A structural variation marker based on the ARL13B gene and its detection method for Wenchang chicken breeding
By detecting and screening the structural variation marker sequence of the ARL13B gene and designing primers for PCR amplification and electrophoresis verification, the problem of uneven weight in the breeding of Wenchang chickens was solved, and the targeted breeding of Wenchang chicken weight was achieved to meet market demand.
Patent Information
- Application Number
- CN202510199304.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-02-24
AI Technical Summary
In the existing technology, the problem of the weight detection method of Wenchang chicken on the market has not been effectively solved. In the existing technology, it is impossible to effectively screen by detecting the ARL13B gene, resulting in the problem that cannot be effectively solved.
The structural variation marker sequence of the ARL13B gene was obtained through detection and screening, and specific primers were designed for PCR amplification. Agarose gel electrophoresis was used to verify and screen out individuals lacking the structural variation marker sequence. This was used in the breeding of Wenchang chickens to increase their weight.
The structural variation marker sequences obtained through detection and screening were used as molecular markers, which significantly increased the weight of Wenchang chickens and met the market demand for uniform weight.
Smart Images
Figure CN119662857B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering, in particular to a method based on ARL13B Gene and structural variation markers and their detection methods used in Wenchang chicken breeding. Background Art
[0002] Wenchang chicken generally refers to the Hainan Wenchang chicken, a broiler breed native to Hainan Province, China. Compared to other chicken breeds, Wenchang chickens possess distinct characteristics, both in appearance and meat quality. This meat quality is highly sought after by consumers, leading to significant market demand for Wenchang chickens. The market demands uniform weight across the entire breed, and to meet this demand, a method is needed to detect variation and use it as a molecular marker in Wenchang chicken breeding.
[0003] ARL13B This gene encodes a member of the ADP-ribosylation factor-like family. The encoded protein is a small GTPase containing N-terminal and C-terminal guanine nucleotide binding motifs. This protein is located in cilia and plays a role in cilia formation and maintenance. ARL13B It was found to be one of the genes under positive selection in the domestic chicken genome and plays an important role in the regulation of cerebral cortex development and skeletal development.
[0004] The present invention obtains a structural variation marker sequence through detection and screening, which is used as a molecular marker for Wenchang chicken breeding. In actual breeding work, it can provide a powerful reference for the directional breeding of body weight. Summary of the Invention
[0005] In order to solve the deficiencies of the prior art, the present invention aims to provide a ARL13B The invention discloses a structural variation marker and a detection method thereof for Wenchang chicken breeding. The invention obtains a molecular marker through detection and screening and is applied to the directional breeding of Wenchang chicken weight.
[0006] In order to achieve the above objectives, the present invention adopts the following technical solutions:
[0007] A structural variation marker based on the ARL13B gene, the sequence of the structural variation molecular marker is SEQ ID No: 01, the structural variation molecular marker is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus galluschicken; the position of the structural variation molecular marker in Genbank: GCA_040436655.1 is CM080655.1: 108497195-108497244, and the structural variation molecular marker is a deletion site.
[0008] The aforementioned structural variation marker based on the ARL13B gene, the sequence of the structural variation molecular marker is located in the ARL13B gene on chromosome chr1, and the flanking sequence of the structural variation breakpoint in the Wenchang chicken genome ASM4043665v1 is: the upstream 50bp is gcgattcaaatagcataattttgtaaaaaatgtatttatattaaacttcc SEQ ID No: 04, and the downstream 50bp is catatatccctaatgagaggtattgctactgtaaaaaaaatgttaagagtc SEQ ID No: 05.
[0009] The aforementioned structural variation marker based on the ARL13B gene and the detection primers for the sequence of the structural variation molecular marker include:
[0010] Forward primer F is 5'- TCAGGCGATTCAAATAGCA 3' SEQ ID No: 02;
[0011] The reverse primer R is 5'-CAGTAGCAATACCTCTCATTAG 3' SEQ ID No: 03.
[0012] Based on the structural variation marker of the ARL13B gene, at the same age, the weight of individuals with missing structural variation marker sequences in the Wenchang chicken genome is higher than that of individuals without missing structural variation marker sequences.
[0013] A structural variation marker based on the ARL13B gene and its application in Wenchang chicken breeding. The sequence of the structural variation molecular marker is SEQ ID No: 01. The structural variation molecular marker is located on the Wenchang chicken gene reference genome ASM4043665v1 (Gallus gallus chicken); the position of the structural variation molecular marker in Genbank: GCA_040436655.1 is CM080655.1: 108497195-108497244, and the structural variation molecular marker is a deletion site. The invention is applied to a Wenchang chicken breeding detection kit.
