Molecular markers of wheat fusarium blight and their application

Abstract

The application discloses a molecular marker of Tilletia foetida and application thereof. The molecular marker of Tilletia foetida in the application comprises at least one gene fragment in OG0008430, OG0008601, OG0008603 and OG0008610. The molecular marker in the application can distinguish and identify Tilletia foetida and its similar species from the genome level, can more comprehensively, accurately and effectively reflect the molecular differences between Tilletia foetida and its similar species, provides a new scheme and way for detection and identification of Tilletia foetida, and has important value and significance for quarantine and prevention of Tilletia foetida.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of Tilletia controversa detection, in particular to a molecular marker of Tilletia controversa and application thereof. BACKGROUND

[0002] Tilletia controversa is a plant pathogen causing dwarfing and increased spore of wheat, which is listed as a quarantine disease in more than 40 countries. Tilletia controversa can be transmitted through seeds, soil, air and other ways, and can survive in soil for many years, which is difficult to eradicate.

[0003] Tilletia controversa is very similar to Tilletia indica, Tilletia foetida and other Tilletia in biological characteristics and molecular biology characteristics, so it is difficult to distinguish by using traditional plant pathogen detection methods.

[0004] Although there are some researches and reports on PCR detection of Tilletia controversa in recent years, it is difficult to effectively distinguish and detect Tilletia controversa and other Tilletia of the same genus due to the similarity of ITS sequences.

[0005] Therefore, it is of great value and significance to develop new molecular markers of Tilletia controversa to better meet the detection and identification requirements of Tilletia controversa. SUMMARY

[0006] The present application aims to provide a new molecular marker of Tilletia controversa and application thereof.

[0007] The present application adopts the following technical solutions:

[0008] The first aspect of the present application discloses a molecular marker of Tilletia controversa, which comprises at least one of the following gene fragments: OG0008430 gene fragment, OG0008601 gene fragment, OG0008603 gene fragment and OG0008610 gene fragment.

[0009] It should be noted that the present application creatively screens new molecular markers of Tilletia controversa from the genome level, which provides a new scheme and way for the detection and identification of Tilletia controversa, and has great value and significance for the quarantine and prevention of Tilletia controversa.

[0010] In one implementation of the present application, the OG0008430 gene fragment is the sequence shown in Seq ID No. 25, the OG0008601 gene fragment is the sequence shown in Seq ID No. 26, the OG0008603 gene fragment is the sequence shown in Seq ID No. 27, and the OG0008610 gene fragment is the sequence shown in Seq ID No. 28.

[0011] The second aspect of the present application discloses a recombinant plasmid containing the molecular marker of the present application.

[0012] It should be noted that the key of the present application lies in developing new molecular markers of T. atra from the genome level: OG0008430, OG0008601, OG0008603, and OG0008610. It can be understood that the four gene fragments can be cloned into a recombinant plasmid according to a conventional method, and then the recombinant plasmid is used as a positive control.

[0013] It should also be noted that the specific primers and probes designed based on the molecular markers of the present application can completely amplify the four genes, or only amplify a certain fragment in the molecular marker gene. At this time, the target fragment amplified can also be cloned into the recombinant plasmid, instead of cloning the complete molecular marker gene into the recombinant plasmid.

[0014] The third aspect of the present application discloses a transfected cell containing the recombinant plasmid of the present application.

[0015] It should be noted that the recombinant plasmid of the present application can be transfected into a host cell, and then a monoclonal cell capable of stable replication in the host cell is obtained through monoclonal screening and identification. The recombinant plasmid of the present application is obtained through culture of the host cell and plasmid extraction.

[0016] The fourth aspect of the present application discloses the application of the molecular marker of the present application, the recombinant plasmid of the present application, or the transfected cell of the present application in detection or identification of T. atra.

[0017] It should be noted that the key of the present application lies in the research finding that at least one gene fragment in OG0008430, OG0008601, OG0008603, and OG0008610 can be used as a molecular marker for detection or identification of T. atra. Therefore, the recombinant plasmid or the cloned cell containing these gene fragments can also be used for detection or identification of T. atra.

