Molecular marker closely linked with major QTL (quantitative trait loci) of row number of corncobs and application of molecular marker

Abstract

The invention discloses a molecular marker closely linked with a major QTL (Quantitative Trait Loci) of the row number of corncobs and application of the molecular marker. A molecular marker closely linked with a major QTL locus qPsa1 with significantly increased ear row number in the process of domesticating teosinte into corn is located at the 270911250th site of a first chromosome of a corn V4 genome, and the genotype of the molecular marker is CC, TT or CT. The molecular marker PSA1KASP can be used for selecting excellent allelic variation of qPsa1 in'redomestication 'or'de novo domestication' corn new varieties or strains, so that the workload of breeding and screening can be greatly reduced, the breeding period is shortened, and the breeding process of corn with a large number of rows per ear is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and specifically relates to a molecular marker closely linked to a major QTL locus qPsa1 for domestication of corn-Tea ear row number and its application. Background Art

[0002] In the process of crop evolution from wild ancestors to local varieties and modern cultivated varieties, it has gone through two stages: domestication and selection. Domestication has enabled cultivated crop varieties to have more seeds, larger fruits or grains than wild ancestors, significantly increasing yields and greatly satisfying human needs. As people's demand for food becomes more diversified and personalized, traditional agricultural production methods have also brought many challenges. The goal of future food production should be to supply food based on people's personalized needs. "Re-domestication" of crops in a semi-domesticated state and "de novo domestication" to produce new crops provide new solutions to solve the world's increasingly severe food problems. The mining and analysis of key functional genes for dominant traits (high yield, high nutritional value, efficient nitrogen fixation, high water utilization rate, etc.) are also considered to be a key step in achieving crop "re-domestication" and "de novo domestication". During the domestication and selection process of corn, the changes in 5-6 key genes established the key morphological structure of modern cultivated corn, greatly improving the adaptability and yield of corn. Among them, the domestication of single spikelets of teosinte to paired spikelets of cultivated corn significantly increased the number of rows of corn ears. To date, the genetic and molecular mechanisms of the transition from single spikelets of teosinte to paired spikelets of cultivated maize remain unclear. The number of ear rows is an important component of maize yield and is significantly positively correlated with single ear grain yield. Therefore, it is necessary to explore the genes for the number of ear rows and their favorable alleles from the process of maize domestication.

[0003] Among the molecular markers currently used, SNPs are widely distributed on the genome. Because of their large number and rich polymorphism, they have gradually become an ideal marker type in genetic breeding. SNP markers can obtain genotypes through resequencing, chips and other methods. Among them, competitive allele-specific PCR typing (Kompetitive Allele Specific PCR, KASP) has become an increasingly important method for SNP genotyping due to its advantages such as rapid, accurate and high-throughput typing. However, there is no method for molecular breeding of the number of ear rows during the domestication of corn-Tea. Therefore, it is particularly urgent and important to develop molecular markers for the gene for the number of ear rows and its favorable alleles during the domestication process.

[0004] In the early stage, our team used the introgression line derived from the hybridization of teosinteus and maize inbred lines as materials, and identified a mutant with a significant reduction in the number of ear rows due to the degeneration of stalked spikelets, named Pedicellate spikelet abortion1 (Psa1). Psa1 was located in the approximately 1Mb interval of the first chromosome using chromosome substitution mapping. The sequences in the interval were analyzed, and KASP molecular markers were developed based on sequence differences. The markers were applied to materials derived from the hybridization of teosinteus and maize, which can realize the molecular marker-assisted selection of maize with a large number of ear rows during the "re-domestication" or "de novo domestication" process. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker closely linked to the major QTL site qPsa1 that significantly increases the number of ear rows during the domestication of teosinte into corn. The molecular marker is a SNP marker located at position 270911250 on the first chromosome of the publicly published corn V4 genome, and the genotype is CC, TT or CT.

[0006] Another object of the present invention is to provide an application of a molecular marker tightly linked to the major QTL site q Psa1 of the number of ear rows in the process of domesticating teosinte into corn, by detecting the genotype of the 270911250th base on the first chromosome of the corn B73 genome, marker-assisted selection of materials with high ear rows can be achieved.

[0007] In order to achieve the above object, the present invention adopts the following technical measures:

[0008] The use of a reagent for detecting base 270911250 on chromosome 1 of the corn v4 genome in corn ear row number breeding falls within the protection scope of the present invention.

[0009] The use of a reagent for detecting a corn sequence comprising base number 270911250 on chromosome 1 of the corn v4 genome in corn ear row number breeding also falls within the scope of protection of the present invention.

