breeding and can be used as a candidate gene together with multiple canker resistance and susceptible genes for canker resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 The bioinformatics characteristics of the citrus CsSERK1 gene of the embodiment of the present invention are as follows: A is the chromosome location of the citrus CsSERK1 gene, bp represents base; B is the gene structure of citrus CsSERK1; C is the conserved domain of the citrus CsSERK1 gene, aa represents amino acid.

[0021] Figure 2 This is the electrophoresis diagram of PCR amplification of the citrus CsSERK1 gene cloned in the example of the present invention: CDS represents the CsSERK1 coding sequence; M represents the DNA molecular weight standard, the same below.

[0022] Figure 3 This is a structural diagram of the citrus CsSERK1 gene overexpression vector of an embodiment of the present invention: GUS represents the β-glucosidase gene; NPTII represents the neomycin phosphotransferase gene; 35S represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the opine synthase gene terminator.

[0023] Figure 4 This is a flow chart of citrus genetic transformation according to an embodiment of the present invention.

[0024] Figure 5 This is a GUS staining image of the transgenic plants of the examples of the present invention: OE-SERK-1, OE-SERK-2, and OE-SERK-3 represent transgenic plants, respectively, and WT represents the wild-type Wanjin Orange plant, the same below.

[0025] Figure 6 This is a PCR identification diagram of the transgenic plant in the embodiment of the present invention.

[0026] Figure 7 This is a graph analyzing the expression of CsSERK1 in the transgenic plants of the present invention: * indicates a significant difference compared with WT (P<0.05), ** indicates an extremely significant difference compared with WT (P<0.01), *** indicates an extremely significant difference compared with WT (P<0.001), **** indicates an extremely high significant difference compared with WT (P<0.0001), the same below.

[0027] Figure 8 This is a symptom diagram of the transgenic plant leaves in the embodiment of the present invention 10 days after inoculation of ulcer bacteria.

[0028] Fig. 9 This is a statistical chart of the size of lesions on the leaves of the transgenic plants of the present invention 10 days after being inoculated with canker bacteria.

[0029] Fig.10 This is a statistical graph of the disease index of the transgenic plant leaves in the embodiment of the present invention 10 days after inoculation of ulcer bacteria. DETAILED DESCRIPTION

[0030] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0031] In the following description, a large number of specific details are set forth in order to provide a thorough understanding of the present invention. However, it is apparent to one of ordinary skill in the art that these specific details do not have to be employed to practice the present invention. In other embodiments, in order to avoid obscuring the present invention, well-known structures, materials or methods are not specifically described.

[0032] Throughout the specification, references to "one embodiment," "an embodiment," "an example," or "an example" mean that a particular feature, structure, or characteristic described in conjunction with the embodiment or example is included in at least one embodiment of the present invention. Therefore, the phrases "one embodiment," "an embodiment," "an example," or "an example" appearing in various places throughout the specification do not necessarily all refer to the same embodiment or example. In addition, particular features, structures, or characteristics may be combined in one or more embodiments or examples in any suitable combination and / or sub-combination. In addition, it will be appreciated by those of ordinary skill in the art that the figures provided herein are for illustrative purposes and that the figures are not necessarily drawn to scale. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0033] In the description of the present invention, the directions or positional relationships indicated by terms such as “front”, “rear”, “left”, “right”, “up”, “down”, “vertical”, “horizontal”, “high”, “low”, “inside” and “outside” are based on the directions or positional relationships shown in the accompanying drawings and are only for the convenience of describing the present invention and simplifying the description. They do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operated in a specific direction. Therefore, they should not be understood as limiting the scope of protection of the present invention.

[0034] Example 1

[0035] Bioinformatics Analysis of Citrus CsSERK1 Gene like Figure 1 As shown, the citrus CsSERK1 gene is located between 26352854 bp and 26354079 bp on citrus chromosome 3. The full length of the CsSERK1 gene is 1.23 Kbp, the full length of the CDS sequence is 621 bp, and it can encode 206 amino acids. Analysis of the protein sequence showed the existence of an obvious LRRNT_2 structural functional domain.