[0018] The fifth aspect of the present application discloses a kit for detection or identification of T. atra, which contains reagents for detecting the molecular marker of the present application.

[0019] In an implementation form of the present application, the reagent for detecting the molecular marker of the present application comprises OG0008430 specific detection primer and probe, OG0008601 specific detection primer and probe, OG0008603 specific detection primer and probe, and OG0008610 specific detection primer and probe.

[0020] In an implementation form of the present application, the OG0008430 specific detection primer and probe comprises at least one of OG0008430 first primer probe combination and OG0008430 second primer probe combination; the upstream and downstream primers of the OG0008430 first primer probe combination are respectively the sequences shown in Seq ID No. 1 and Seq ID No. 2, and the probe is the sequence shown in Seq ID No. 3; the upstream and downstream primers of the OG0008430 second primer probe combination are respectively the sequences shown in Seq ID No. 4 and Seq ID No. 5, and the probe is the sequence shown in Seq ID No. 6.

[0021] In an implementation form of the present application, the OG0008601 specific detection primer and probe comprises at least one of OG0008601 first primer probe combination and OG0008601 second primer probe combination; the upstream and downstream primers of the OG0008601 first primer probe combination are respectively the sequences shown in Seq ID No. 7 and Seq ID No. 8, and the probe is the sequence shown in Seq ID No. 9; the upstream and downstream primers of the OG0008601 second primer probe combination are respectively the sequences shown in Seq ID No. 10 and Seq ID No. 11, and the probe is the sequence shown in Seq ID No. 12.

[0022] In an implementation form of the present application, the OG0008603 specific detection primer and probe comprises at least one of OG0008603 first primer probe combination and OG0008603 second primer probe combination; the upstream and downstream primers of the OG0008603 first primer probe combination are respectively the sequences shown in Seq ID No. 13 and Seq ID No. 14, and the probe is the sequence shown in Seq ID No. 15; the upstream and downstream primers of the OG0008603 second primer probe combination are respectively the sequences shown in Seq ID No. 16 and Seq ID No. 17, and the probe is the sequence shown in Seq ID No. 18.

[0023] In an implementation form of the present application, the OG0008610 specific detection primer and probe comprises at least one of the following: OG0008610 first primer probe combination and OG0008610 second primer probe combination; the upstream and downstream primers of the OG0008610 first primer probe combination are respectively the sequences shown in Seq ID No. 19 and Seq ID No. 20, and the probe is the sequence shown in Seq ID No. 21; the upstream and downstream primers of the OG0008610 second primer probe combination are respectively the sequences shown in Seq ID No. 22 and Seq ID No. 23, and the probe is the sequence shown in Seq ID No. 24.

[0024] In an implementation form of the present application, the kit of the present application further comprises the recombinant plasmid of the present application, which is used as a positive control.

[0025] In an implementation form of the present application, the kit of the present application further comprises a real-time fluorescent PCR reaction mixture.

[0026] It can be understood that the key of the kit of the present application is the specific primer and probe for detecting the molecular marker of the present application, and the real-time fluorescent PCR reaction mixture can be combined into the kit of the present application according to the requirement, or can be directly purchased separately, which is not specifically limited herein.

[0027] The sixth aspect of the present application discloses a method for detecting or identifying Tilletia, comprising detecting the molecular marker of the present application by using the kit of the present application, and distinguishing and identifying the Tilletia species to be detected according to the detection result.

[0028] It should be noted that the detection or identification method of the present application can effectively distinguish and identify the Tilletia species by detecting the molecular marker of the present application, especially the four genes OG0008430, OG0008601, OG0008603 and OG0008610, and in an implementation form of the present application, the identification of 37 Tilletia species is realized.

