Loop-mediated amplification primer group, kit and detection method for detecting influenza A virus, influenza B virus and respiratory syncytial virus

Abstract

The invention provides a loop-mediated amplification primer group, a kit and a detection method for detecting influenza A virus, influenza B virus and respiratory syncytial virus, and relates to the technical field of biotechnology. Specific loop-mediated amplification primers are respectively designed aiming at M1 protein genes of influenza A viruses, NEP genes of influenza B viruses, F gene conserved segments of respiratory syncytial viruses and human RnaseP genes, and each set of primers comprises two outer primers (OF / OB), two inner primers (FIP / BIP) and at least one loop primer (LF / LB). Compared with a traditional detection method, the detection time is greatly shortened, a basis can be provided for clinical diagnosis more quickly, treatment measures can be taken in time, complex nucleic acid extraction and purification steps are not needed, the swab sample can be detected after being simply treated, the operation difficulty and the requirement for professional skills of operators are reduced, and the detection efficiency is improved. And popularization and application in all levels of medical institutions are facilitated.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology technology, and more specifically, particularly relates to a loop-mediated amplification primer set, a kit and a detection method for detecting influenza A virus, influenza B virus and respiratory syncytial virus. Background Art

[0002] Respiratory tract infection is a common and serious disease. Influenza A virus, influenza B virus and respiratory syncytial virus are important pathogens that cause respiratory tract infection. These viruses spread rapidly and can easily cause large-scale epidemics, posing a huge threat to public health and personal health.

[0003] Traditional detection methods, such as virus culture and serological testing, have problems such as complex operation, long detection cycle, and low sensitivity, and often cannot provide accurate basis for clinical diagnosis in a timely manner. Although the detection technology based on polymerase chain reaction (PCR) has high specificity and sensitivity, it requires complex nucleic acid extraction steps, has high requirements for experimental equipment and operators, and takes a long time to detect, which is difficult to meet the needs of rapid diagnosis. Some existing rapid detection kits have deficiencies in accuracy, specificity or detection range, and cannot effectively detect influenza A virus, influenza B virus and respiratory syncytial virus at the same time;

[0004] As a new type of nucleic acid amplification technology, loop-mediated isothermal amplification (LAMP) has the advantages of simple operation, rapidity, strong specificity, high sensitivity, etc. In recent years, LAMP technology has gradually attracted attention in the field of pathogen detection, providing new ideas and methods for the detection of respiratory viruses. In order to overcome the shortcomings of existing detection technologies, the present invention has developed a loop-mediated amplification primer set, a kit and a detection method for the detection of influenza A virus, influenza B virus and respiratory syncytial virus based on LAMP technology. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a loop-mediated amplification primer set, a kit and a detection method for detecting influenza A virus, influenza B virus and respiratory syncytial virus to solve the above problems.

[0006] A loop-mediated amplification primer set for the detection of influenza A virus, influenza B virus, and respiratory syncytial virus, wherein specific loop-mediated amplification primers are designed for the influenza A virus M1 protein gene, the influenza B virus NEP gene, the conserved segment of the F gene of the respiratory syncytial virus, and the human RNaseP gene, respectively. Each set of primers includes two outer primers (OF / OB), two inner primers (F IP / B IP) and at least one loop primer (LF / LB), and the specific primer sequences are as follows:

[0007] Influenza A virus M1 gene:

[0008] Outer primer-OF: ATGAGYCTTCTAACMGAGGTC;

[0009] Outer primer-OB: CCRTTDAGGGCATTYTGRACA;

[0010] Internal primer-F IP: TTTGAGGGGGCCTGAYGGGAAACGTAYGTTCTCTCTATCRT;

[0011] Internal primer-B IP: ACAAGACCAATYCTGTCACCTCTGAAKCGTCTACGCTGCAGT;

[0012] Loop primer-LB: GGRTTYGTRTTCACGCTCACCG;

[0013] Influenza B virus NEP gene:

[0014] Outer primer-OF: ACAATAARAAGGGATATGCGTAA;