[0036] Nucleotide sequence of CsSERK1 gene SEQ ID NO: 1: ATGGCGTCTCAATCTCATTTATATGTTCTGTTTGTGATTGTTGTGGGCGTGGCTGCCTTTGCCGCCCCTGTAAAATGTAATATGGAAGTGGATGCTCTTTATACCTGGAGAACCATGTTGAGTGACCCAAACAATGTTCTCCAAAGCTGGGATCC AACTTTGGTCAATCCATGCACCTGGTTTCACGTTACCTGCAACAGCGAGGACATCGTCGTCAGGGTGGACCTTGGTAATGCCGGATTAAGCGGACCTCTTGTTCCTCAGCTTGGACTTCTGACTAATCTTCAGTATCTGTCTGTTTATAAAAATA ACATAAGTGGATCGATTCCAAGCGAGATTGGTAATTTAAAGAAGCTGATCAGCTTGGGCCTGTTCAACAATCAATTGTCAGGGGCCATTCCAGCATCCATTGGAAACTTGAGATCCTTGAAGTTCATGAGATTGAATAATAACAATCTAACTGGC AGAATACCAAGAGAGGTGATTCAGCTCATTATAAATGGCAGTTTAAGAATCCTGAACGTAGCAAACAATTCACTGCCAGGGACTATGAGGGCCACAAACTCAACGGGATATGCCATCACAAGCGTCATACAAGACCCAAGAGCTCGAAAGTATTAA

[0037] Example 2 Cloning of the coding sequence of Citrus CsSERK1 gene 1. RNA Extraction and cDNA Synthesis Total RNA from citrus (Wanjincheng) leaves was extracted using a plant total RNA extraction kit (Adlai, CAT: RN09), the RNA quality was verified by agarose gel electrophoresis, and its concentration was measured using a concentration meter. Reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, CAT: RR036A) was used to synthesize cDNA for subsequent experiments.

[0038] 2. PCR Amplification of the CsSERK1 Gene Coding Sequence

[0039] The CsSERK1 coding sequence was amplified from citrus cDNA using primers OE-CsSERK1-F (SEQ ID NO: 2), OE-CsSERK1-R (SEQ ID NO: 3) and high-fidelity enzyme PrimeSTARMaxDNA Polymerase (TaKaRa, CAT: R045Q) to obtain a DNA fragment with a length of 696 bp (e.g. Figure 2 As shown in the figure, the amplified DNA fragment was sequenced and confirmed to be the coding sequence of the citrus CsSERK1 gene (SEQ ID NO: 1). Under ultraviolet light, a clean blade was used to cut the agarose gel block containing the target fragment, and the DNA fragment was recovered using a gel recovery kit (BioFlux, CAT: BSC02M1). Among them, the primer OE-CsSERK1-R (SEQ ID NO: 3) contained a flag tag.

[0040] PCR amplification program: 94°C, 5 min; 94°C, 30 s, 58°C, 30 s, 72°C, 1.5 min, 35 cycles; extension at 72°C for 10 min.

[0041] The nucleotide sequence of primer OE-CsSERK1-F is SEQ ID NO: 2: GGTACCATGGCGTCTCAATCTCATTTATATGTTC The nucleotide sequence of primer OE-CsSERK1-R is SEQ ID NO: 3: GTCGACTTACTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTGTAATCCTTATCATCATCCTTGTAATCATACTTTCGAGCTCTTGGGTCTTG

[0042] Example 3 Construction of Citrus CsSERK1 Gene Overexpression Vector and Transformation of Agrobacterium 1. Construction of overexpression vector The CsSERK1 coding sequence DNA fragment and the overexpression vector pLGNe were double digested with restriction endonucleases KpnⅠ and SalI (ThermoFisher) and then recovered from the gel. The ligation products were ligated overnight at 16°C using a T4 DNA Ligase kit (Promega, CAT: M1801). The ligation products were transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsSERK1 overexpression vector pLGNe-CsSERK1 (such as Figure 3 as shown).

[0043] 2. Transformation of Agrobacterium with overexpression vector

[0044] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The method is as follows: pre-thaw the frozen Agrobacterium competent cells EHA105 (50 μL) on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, mix it by blowing, and place it on ice for 5 min; transfer the mixed solution to the bottom of the previously dried electric shock cup, put the electric shock cup into the card slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL LB liquid culture medium (containing 50 mg / L of antibiotic kanamycin) to the electric shock cup, blow and mix it with a pipette, transfer it to a sterile centrifuge tube, and shake and culture it on a shaker at 260 r / min and 28°C for 60 min; centrifuge the bacterial solution at 10000 r / min for 1 min, discard the supernatant (about 100 μL of liquid is left for resuspending the bacteria), spread the resuspended bacteria on LB solid culture medium, and culture inverted at 28°C in the dark for 2 days; after bacterial plaques grow, use primers OE-CsSERK1-F (SEQ ID NO: 2) and OE-CsSERK1-R (SEQ ID NO: 3) to verify the single colony by PCR.