[0029] The present application has the following beneficial effects:

[0030] The molecular marker of the present application can distinguish and identify the Tilletia and its similar species at the genome level, can more comprehensively, accurately and effectively reflect the molecular differences between the Tilletia and its similar species, and provides a new scheme and way for the detection and identification of the Tilletia, which has important value and significance for the quarantine and prevention of the Tilletia. BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1These are homologous genes obtained from preliminary screening in the embodiments of this application;

[0032] Figure 2 These are homologous genes used for primer and probe design after screening in the embodiments of this application. Detailed Implementation

[0033] The present application will be further described in detail below through specific embodiments. The following embodiments are only for further illustration of the present application and should not be construed as limiting the present application.

[0034] Example

[0035] I. Materials and Methods

[0036] 1. Test materials

[0037] A total of 31 Tilletia genomes were used for comparative genomic analysis, including 3 provided by the Shenzhen Customs Animal and Plant Quarantine Technology Center and 28 genomes assembled and annotated from GenBank; among them, there were 7 genome datasets for T. controversa. Details are shown in Table 1.

[0038] Table 1. Tilletia species used for genomic analysis

[0039]

[0040]

[0041] 2. Gene fragment screening analysis

[0042] OrthoFinder (version 2.5.4) was used to cluster protein sequences based on sequence similarity. Based on the clustering results, T. contorversa-specific sequence clusters were initially screened. The corresponding nucleic acid sequences were then identified based on the screened protein sequences. Multiple sequence alignment was performed on the nucleic acid sequences using the multiple sequence alignment tool MUSCLE (v3.8.31). Based on the alignment results, nucleic acid sequences or sequence fragments with 100% identity were selected.

[0043] 3. Sequence fragment verification

[0044] The selected sequence fragments were aligned to known databases. Based on the information recorded in the genome, the CDS region fragments of the nucleic acid sequence were screened and aligned to the NR database via NCBI online alignment blastx. The CDS fragment sequences and their protein sequences were then aligned to the gene sequences obtained from transcriptome data analysis.

[0045] 4. Gene primer and probe design

[0046] The selected nucleic acid sequence was supplemented with 100 bp of bases upstream and downstream in its genome, and Primer-BLAST provided by NCBI was used to attempt primer design for the fragment.

[0047] 5. Gene verification

[0048] 5.1 PCR amplification

[0049] PCR amplification was performed on the samples to verify the discrimination of the target gene. PCR amplification and Sanger sequencing verification were performed on 37 Tilletia species, as shown in Table 2.

[0050] Table 2 Tilletia species materials for primer probe verification

[0051]

[0052]

[0053] 5.2 Sanger sequencing

[0054] The amplification product was sequenced to verify whether the amplification product was the target gene. Software MEGA7 was used for alignment and sorting.

[0055] 5.3 Genome sequencing

[0056] Genome sequencing was performed on TCK-XJ (Tilletia controversa), TFO-XJ (Tilletia laevis), and CBS122087 (Tilletia secalis), and the similarity was compared with the TCK genome.

[0057] 5.4 Fluorescent probe test

[0058] Corresponding fluorescent probes were designed for PCR amplification primers for testing. A multiplex fluorescent experiment scheme was developed. According to the Ct value, combined with the previous ordinary PCR amplification results, it was judged whether the sample was effectively amplified.

[0059] The ordinary PCR reaction system (25 μL) was as follows: sample DNA 1 μL, 10×PCR buffer 2.5 μL, 2.5 mmol / L MgCl2 2.5 μL, 2.5 mmol / L dNTPs 2.5 μL, 10 μmol / L primer 0.5 μL each, 5 U / μL Taq DNA polymerase 0.2 μL, and ddH2O was added to 25 μL.

[0060] General PCR reaction conditions: 94°C for 5 min, then 32 cycles of 94°C for 30 s, 52°C for 30 s, 72°C for 30 s, 72°C for 8 min after the end of the cycle, and 4°C standby.