[0015] Outer primer-OB: CCATCTTCTTCATCCTCCA;

[0016] Inner Primer-F IP: GGACTTGTATCCATTGGGGTGTTATTGTCCTTGAGAGTGTTGG;

[0017] Internal primer-B IP: CTRCATAGATTGAATGCATATGACCTGTAAGATCATCAGTRGCA;

[0018] Loop primer-LB: AGAGTGGAAGRCTTGTTGCTAAAC;

[0019] RSV F gene:

[0020] Outer primer-OF:ACAGCAAGAYTAGATAGRATTGAT;

[0021] Outer primer-OB: GTTGGATTGAGAGACACTTCATCTG;

[0022] Inner primer-F IP: ACCAACCATRGCATCTCTTATWCCAAGTGAAATAYTAGGAATGCTYC; Inner primer-BIP: AGARCWGAAGCATTAATGACCAATGTGTCTTTGCCATYTTTTCRC; Loop primer-LF: GTCCTGCACTYGCWACTACTAATGT;

[0023] Loop primer-LB: GCYATGGCAAGACTYAGGAATGA;

[0024] Internal standard RNaseP:

[0025] Outer primer-OF: CTTCAGCATGGCGGTGTT;

[0026] Outer primer-OB: TCAGACCAACACCTCGGC;

[0027] Internal primer-F IP: GCTGTCTCCACAAGTCCGCGGCAGATTTGGACCTGCGAG;

[0028] Inner Primer-B IP: CCTGGCCAACCTCATGCCACGACCTGACCGAGACCCATC;

[0029] Loop primer-LF: AGAGCCTTCAGGTCAGAACCC;

[0030] Loop Primer-LB: CAGACCATCGGGCCACACTC.

[0031] A kit for detecting influenza A virus, influenza B virus, and respiratory syncytial virus, comprising a sample release agent, a freeze-dried ball, a chip, a negative control, and a positive control;

[0032] The components of the nucleic acid releaser mainly include: 10-20mM TrisCl, 10-50mM KCl, 0.25-2.5mM EDTA, 0.001-0.1% SDS (w / v), 0.05-0.5% TritonX-100 (v / v), 0.05-0.5% Tween-20 (v / v), 0.05-0.5% NP-40 (v / v), and 0.01%-0.1% Proc lin-300;

[0033] The freeze-dried ball mainly includes: 0.1-0.4U / μl commercial Bst polymerase, 1-4U / μl commercial reverse transcriptase, 0.01-0.02U / μl commercial UDG enzyme and matching commercial reaction buffer, 6-8mM MgSO4, 4-6mM dNTPs, 1× EveGreen fluorescent dye, and 1× freeze-dried protective agent;

[0034] The four reaction wells in the chip are respectively embedded with influenza A virus, influenza B virus, respiratory syncytial virus and an internal standard RNaseP loop-mediated primer set in an air-dried form;

[0035] The negative control substance is physiological saline, and the positive control substance is physiological saline containing influenza A virus, influenza B virus, and respiratory syncytial virus pseudovirus particles. The negative control and the positive control are embedded in a preservation tube in an air-dried form.

[0036] Preferably, the sample releasing agent is a reagent for rapidly lysing cells / viruses and releasing nucleic acids.

[0037] A detection method for influenza A virus, influenza B virus, and respiratory syncytial virus detection, comprising the following steps:

[0038] S1: Use a sterile swab to swab a throat or nose swab, immerse the swab head in the sample release agent, and turn it upside down several times. The processing method of the negative control and positive control is as follows: take 150μl of sample release agent and add it to the storage tube containing the negative control and positive control, and turn it upside down to fully dissolve;

[0039] S2: Directly pipette 125 μl of the sample in step S1 into the freeze-dried pellet, and pipette to fully dissolve the freeze-dried pellet;

[0040] S3: Take 110 μl of the sample processed in step S2, add it to the chip, and insert the chip into the nucleic acid amplification analyzer for detection;

[0041] S4: After the test is completed, the nucleic acid amplification analyzer automatically issues and prints the test results and report.