[0014] The present invention is beneficial in that:
[0015] The present invention obtains a structural variation marker sequence through detection and screening as a molecular marker for use in Wenchang chicken breeding;
[0016] At the same age, the body weight of individuals lacking the structural variation marker sequence was significantly higher than that of individuals without the deletion, which can be used for the directional selection of body weight in Wenchang chickens.
[0017] Professional terminology:
[0018] The flanking sequence refers to a non-translated nucleotide sequence outside the first exon and the last exon of the coding region. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 This is the electrophoresis result of the structural variation marker sequence deletion verification of the present invention;
[0020] Figure 2 This is the result of the association analysis between the three gene types of 0 / 0 (no deletion), 0 / 1 (heterozygous deletion), and 1 / 1 (homozygous deletion) and the trait (weight) of the present invention. DETAILED DESCRIPTION
[0021] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0022] The samples and their sources are shown in Table 1:
[0023] Table 1
[0024]
[0025] A total of 354 individuals, including Wenchang chickens from 3 chicken farms.
[0026] Structural variation (SV) detection process
[0027] 1. SV identification by next-generation sequencing
[0028] Illumina paired-end sequencing data from 354 individuals were obtained. SV detection was performed using the following algorithms: read-pair (RP), split-read (SR), read depth (RD), and assembly (AS). We combined multiple SV detection algorithms to maximize sensitivity using an ensemble of at least two algorithms from six detection software programs: Manta, Delly, Wham, Smoove, Dysgu, and GRIDS2. SVs were merged for each sample using SURVIVOR software with the following parameters: 50 1 1 1 0 50. The merged SVs were then filtered using the following parameters: NA 50 100000 0 -1. Next, the breakpoints of the SVs were refined based on their highest frequency positions.
[0029] 2. Assembly-based SV identification
[0030] In addition to the Wenchang chicken reference genome ASM4043665v1, published genome assemblies of 30 samples from NCBI were used to detect assembly-based structural variation by constructing a pan-genome variation map. This step was performed using Pggb software with the parameters -p 95 -s 10000 -T 20 --poa-params 1,9,16,2,41,1. Next, the vg toolkit was used in deconstruct mode with default parameters to identify SVs on all autosomes and chromosome Z of the Wenchang chicken reference genome ASM4043665v1. The generated vcf file contains SVs from all 31 assembled genomes.
[0031] ARL13B The position of the reference genome ASM4043665v1 (GCA_040436655.1) uploaded in the assembly is CM080655.1:108497195-108497244. The flanking sequences of the structural variation marker sequence are:
[0032] Upstream 50bp: gcgattcaaatagcataattttgtaaaaaatgtatttatattaaacttcc SEQ IDNo: 4,
[0033] Downstream 50bp: cataatccctaatgagaggtattgctactgtaaaaaaaatgttaagagtc SEQ IDNo: 5.
[0034] 3. Pan-genome map construction
[0035] The Wenchang chicken reference genome ASM4043665v1 was used as the backbone of the pan-genome map. Previously identified SVs based on next-generation sequencing and assembly were incorporated into the pan-genome variation map using the construct module of the vg toolkit, without removing any alternative alleles. The resulting pan-genome map was then indexed using the "vg index" tool in both XG and GCSA formats, with the "-L" option enabled for both formats. SVs are depicted as bubbles in the map, with paths representing the corresponding alleles. These paths consist of the start and end nodes of the reference sequence, as well as the paths traversing these nodes.
[0036] 4. Graph-based SV genotyping
[0037] Genotyping was performed on 354 samples sequenced at a high depth (>10×) using the pan-genome map. Clean reads from each sample were aligned to the map genome using vgGiraffe, generating a GAM-formatted result file. Alignments with alignment quality <5 or base quality <5 were excluded. Subsequently, indexing was performed using vg pack with default parameters. SV genotyping results for the 354 samples were generated using vg call on the constructed pan-genome map with the parameters -v --bias-mode --het-bias 2,4.
[0038] 5. SV GWAS
[0039] GWAS were performed on the SV dataset using linear mixed models using GEMMA96 (v1.0.3), adjusting for sex, kinship, and population structure as cofactors. A kinship matrix was calculated using all SNPs in GEMMA, and population structure was determined using the first 10 principal components. A genome-wide significance threshold was determined using a uniform threshold of 0.05 / n, where n represents the effective number of independent SVs and SNPs as calculated using the genetic type I error calculator.