[0061] II. Results and analysis

[0062] 1. Comparative genomic analysis of Tilletia to screen homologous genes

[0063] A total of 7 genomes of the target species Tilletia controversa were found in the database, and the data number information is as follows (wherein GCA_905071765.1 is the Ref genome of the target species): GCA_001645045, GCA_009428265, GCA_905071705, GCA_905071725, GCA_905071765, GCA_905071775, GCA_905071785. Using OrthoFinder software, a total of 12587 gene clusters were clustered, of which there were 15 gene clusters with gene copies in the target species and no copies in other species of the same genus. The sequence copy number statistics are shown in Table 1. Figure 1 .

[0064] According to the nucleic acid sequence alignment results, remove the gene clusters with large sequence differences, and only keep the gene fragments that are completely identical in at least 5 genomes of the 7 genomes, a total of 9 fragments are screened, see Table 2, mainly based on the Ref genome fragment sequence, containing intron sequence. Figure 2 .

[0065] The CDS fragments in the nucleic acid sequence are selected and aligned online to the NR database, and the results show that in addition to the protein sequence of the species which can have a better alignment result, there are also some species with alignment results. To prevent false positives, sequences with good alignment rates with other species are also removed, and the final retained sequence fragments are used as potential specific fragments, a total of 4, OG0008430, OG0008601, OG0008603, OG0008610. OG0008430 is the sequence shown in Seq ID No. 25, OG0008601 is the sequence shown in Seq ID No. 26, OG0008603 is the sequence shown in Seq ID No. 27, and OG0008610 is the sequence shown in Seq ID No. 28.

[0066] Seq ID No. 25:

[0067] ATGACTGGTGGAACCTTCACGTACTACCTCAAGGACAGCGTCGCCGTCGCTGTTGTCTTGACGGGAGTTCCGCCCCGCGCTCATGACCCTCTGATGACGCTCCAGCCAGACGTCTTCGACCACTGGAGAGTCAAGGTGCGCGACGCCGTCACGGGTCACAACAACGTCAACCAGCGGTTCTACGTCGTCATCGATTCGTCCGTCGTCATGGCACAGGTACAGGGTCAGGACCAGCTTGCCGTGCGCGTCGTTGTCCTCGCCCAGAGCGTCAGGTCGTCGGTGGCTACGTATGACTTCCGCAAGGCTGCGCAGGAGCTCGGGCTCAACTTTGCCGTGGTCGACCAGCGAATCGACGTCGACAATCCCGAGGTCGCTGGGTTGTTCAGGGACCGCATGCCTCGCTAA

[0068] Seq ID No. 26:

[0069]

[0070] Seq ID No. 27:

[0071] ATGAATGACCACCAGATGGCAACAAAGTGAGTTGCTCACGATTGGACCCTGTACAATGTCGTGATCCTCATTGAGCTCTTGCTTCCTCATGTTTCTTGCTTTGCCTCCCCCTACCACCACACCACCTCTTCAAACTCAAGGCAAGGTTGGGACAAAGCTATCGGCAAACCAAGGCCGATGATGGCTGCCATCACCGCCGACACTGTCAAAGACGGCCAAGAATGGTGCACCTTGATCGACGAAGCCTTGTATGCATTCAAGGGCCTGGTCGAGATCCAAGGCGGGACCATCCGAAACCAAGATGCAATGGTCGATCTCTTCCAGGCATACACCGTCTTCAAATCTCAGTTCGTGCTCAACTACGACCAAGCGGACCTTCAAAAGAAGTTCAACATGGCCATCGACGCCATCGAGAACAAGCTTACCAGCCCTGAGCCCGCTTATGCCCAGTATAAGGTCCACTCCAAGATGATGGTCGCCATCAAGAACAAGTTCCCGAACAACTACGAAGGCAAGCAAAAGATTTGGAAGCAGCTGTGCTCGCAGATCCTCGTCGACAAGGCCGCCTACGTCAAATCTGGTCTGAAACGAGATGCCACCAACATGAAGCAGGTCGCCGACGTCAAGCGGGATCTCCCTTAG

[0072] Seq ID No. 28:

[0073] ATGACCCGACACAGCTGCCGTCCCGTTCGGAAGCTCCGCCGATACAGCAAGGCGGTGCTGAACCAGCAACTCTTCGAGATCTGGGTTGAGCCCCCCCCCCTCAAGGATCGGCCTCAAAAACTGACTTTGCCCAAATTCAAGAGTATTTTCAAAGAGCTCCTTAAGCACTACGGTTGCTATGAGAAAGCCGAGGCCCACAAGATCATGAAGGCGGTAAGTGCGTTGTCAACTCCCTCTGTTTGTTATCTACATCTCATCTCATGCCTCGTCGGCCCATCCCTTTATATAGTTCGCTCGGTCTCATTACTACCGAAACACCGAGCCGGCTGACAGCCCTTTCCACACCCTGGAGCAACGCTACATCATGCTCCTCCTCGTCCTCAAGTCTCTGACTGGAGCCTGCACCACCGACGAGGAGCTTTCCGCTGCGGCGGCCAAAACCGGACTTTTCAACGTACAAGTGCGTAATTACATCGCCGCCGCGAAGAAATATGATGTCCAGCTCTTTGTTCGTTAG

[0074] 2. Primer and probe design for candidate genes

[0075] Primer design was performed for the several gene fragments obtained in the final screening and the retained upstream and downstream bases, using default conditions. The primer information and primer sequence information are shown in Table 4.

[0076] Table 4. Primers and probes designed for candidate gene fragments

[0077]

[0078]

[0079] In Table 4, the primers and probes with "8430" in the "No." column are specific primers and probes designed for the "OG0008430" gene fragment, "1F" is the upstream primer, "1R" is the corresponding downstream primer, "1PF" or "1PR" is the corresponding probe, and the rest are similar.

[0080] 3. Differentiation and identification efficiency of designed primers and probes

[0081] PCR amplification and Sanger sequencing verification were performed on 37 Tilletia species, and the results showed that the combination of 4 genes could identify Tilletia species, and the identification results are shown in Table 5. At the same time, a multiplex real-time fluorescence PCR was established, and the reaction system and amplification program are shown in Table 6. In the multiplex qPCR, different fluorescent groups in different spectral ranges were selected using Bioer 9600 fluorescence quantitative PCR instrument (model: FQD-96A). Although the maximum emission wavelengths of many fluorescent groups with similar fluorescence spectra are different, they will still overlap in the nearby waveband. Therefore, it is necessary to exclude the combination of fluorescent groups that may interfere with each other in the emission spectrum. Some samples were selected to test the remaining probe combinations, and finally a combination method was obtained, which could amplify multiple pairs of primers and probes at the same time, and the amplification results were consistent with the ordinary PCR results. After many attempts, a three + one real-time fluorescence PCR method can effectively distinguish target species from other species, and there are two combination methods, one is three (OG0008601, OG0008603, OG0008610) + one (OG0008430), and the other is three (OG0008430, OG0008603, OG0008610) + one (OG0008601). The combination methods and identification results are shown in Tables 7, 8, 9 and 10. Table 7 is the result of three real-time fluorescence PCR composed of primer-8601-2F, primer-8601-2R and primer-8601-2PF, primer-8603-1F, primer-8603-1R and primer-8603-1PF, and primer-8610-1F, primer-8610-1R and primer-8610-1PR, Table 8 is the result of one real-time fluorescence PCR composed of primer-8430-2F, primer-8430-2R and primer-8430-2PR. Table 7 and Table 8 are combination one, that is, three (OG0008601, OG0008603, OG0008610) + one (OG0008430). Table 9 is the result of three real-time fluorescence PCR composed of primer-8430-1F, primer-8430-1R and primer-8430-1PF, primer-8603-1F, primer-8603-1R and primer-8603-1PF, and primer-8610-2F, primer-8610-2R and primer-8610-2PR, and Table 10 is the result of one real-time fluorescence PCR composed of primer-8601-1F, primer-8601-1R and primer-8601-1PF.Table 9 and Table 10 are combinations two, i.e. triple (OG0008430, OG0008603, OG0008610) + single (OG0008601).