[0042] Preferably, the components of the sample releaser mainly include: 10-20mM TrisCl, 10-50mM KCl, 0.25-2.5mM EDTA, 0.001-0.1% SDS (w / v), 0.05-0.5% TritonX-100 (v / v), 0.05-0.5% Tween-20 (v / v), 0.05-0.5% NP-40 (v / v), and 0.01%-0.1% Procline-300.

[0043] Preferably, the freeze-dried ball mainly includes: 0.1-0.4U / μl commercial Bst polymerase, 1-4U / μl commercial reverse transcriptase, 0.01-0.02U / μl commercial UDG enzyme and matching commercial reaction buffer, 6-8mM MgSO4, 4-6mM dNTPs, 1× EveGreen fluorescent dye, and 1× lyophilization protectant.

[0044] Compared with the prior art, the present invention has the following beneficial effects:

[0045] 1. The detection method of the present invention can complete the detection in about 30 minutes, which greatly shortens the detection time compared with the traditional detection method, can provide a basis for clinical diagnosis more quickly, and help to take treatment measures in time.

[0046] 2. There is no need for complicated nucleic acid extraction and purification steps. The swab sample can be tested after simple processing, which reduces the difficulty of operation and the requirements for the professional skills of the operator, making it easier to promote and apply it in medical institutions at all levels.

[0047] 3. It can detect extremely low concentrations of viral nucleic acid and still has good detection capabilities for samples with early infection or low viral load, reducing the possibility of missed diagnosis.

[0048] 4. Primers designed for the specific genes of influenza A virus, influenza B virus, and respiratory syncytial virus can accurately distinguish the target virus from other similar viruses and reduce the misdiagnosis rate.

[0049] 5. Each component in the test kit is freeze-dried or air-dried and can be stored for a long time at room temperature, which reduces storage and transportation costs and increases the convenience of using the test kit in different environments.

[0050] 6. Three common respiratory viruses can be screened simultaneously through one test, which improves the detection efficiency and saves the detection cost and time.

[0051] 7. After a large number of experimental verifications, the detection method of the present invention has a higher compliance rate than the traditional method and can provide accurate detection results for clinical diagnosis.

[0052] 8. It simplifies the operation process and reduces the dependence on expensive instruments and complex reagents, thereby reducing the overall testing cost and facilitating popularization and promotion.

[0053] 9. In terms of the collection and transportation of clinical samples, the design of this kit fully considers the convenience of actual operation and the stability of samples. The collection process of throat swab or nasal swab samples is simple and non-invasive, and patients have high acceptance. At the same time, due to the presence of sample releasers, the samples can maintain stability for a long time at room temperature after collection, reducing dependence on cold chain transportation and reducing the cost and difficulty of sample transportation. This is especially important for sample collection and delivery in remote areas or primary medical institutions, which can ensure that the samples do not degrade or deteriorate during transportation, and ensure the accuracy of the test results. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 It is a schematic diagram of the overall structure of the present invention. DETAILED DESCRIPTION

[0055] The following embodiments of the present invention are described in further detail in conjunction with the accompanying drawings and examples. The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0056] Respiratory tract infection is one of the common diseases worldwide, among which influenza A virus, influenza B virus and respiratory syncytial virus are important pathogens causing respiratory tract infection. Accurate and rapid detection of these viruses is of great significance for the diagnosis, treatment and prevention of diseases. The present invention provides a detection primer set, a kit and a detection method based on loop-mediated isothermal amplification technology (LAMP), aiming to achieve efficient and sensitive detection of the above three viruses.

[0057] 1. Experimental materials:

[0058] Virus strains: Standard strains and clinical isolates of different subtypes of influenza A virus (including H1N1, H3N2, H5N1, H7N9), influenza B virus (Victoria and Yamagata lineages), and respiratory syncytial virus (type A and type B) were collected;

[0059] Reagents and instruments: the kit described in the present invention (including sample release agent, freeze-dried balls, chips, negative control, positive control); nucleic acid extraction kit (control kit); fluorescent quantitative PCR instrument; constant temperature amplification instrument; centrifuge; pipette, etc.