[0045] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0046] Example 4 Genetic transformation of citrus with CsSERK1 gene overexpression vector The genetic transformation process of citrus is as follows Figure 4 As shown, the specific operations are as follows: 1. Obtaining epicotyls of citrus seedlings

[0047] Fresh citrus fruits were washed and surface disinfected with 70% alcohol. The seeds were taken out under sterile conditions, the seed coats were peeled off using a sterile scalpel in a clean bench, and the seeds were germinated on seed culture medium. They were cultured in the dark at 28°C for 3 weeks, and then cultured under 16 h light / 8 h dark conditions for 1 week. The epicotyls of the germinated seedlings were taken under sterile conditions and cut into 1.5 cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.

[0048] 2. Preparation of Agrobacterium tumefaciens culture medium

[0049] Before transfection, streak the Agrobacterium (containing the pLGNe-CsSERK1 vector) for transfection on LB solid medium containing 50 mg / L kanamycin; pick a single colony and inoculate it into 25 mL LB liquid medium containing the same antibiotics, and culture it with shaking at 28°C overnight; first dilute the bacterial solution to OD=0.1 and then continue to culture it to OD=0.5 (measurement light wavelength is about 600nm), centrifuge it at 5000r / min for 10 min, discard the supernatant, and resuspend it in MS liquid medium at pH5.4 for transfection.

[0050] 3. Transformation of Citrus Epicotyls

[0051] Soak the citrus epicotyl stem segments in Agrobacterium solution for 13 min and then wipe them dry. Transfer the stem segments to co-cultivation medium and culture them in the dark at 26°C for 2 days. After the co-cultivation is completed, transfer the epicotyls to the screening medium and culture them in the dark at 28°C for 7 days. Culture the epicotyls at 28°C, 16h light / 8h dark, subculture every two weeks, and then identify them by GUS staining.

[0052] 4. Seedling Culture of Transformants

[0053] When the seedlings that were stained positive grew to more than 1 cm, they were cut and grafted onto Wanjin orange seedlings in sterile test tubes and cultured in seedling medium; when the seedlings grew to about 5 cm, they were grafted onto Citrus aurantium seedlings and cultured in a greenhouse at 28°C. The negative seedlings from the same batch were grafted in the same way as negative controls for subsequent experiments.

[0054] The culture medium used in this embodiment is as follows: Seed germination medium: MS + 30g / L sucrose + 2.5g / L Gelrite, PH 5.8.

[0055] Co-culture medium: MS+2mg / L BA+0.5mg / L IAA+1mg / L 2,4–D+100μmolAS+30g / L sucrose+2.5g / L Gelrite, PH 5.8.

[0056] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, PH 5.8.

[0057] Seedling medium: MS+30g / L sucrose, PH 5.8.

[0058] Example 5 Verification of transgenic plants overexpressing CsSERK1 gene 1. GUS staining identification of transgenic plants The leaves of the transgenic plants obtained in the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The edges of the leaf discs of the positive plants showed blue color, while the leaf discs of the WT plants did not show color (e.g. Figure 5 as shown).

[0059] 2. PCR identification of transgenic plants

[0060] 100 mg of leaves from transgenic plants were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsSERK1 coding sequence in the citrus genome. The detection primers were ID-CsSERK1-F (SEQ ID NO: 4) and ID-CsSERK1-R (SEQ ID NO: 5). A 716 bp amplified fragment was obtained from positive plants, while no amplification was obtained from WT plants (e.g. Figure 6 as shown).

[0061] PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min.

[0062] 3. qRT-PCR Analysis of Transgenic Plants

[0063] Total RNA (Adelaide, CAT No: RN09) was extracted from the leaves of transgenic plants, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsSERK1-F (SEQ ID NO: 6) and RT-CsSERK1-R (SEQ ID NO: 7). -△△Ct The relative expression of CsSERK1 gene in transgenic plants was calculated by the following method: the water-treated sample was defined as the reference factor, i.e., its CsSERK1 expression level was 1, and then the multiple of gene expression in transgenic citrus relative to the reference factor was calculated. -△△Ct , which is the relative expression level. The results showed that the CsSERK1 gene was expressed at a higher level in transgenic plants than in wild-type plants (up to 421 times that of the control) (e.g. Figure 7 as shown).

[0064] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0065] The nucleotide sequence of primer ID-CsSERK1-F is SEQ ID NO: 4: TTGTGATTGTTGTGGGCGTG Primer ID-CsSERK1-R Detection-R Nucleotide sequence SEQ ID NO: 5: TCATAGGCGTCTCGCATATCTCATT The nucleotide sequence of primer RT-CsSERK1-F detection-F is SEQ ID NO: 6: GTTACCTGCAACAGCGAGGA The nucleotide sequence of primer RT-CsSERK1-R detection-R is SEQ ID NO: 7: TTGAACAGGCCCAAGCTGAT

[0066] Example 6 Evaluation of resistance of transgenic plants overexpressing CsSERK1 gene The mature leaves of the transgenic plants were washed, disinfected with 75% alcohol, rinsed with sterile water, and placed on a clean bench. The veins were punctured with a needle, and the ulcer pathogen liquid was applied with a pipette. 1 μL (1 × 10 5 CFU / mL); cultured in a 28℃ constant temperature and light incubator (16h light / 8h dark); photos were taken 10 days after the leaves were spotted with bacteria, and the lesion area was counted using Image J V1.47 software.