[0082] The experimental results show that the triple qPCR combinations of probes primer-8601-2PF, primer-8603-1PF and primer-8610-1PR and the triple qPCR combinations of primer-8430-1PF, primer-8603-1PF and primer-8610-2PR can effectively amplify, and the amplification results are consistent with the ordinary PCR amplification results, which meet the identification of most Tilletia species. For the Tilletia species that cannot be effectively distinguished by the two kinds of multiplex qPCR, single PCR is carried out for the probe primer-8430-2PR and primer-8601-1PF alone. The two groups of triple qPCR + single qPCR combinations for 8 probes can effectively distinguish all Tilletia species.

[0083] Table 5 Screening of primer and probe for identification efficiency of Tilletia species

[0084]

[0085]

[0086] In Table 5, the sample number is consistent with Table 1 and Table 2, "8430 first group" represents "OG0008430 first primer and probe combination", "8430 second group" represents "OG0008430 second primer and probe combination", and the rest are similar.

[0087] Table 6 qPCR reaction system

[0088] Reagent name 20 μL reaction volume (μL) 2 x qPCR Mix 10 F primer (10 pmol / μL) 0.4 R primer (10 pmol / μL) 0.4 DNA template 4 Fluorescent probe 0.2 ddH2O 5

[0089] The fluorescence PCR reaction conditions are as follows: 95℃ for 30 sec, then 40 cycles of 95℃ for 10 sec, 58℃ for 20 sec, 72℃ for 30 sec, after the end of the cycle, 95℃ for 15 sec, 60℃ for 1 min, 72℃ for 15 sec. When 40 cycles are performed, collect fluorescence at 58℃; after the end of the cycle, perform melting curve analysis, step temperature 0.5℃, step constant temperature time 20 sec.

[0090] Table 7 Triple qPCR result table of combination one

[0091]

[0092]

[0093] Table 8 Combination one of one qPCR results table

[0094] Sample number Ct value of fluorescent 8430-2 8430-2 normal PCR CBS 37 1.36 － － CBS 12 1951 － － ATCC 42080 33.53 √ CBS 160.85 － － ATCC 90926 33 √ CBS 36 9.36 － － TCK-XJ 34.69 √ CK － －

[0095] Table 9 Combination two of three qPCR results table

[0096]

[0097] Table 10 Combination two of one qPCR results table

[0098]

[0099]

[0100] In Tables 7 to 10, the sample number is consistent with Tables 1 and 2, TCK-XJ is the positive control, and CK is the negative control. When the negative control has no Ct value, the sample has Ct value, which is determined as effective amplification; when the negative control has Ct value, the sample Ct value < negative 0.5 or more is determined as effective amplification.

[0101] III. Discussion and conclusion

[0102] The molecular detection of Tilletia indica has always been a difficult point. Hai D.T. Nguyen et al. (2019) analyzed the genomes of 10 Tilletia species including TCK, designed specific primer probes for different species, but did not discuss the identification efficiency of single spore when there was no wheat or gall. Somayyeh et al. (2021) compared 21 genomes of 6 species of the genus to identify specific and conserved DNA regions in all TCK isolates, and developed a LAMP detection method, but produced false positive signals for Tilletia trabutii with a specificity of 97.7%. Based on the experience of previous studies on screening specific marker genes in TCK at the genome level, homologous gene evolution analysis showed that 4 genes OG0008430, OG0008601, OG0008603, OG0008610, etc. can effectively distinguish TCK and other similar species, and 8 pairs of primers and probes were designed and two sets of three + one real-time fluorescence PCR detection methods were established, namely combination one and combination two. The detection method in this example is time-saving, high-sensitivity, and can accurately and quickly distinguish Tilletia species, which can be directly applied to the quarantine of imported wheat.

[0103] The above description is further detailed in combination with specific embodiments of the present application, and cannot be deemed to limit the specific embodiments of the present application to these descriptions. For those skilled in the art of the present application, several simple deductions or replacements can be made without departing from the concept of the present application.