[0010] The application of primers designed for base 270911250 on chromosome 1 of the corn v4 genome in corn ear row number breeding also falls within the protection scope of the present invention.

[0011] In the above application, the applicant developed a KASP marker PSA1KASP based on the above SNP site, and the primers designed based on the marker are:

[0012] High ear row number allele-specific primer PSA1KASP-F1: AGCTCCCCCTCGATCGTC

[0013] Low ear row allele-specific primer PSA1KASP-F2: AGCTCCCCCTCGATCGTT

[0014] Reverse primer PSA1KASP-R: GATGAAAAGTGCCAAAGAGAT

[0015] The above primers must be developed according to the principles of KASP labeling and must be added with a KASP-labeled universal adapter before use.

[0016] The present invention also provides the use of the above primers in corn breeding. When the 270911250th base on chromosome 1 of the corn v4 genome is a CC genotype, it exhibits a large number of rows, and when it is a TT genotype, it exhibits a small number of ear rows.

[0017] The specific application is in the rapid screening of corn breeding materials with a large number of ear rows.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] (1) For the first time, a molecular marker PSA1KASP was discovered that was significantly associated with the number of rows of maize ears, providing a reliable source of molecular markers for the pre-selection of materials with high rows of ears during the process of "re-domestication" or "de novo domestication".

[0020] (2) The molecular marker PSA1KASP can be used to select excellent alleles of qPsa1 in new maize varieties or lines that have been "re-domesticated" or "de novo domesticated", which can greatly reduce the workload of breeding screening, shorten the breeding cycle, and accelerate the breeding process of maize with a large number of ears and rows. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 .qPsa1 fine mapping results, 1: Teosinte; 2: Zea mays; 3: Heterozygous; N is the number of individual plants;

[0022] Figure 2 . Genotyping results of PSA1KASP in two materials with high and low ear row numbers. Green is the haplotype of teosinte, blue is the haplotype of maize, and gray is the negative control with water as template;

[0023] Figure 3 .The genotyping results of PSA1KASP in the segregating population, green is the teosinte haplotype TT, blue is the maize haplotype CC, red is the heterozygous genotype CT, gray is the negative control with water as the template, and black is undetected or blank. DETAILED DESCRIPTION

[0024] The technical solutions of the present invention, unless otherwise specified, are all conventional techniques in the art; the reagents or materials, unless otherwise specified, are all from commercial channels. In the present invention, unless otherwise specified, the maize genome is referenced to B73v4.

[0025] Embodiment 1:

[0026] Discovery of SNP markers tightly linked to the major QTL locus qPsa1 for the number of maize ear rows and establishment of a method

[0027] A backcross recombinant inbred line BC2-RIL population was constructed by hybridizing teosinte with maize inbred lines, and backcrossing for two generations and selfing for multiple generations with maize as the recurrent parent. A mutant with degeneration of pedicel spikelet, which resulted in a significant reduction in the number of ear rows, was derived from the population and named Pedicellate spikelet abortion1 (Psa1). The material with normal spikelet development (WT) in the population was used as the maternal parent and hybridized with Psa1 to construct an F2 segregating population. The genetic background difference between Psa1 and WT was analyzed using the 56K-SNP maize chip produced by Illumina. After quality control, 40,325 high-quality SNP marker information was screened. The fragments derived from teosinte were mainly distributed on chromosomes 1, 3, 5, 7, 8, and 10. Molecular markers were developed near the polymorphic SNP sites and used for single plant genotype detection of the F2 segregating population, and single-factor analysis of variance was performed with the number of ear rows per plant. After analysis, a major QTL was detected on chromosome 1, corresponding to the physical position of maize reference genome B73 at 266-271Mb. Using more F2 populations and progeny tests of different recombinant types for fine positioning, the candidate interval was narrowed down to 1M interval ( Figure 1 ). This interval contains 11 genes in the B73 V4 version.