[0060] 2. Primer design and synthesis:

[0061] Based on the sequences of influenza A virus M1 protein gene, influenza B virus NEP gene, respiratory syncytial virus F gene conserved segment and human RNaseP gene, specific LAMP primers were designed using PrimerExplorer V5 software. The primers were synthesized by a professional biological company, purified by PAGE, and dissolved in nuclease-free water to 10 μM for later use.

[0062] 3. Preparation of the kit:

[0063] Preparation of sample release agent: According to the formula, accurately weigh TrisCl, KCl, EDTA, SDS, TritonX-100, Tween-20, NP-40 and Procline-300, dissolve in deionized water, adjust the pH to 7.5-8.0, and dilute to an appropriate volume;

[0064] Preparation of freeze-dried pellets: commercial Bst polymerase, reverse transcriptase, UDG enzyme, and matching reaction buffer, MgSO4, dNTPs, EveGreen fluorescent dye, and freeze-dried protective agent are mixed in a certain proportion, divided into sterile centrifuge tubes, and freeze-dried in a freeze dryer to obtain freeze-dried pellets;

[0065] Preparation of the chip: Add air-dried influenza A virus, influenza B virus, respiratory syncytial virus and internal standard RNaseP loop-mediated amplification primer set to the four reaction wells of the chip respectively;

[0066] Preparation of negative control and positive control: The negative control is normal saline; the positive control is normal saline containing certain concentrations of influenza A virus, influenza B virus, and respiratory syncytial virus pseudovirus particles. The negative control and positive control are air-dried and embedded in storage tubes respectively.

[0067] 4. Viral nucleic acid extraction:

[0068] Use a conventional nucleic acid extraction kit and follow the instructions to extract viral RNA from the virus strain.

[0069] 5. LAMP amplification reaction:

[0070] Sample processing: Use a sterile swab to swab a throat swab or nasal swab sample, immerse the swab head in the sample release agent, and turn it upside down several times to fully lyse the sample. For negative and positive controls, take 150 μl of sample release agent and add it to the storage tubes containing negative and positive controls, respectively, and turn it upside down several times to fully dissolve;

[0071] Preparation of amplification system: directly pipette 125 μl of the treated sample into the freeze-dried ball, pipette and beat several times to fully dissolve the freeze-dried ball;

[0072] Amplification reaction: Take 110 μl of the above-treated sample, add it to the chip, and insert the chip into a constant temperature amplification instrument for amplification reaction. The reaction conditions are: constant temperature reaction at 63-65°C for 30-45 minutes.

[0073] During the amplification reaction, the reaction progress is monitored in real time by the change of the fluorescent signal, and the same sample is detected by the fluorescent quantitative PCR method. The detection results of the two methods are compared, and other viruses similar to or related to influenza A virus, influenza B virus, and respiratory syncytial virus, such as coronavirus, adenovirus, rhinovirus, etc., are selected and detected using the kit of the present invention to verify the specificity of the kit. Influenza A virus, influenza B virus, and respiratory syncytial virus RNA with known concentrations are gradiently diluted and detected using the kit of the present invention and the fluorescent quantitative PCR kit respectively. The minimum virus concentrations that can be detected by the two methods are compared to evaluate the sensitivity of the kit of the present invention. Virus samples with high, medium, and low concentrations are selected, and multiple replicates are set for each concentration. The kit of the present invention is used for detection, and the intra-batch and inter-batch coefficients of variation are calculated to evaluate the repeatability of the kit. After the kit is stored at different temperatures (4° C., 25° C., and 37° C.) for a certain period of time (1 week, 2 weeks, 1 month, and 3 months), its performance is detected to see if it changes, and the stability of the kit is evaluated.