Claims

1. A molecular marker for Gaeumannomyces graminis, characterized in that: the OG0008430 gene fragment is a sequence as represented in Seq ID No. 25, the OG0008601 gene fragment is a sequence as represented in Seq ID No. 26, the OG0008603 gene fragment is a sequence as represented in Seq ID No. 27, and the OG0008610 gene fragment is a sequence as represented in Seq ID No.

28.

2. Use of the molecular marker in claim 1 in detection or identification of T. turcicum. The molecular marker clone is in a recombinant plasmid as a positive control.

3. Use according to claim 2, characterized in that: The recombinant plasmid is transfected into a host cell, and the recombinant plasmid is obtained by culture of the host cell and plasmid extraction.

4. Use according to claim 3, characterized in that: The reagent for detecting the molecular marker in claim 1 comprises OG0008430 specific detection primers and probes, OG0008601 specific detection primers and probes, OG0008603 specific detection primers and probes, and OG0008610 specific detection primers and probes.

5. A kit for detection or identification of Gaeumannomyces graminis, characterized by: The OG0008430 specific detection primers and probes comprise at least one of OG0008430 first primer probe combination and OG0008430 second primer probe combination. The upstream and downstream primers of the OG0008430 first primer probe combination are sequences as represented in Seq ID No. 1 and Seq ID No. 2 respectively, and the probe is a sequence as represented in Seq ID No.

3.

6. The kit of claim 5, wherein: The upstream and downstream primers of the OG0008430 second primer probe combination are sequences as represented in Seq ID No. 4 and Seq ID No. 5 respectively, and the probe is a sequence as represented in Seq ID No.

6. The OG0008601 specific detection primers and probes comprise at least one of OG0008601 first primer probe combination and OG0008601 second primer probe combination. The upstream and downstream primers of the OG0008601 first primer probe combination are sequences as represented in Seq ID No. 7 and Seq ID No. 8 respectively, and the probe is a sequence as represented in Seq ID No.

9.

7. The kit of claim 5, wherein: The upstream and downstream primers of the OG0008601 second primer probe combination are sequences as represented in Seq ID No. 10 and Seq ID No. 11 respectively, and the probe is a sequence as represented in Seq ID No.

12. The OG0008603 specific detection primers and probes comprise at least one of OG0008603 first primer probe combination and OG0008603 second primer probe combination. The upstream and downstream primers of the OG0008603 first primer probe combination are sequences as represented in Seq ID No. 13 and Seq ID No. 14 respectively, and the probe is a sequence as represented in Seq ID No.

15.

8. The kit of claim 5, wherein: ​ ​ The upstream and downstream primers of the OG0008603 second primer probe combination are respectively the sequences shown in Seq ID No. 16 and Seq ID No. 17, and the probe is the sequence shown in Seq ID No.

18.

9. The kit of claim 5, wherein: The OG0008610 specific detection primer and probe comprise at least one of OG0008610 first primer probe combination and OG0008610 second primer probe combination; The upstream and downstream primers of the OG0008610 first primer probe combination are respectively the sequences shown in Seq ID No. 19 and Seq ID No. 20, and the probe is the sequence shown in Seq ID No.

21. The upstream and downstream primers of the OG0008610 second primer probe combination are respectively the sequences shown in Seq ID No. 22 and Seq ID No. 23, and the probe is the sequence shown in Seq ID No.

24.

10. The kit according to any one of claims 5 to 9, characterized in that: Also containing a recombinant plasmid, wherein the recombinant plasmid contains the molecular marker of claim 1.

11. The kit of claim 10, wherein: Also containing a real-time fluorescent PCR reaction mixture.

12. A method for detection or identification of Gaeumannomyces graminis comprising: The method comprises detecting the molecular marker of claim 1 by using the kit of any one of claims 5-11, and identifying the species of the sample according to the detection result. Tilletia The method comprises detecting the molecular marker of claim 1 by using the kit of any one of claims 5-11, and identifying the species of the sample according to the detection result.

Images