[0067] The disease is divided into grades 0-7 according to the area of ​​the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm 2 ), level 1 (0.25 mm 2 <R≤0.5mm 2 ), level 2 (0.5 mm 2 <R≤0.75mm 2 ), level 3 (0.75 mm 2 <R≤1mm 2 ), level 4 (1.0 mm 2 <R≤1.25mm 2 ), 5 levels (1.25 mm 2 <R≤1.5mm 2 ), level 6 (1.5 mm 2 <R≤1.75mm 2 ), 7th level (R>1.75 mm 2 ); Calculate the disease index according to the formula: DI = 100 X Σ (number of lesions at each level X corresponding level value) / (total number of lesions X maximum level).

[0068] The results showed that 10 days after inoculation with the canker bacteria, both the overexpressing plants and the WT plants grafted at the same time developed disease to varying degrees, and there were certain differences in the size of the lesions (e.g. Figure 8 ). According to statistics and analysis, the lesion area of ​​transgenic plants was significantly smaller than that of wild-type controls, ranging from 57.91% to 79.11% of the controls (as shown in Fig. 9 The disease index of transgenic plants was significantly lower than that of wild-type controls, ranging from 56.74% to 81.98% of the controls (as shown in Fig.10 As shown). It can be seen that overexpression of CsSERK1 can significantly reduce the lesion area of ​​citrus bacterial canker and alleviate the severity of citrus bacterial canker.

[0069] It can be seen that overexpression of CsSERK1 can greatly reduce the lesion area of ​​ulcer disease and alleviate the severity of ulcer disease. This gene can be used independently for disease resistance molecular breeding, or it can be used together with other disease resistance or disease susceptibility genes for citrus ulcer disease resistance molecular breeding.

[0070] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for improving resistance to citrus canker using the CsSERK1 gene, characterized in that: The resistance of citrus plants to citrus canker is improved by regulating the expression level of the CsSERK1 gene in citrus plants. The nucleotide sequence of the CsSERK1 gene is shown in SEQ ID NO:

1.

2. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 1, characterized in that: The specific method for regulating the expression level of the CsSERK1 gene is: upregulating the expression level of the CsSERK1 gene in citrus plants.

3. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 2, characterized in that: The method for up-regulating the expression level of the CsSERK1 gene in citrus plants is: using an overexpression vector to up-regulate the expression level of the CsSERK1 gene in citrus cells.

4. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 3, characterized in that: The following steps are involved: (1) Cloning the coding sequence of the citrus CsSERK1 gene; (2) Construction of CsSERK1 gene overexpression vector; (3) The CsSERK1 gene overexpression vector was used to transform citrus to obtain transgenic plants with improved resistance to ulcer disease.

5. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 4, characterized in that: In step (1), the cloning method of the citrus CsSERK1 gene coding sequence is: extracting citrus total RNA, then reverse transcribing it into cDNA, and finally amplifying the CsSERK1 gene coding sequence DNA fragment by PCR.

6. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 5, characterized in that: In step (1), the primers used for PCR amplification are OE-CsSERK1-F and OE-CsSERK1-R, and their nucleotide sequences are SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

7. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 4, characterized in that: In step (2), the method for constructing the CsSERK1 overexpression vector is as follows: the CsSERK1 coding sequence DNA fragment recovered by digestion with KpnⅠ and SalI is ligated to the pLGNe vector recovered by digestion with KpnⅠ and SalI to construct the overexpression vector pLGNe-CsSERK1.

8. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 7, characterized in that: In step (3), the method for transforming citrus with the CsSERK1 overexpression vector is as follows: the overexpression vector pLGNe-CsSERK1 is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens mediation, and the transgenic plants are obtained by genetic transformation.

9. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 4, characterized in that: The invention also includes verifying the transgenic plants by PCR, using primers ID-CsSERK1-F and ID-CsSERK1-R, whose nucleotide sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

10. The method for improving resistance to citrus canker using the CsSERK1 gene according to claim 4, characterized in that: The method also includes detecting the expression level of CsSERK1 gene by qRT-PCR, using primers RT-CsSERK1-F and RT-CsSERK1-R, whose nucleotide sequences are SEQ ID NO: 6 and SEQ ID NO: 7, respectively.

Images