[0074] The experimental results show that no positive results were found in the detection of other viruses such as coronavirus, adenovirus, rhinovirus, etc., indicating that the kit of the present invention has good specificity and can accurately distinguish influenza A virus, influenza B virus, respiratory syncytial virus and other related viruses. The kit of the present invention can detect the lowest concentration of influenza A virus RNA of 10 copies / ml, the lowest concentration of influenza B virus RNA of 5 copies / ml, and the lowest concentration of respiratory syncytial virus RNA of 8 copies / ml. The fluorescent quantitative PCR kit can detect the lowest concentration of influenza A virus RNA of 100 copies / ml, the lowest concentration of influenza B virus RNA of 50 copies / ml, and the lowest concentration of respiratory syncytial virus RNA of 80 copies / ml. It shows that the kit of the present invention has higher sensitivity, the intra-batch coefficient of variation is less than 5%, and the inter-batch coefficient of variation is less than 10%, indicating that the kit of the present invention has good repeatability. After the kit is stored at 4°C for 3 months, at 25°C for 1 month, and at 37°C for 2 weeks, the performance does not change significantly, indicating that the kit has good stability. Throat swab or nasal swab samples collected from 200 clinically suspected respiratory tract infection patients were tested, and the test results of the kit of the present invention were consistent with the fluorescent quantitative PCR method by 98%, of which the positive consistency rate was 97% and the negative consistency rate was 99%.

[0075] The present invention is directed to the LAMP primers designed for the conservative segment of the M1 protein gene of influenza A virus, the NEP gene of influenza B virus, and the F gene of respiratory syncytial virus, and has high specificity and sensitivity. Through the careful screening and optimization of the primer sequence, the accuracy and reliability of the detection are effectively improved, and the sample release agent can quickly lyse cells and viruses, release nucleic acids, and effectively remove impurities and inhibitors in the sample, providing good conditions for subsequent amplification reactions. The optimization of its formula ensures the efficiency and stability of sample processing. The freeze-dried ball contains key reagents such as Bst polymerase, reverse transcriptase, and UDG enzyme, and the activity and stability of the enzyme are maintained by freeze-drying technology. When in use, the amplification reaction can be quickly started by adding the sample, which simplifies the operation process and improves the detection efficiency. The specific primer group is pre-embedded on the chip, which not only reduces the operation error, but also improves the repeatability and consistency of the detection. At the same time, the design of multiple reaction holes can detect multiple viruses at the same time, realizing high-throughput detection. Compared with the traditional fluorescent quantitative PCR method, the detection method of the present invention has the advantages of simple operation, short detection time, and low equipment requirements. It has greater application potential, especially in primary medical institutions and on-site rapid testing.

[0076] The positive predictive value (PPV), negative predictive value (NPV) and total coincidence rate of the detection method of the present invention and the traditional fluorescent PCR detection method were calculated respectively, and the results are as follows:

[0077]

[0078] Comparison of the lowest virus concentrations that can be detected by the two methods:

[0079]

[0080] Count the false positive and false negative results of the two methods:

[0081]

[0082] It can be seen from the above experimental data that the loop-mediated amplification primer set, kit and detection method of the present invention are excellent in accuracy, sensitivity and specificity. Compared with the traditional fluorescent PCR detection method, the detection method of the present invention has higher sensitivity and can detect lower concentrations of viruses; better specificity, lower false positive and false negative rates; higher accuracy, and a total compliance rate of 97%.

[0083] The loop-mediated amplification primer set, kit and detection method of the present invention can quickly, accurately and specifically detect influenza A virus, influenza B virus and respiratory syncytial virus. A series of experimental verifications show that the kit has high sensitivity, high specificity, good repeatability and stability, and is suitable for the detection and large-scale screening of clinical samples. It has important application value in the diagnosis and prevention and control of respiratory infections.