[0028] DNA from Psa1 and WT leaves was extracted, primers were designed in the candidate interval according to chip data and reference genome B73 sequence, and the PCR amplification products were sent to Shanghai Biotech for first-generation sequencing. High-quality SNP sites were screened for KASP marker development, and sequencing results showed that Psa1 and WT had C / T variation at position 270911250. And this site was the same as WT among 510 maize inbred lines, 508 (99.61%) materials were the same as WT, all C, and there was no heterozygote. Among 184 teosinte materials, 160 had Psa1 haplotype, and the genotype of this SNP site was CC, TT or CT. The sequences of 100 bp upstream and downstream of the site are as follows: ATCACATTTGAGTCCCAGAGGATTGGGGCGCTTCATTGTACATGGCTTGTGGC TCCTCTCCTTGGTTGAGGATGAATTGACCGAGCTCCCCCTCGATCGTCTCCCGCTTGGTGATCTTGGTCACCTCATCCCCTTCATGTGCGATCTTTAGAACATCCCAAATCTCTTTGGCACTTTTCATCCCTTGCACCTTATTATACT

[0029] According to the design principle of KASP (Kompetitive Allele-Specific PCR) molecular marker primers, KASP molecular marker PSA1KASP was developed. Each marker includes two competitive forward primers F1 and F2, and a reverse universal primer R. The primer sequences are as follows:

[0030] PSA1KASP-F1: AGCTCCCTCTCGATCGTC

[0031] PSA1KASP-F2: AGCTCCCTCTCGATCGTT

[0032] PSA1KASP-R:GATGAAAAGTGCCAAAGAGAT

[0033] The above primers must be developed according to the principles of KASP labeling and must be added with a KASP-labeled universal adapter before use.

[0034] The linker sequence added before F1 is GAAGGTGACCAAGTTCATGCT , the linker sequence added before F2 is GAAGGTCGGAGTCAACGGATT .

[0035] The competitive allele-specific PCR technique was used to perform genotyping in the BC2F7 materials with high ear rows (12 rows) and low ear rows (6 rows) obtained by hybridization of teosinte and maize. The amplification kit used was the five-primer amplification blocked mutation system (PAMS). According to the instructions of the PAMS pro SNP Genotyping PCR mix kit, a 10uL reaction system was designed: 2×PARMS master mix 5μL, Allele X primer (10μM) 0.15μL, Allele Y primer (10μM) 0.15μL, Common R primer (10μM) 0.4μL, maize genomic DNA 10-100ng. The amplification program was: 94℃15min; 94℃20s, 65-57℃ (Touch-down) 1min, 10 cycles; 94℃20s, 57℃1min, 30 cycles; collect the fluorescence signal once and output the genotype result. The genotyping result is shown in the figure. Figure 2 The markers can clearly distinguish different haplotypes and correspond one to one with the number of ear rows.

[0036] Embodiment 2:

[0037] The application of primers designed based on the 270911250th base of maize chromosome 1 in the screening and breeding of maize ear rows is as follows:

[0038] To verify the role of the above molecular markers, primers were used to identify the genotype of the segregating population produced by the hybridization of zea macrophylla and maize inbred line ZZCO1. The population was sown in the experimental field in the spring of 2024. The leaf DNA was extracted by CTAB method at the two-leaf and one-heart stage. The amplification method was the same as described in Example 1. Genotype identification was performed on 384 individual plants. The typing results are shown in Figure 1. Figure 3 As shown in the figure, PSA1KASP clearly divides the test population into three genotypes: teosinte, maize, and heterozygous. In order to better identify the number of ear rows, phenotypic identification was performed when the female ear was not yet mature. Combining genotype and phenotype for significance test, it was found that the CC genotype material had 7.09 more ear rows than the TT genotype material (Table 1), further verifying that the developed KASP marker can quickly and effectively identify materials with more ear rows in the population constructed by hybridization of teosinte and maize, and has application value for quickly screening breeding materials with more ear rows in the "re-domestication" or "de novo domestication" breeding of maize.

[0039] Table 1: Genotypic and phenotypic significance of marker PSA1KASP in maize-Zeus F2 population

[0040]

Claims

1. A molecular marker closely linked to the major QTL locus qPsa1, which significantly increases the number of ear rows during the domestication of teosinte into maize, is located at position 270911250 of the first chromosome of the maize V4 genome, and its genotype is CC, TT or CT.

2. A reagent for detecting base 270911250 on chromosome 1 of the maize v4 genome.

3. The reagent according to claim 1, characterized in that The reagents contain primers, which are: High ear row number allele-specific primer PSA1KASP-F1: AGCTCCCCCTCGATCGTC Low ear row allele-specific primer PSA1KASP-F2: AGCTCCCCCTCGATCGTT Reverse primer PSA1KASP-R: GATGAAAAGTGCCAAAGAGAT.

4. Use of the molecular marker described in claim 1 or the reagent described in claim 2 or 3 in corn ear row number breeding.

5. The use according to claim 4, characterized in that: When the 270911250th base on chromosome 1 of the corn v4 genome is the CC genotype, it shows a large number of rows, and when it is the TT genotype, it shows a small number of ear rows.

Images