[0040] 6. Structural variation marker sequences
[0041] A structural variation marker sequence was screened and used as a molecular marker for Wenchang chicken breeding, as shown in Table 2. Genotyping results showed three genotypes: 0 / 0 (no deletion), 0 / 1 (heterozygous deletion), and 1 / 1 (homozygous deletion). The results of the trait association analysis showed that Figure 2 At the same age, the weight of individuals with deletions was significantly higher than that of individuals without deletions.
[0042] Table 2
[0043]
[0044] Structural variation marker sequence deletion experimental verification process:
[0045] 1. The structural variation marker sequence is 50 bp long, so primers covering the missing sequence were designed using Primer Premier 6.0 (Primer Premier :: Software for PCR Primer Design | Primer Design Program) software. The target fragment was 134 bp long and specific.
[0046] Forward primer F is 5'-TCAGGCGATTCAAATAGCA 3' SEQ ID No: 02
[0047] Reverse primer R is 5'-CAGTAGCAATACCTCTCATTAG 3' SEQ ID No: 03
[0048] 2. The DNA samples used for verification were obtained from Beijing Compson Agriculture Co., Ltd. The PCR reaction system was configured using Vazyme 2× RapidTaq Master Mix (50 ml) as shown in Table 3:
[0049] Table 3
[0050]
[0051] 3. PCR reaction conditions: 1. Pre-denaturation at 95°C for 3 minutes; 2. Denaturation at 95°C for 15 seconds; 3. Annealing at 55°C for 15 seconds; 4. Extension at 72°C for 30 seconds (repeat steps 2, 3, and 4 for 35 cycles); 5. Extension at 72°C for 5 minutes
[0052] 4. Electrophoresis: ① Prepare a 1.0% agarose gel: Dissolve 0.5g agarose in 50ml 1% TAE and add 5.5μl Sparkred fluorescent nucleic acid stain. ② Use a pipette to pipette 5μl of PCR amplification product into the gel wells. Also add 4.5μl DNA Maker (D2000) as a reference. ③ After 30 minutes of electrophoresis at 120V constant voltage, observe under UV light and photograph.
[0053] 5. Electrophoresis results are as follows Figure 1 As shown,
[0054] The presence of a band at 84 bp indicates that there is a structural variation marker sequence deletion, while the presence of a band at 134 bp indicates that there is no structural variation marker sequence deletion. Heterozygotes have two bands.
[0055] The results of the association analysis between 0 / 0 (no deletion), 0 / 1 (heterozygous deletion), and 1 / 1 (homozygous deletion) and the traits show that Figure 2 At the same age, the weight of individuals with missing lesions is significantly higher than that of individuals without missing lesions (g). Figure 2 As shown:
[0056] From the above experiments, we can see that at the same age, the weight of individuals with missing structural variation marker sequences is significantly higher than that of individuals without deletions.
[0057] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solutions obtained by equivalent replacement or equivalent transformation fall within the scope of protection of the present invention.
Claims
1. Application of a reagent for detecting structural variation markers of Wenchang chicken ARL13B gene in Wenchang chicken body re-directed breeding, characterized in that: The sequence of the structural variation marker is SEQ ID No: 01, and the structural variation marker is on the Wenchang chicken gene reference genome ASM4043665v1. The Genbank accession number of the reference genome is: GCA_040436655.
1. The position of the structural variation marker is bases 108497195-108497244 with Genbank accession number: CM080655.
1. The structural variation marker is an insertion or deletion polymorphism marker. At the same age, the weight of individuals lacking the structural variation marker in the Wenchang chicken genome is higher than that of individuals without the structural variation marker.
2. The use according to claim 1, characterized in that The sequence of the structural variation marker is located in the ARL13B gene on chromosome chr1, and the flanking sequence of the structural variation marker is: 50 bp upstream is gcgattcaaatagcataattttgtaaaaaatgtatttatattaaacttcc, and 50 bp downstream is cataatccctaatgagaggtattgctactgtaaaaaaaatgttaagagtc.
3. The use according to claim 1, characterized in that The reagent for detecting structural variation markers is a primer, and the primer includes: Forward primer F is 5′- TCAGGCGATTCAAATAGCA 3′; The reverse primer R is 5'-CAGTAGCAATACCTCTCATTAG 3'.