[0084] In addition, the detection method of the present invention also has the following significant advantages and characteristics in practical applications:

[0085] In terms of the collection and transportation of clinical samples, the design of this kit fully considers the convenience of actual operation and the stability of samples. The collection process of throat swab or nasal swab samples is simple and non-invasive, and patients have high acceptance. At the same time, the presence of sample releasers enables the samples to maintain stability at room temperature for a long time after collection, reducing dependence on cold chain transportation and reducing the cost and difficulty of sample transportation. This is especially important for sample collection and delivery in remote areas or primary medical institutions, which can ensure that the samples do not degrade or deteriorate during transportation, and ensure the accuracy of the test results.

[0086] In terms of interpretation and reporting of test results, this kit is equipped with intuitive and easy-to-understand test result interpretation standards and report templates. By analyzing the fluorescent signal, the operator can quickly determine the positive, negative or weak positive results of the sample, and give a clear diagnostic conclusion based on the preset threshold. The test report not only contains the test results of the sample, but also provides detailed test parameters, quality control information, etc., providing clinicians with a comprehensive and accurate basis for diagnosis. At the same time, the test results can be seamlessly connected with the hospital's information system to achieve rapid data transmission and sharing, and improve the efficiency and accuracy of medical work.

[0087] In terms of integration with clinical treatment, this detection method can provide timely and accurate guidance for the selection and adjustment of clinical treatment plans. For example, in the early stages of a patient's infection, quickly identifying the virus type can help doctors select targeted antiviral drugs and avoid unnecessary drug use and abuse. During the treatment process, by regularly monitoring changes in viral load, the treatment effect can be evaluated, the treatment plan can be adjusted in a timely manner, and the success rate of treatment can be improved. In addition, for patients with co-infection or secondary infection, this detection method can detect multiple viruses at the same time, providing strong support for a comprehensive understanding of the patient's condition and the formulation of a comprehensive treatment strategy.

[0088] From the perspective of public health monitoring, the detection method of the present invention has important application value. During the flu season or the peak period of respiratory diseases, the population can be screened quickly and on a large scale to promptly detect the outbreak and epidemic trend of the epidemic. By analyzing the monitoring data of different regions and different populations, the transmission pattern and mutation of the virus can be understood, providing a scientific basis for public health departments to formulate prevention and control strategies and allocate medical resources. At the same time, this detection method can also be used for monitoring key places such as entry ports, schools, and kindergartens to effectively control the spread and spread of the epidemic.

[0089] In terms of cost-effectiveness, the kit of the present invention has obvious advantages. Compared with traditional detection methods, the raw material cost of the kit is relatively low, and the production process is relatively simple, which is conducive to reducing the detection cost. At the same time, since the detection process is simple and fast to operate, it reduces the dependence on professional technicians and high-end equipment, and reduces labor costs and equipment maintenance costs. In large-scale detection and screening, the overall detection cost can be significantly reduced and the utilization efficiency of medical resources can be improved. This is of great significance for popularizing the detection of respiratory viruses and improving the level of disease prevention and control.

[0090] In terms of future development and application expansion, the present invention has broad prospects. With the continuous advancement of molecular biology technology and the increasing demand for detection, the primer design and kit composition can be further optimized to improve the performance and scope of application of the detection. For example, the detection capability of newly emerging virus variants can be increased, and the detection function of other respiratory pathogens (such as Mycoplasma pneumoniae, Chlamydia, etc.) can be expanded to achieve one machine with multiple tests, and improve the comprehensiveness and efficiency of the test. At the same time, mobile detection equipment and Internet technology can be combined to achieve on-site instant detection and remote diagnosis, providing strong support for emergency response and telemedicine for public health emergencies.

[0091] In terms of international cooperation and communication, the detection method of the present invention is expected to be widely used and promoted worldwide. Through cooperation and communication with international scientific research institutions, medical institutions and enterprises, clinical trials and verification can be jointly carried out to optimize detection technology and products. At the same time, sharing of detection data and experience can promote the improvement of global respiratory disease prevention and control and diagnosis level, and make greater contributions to human health.

[0092] In summary, the loop-mediated amplification primer set, kit and detection method for influenza A virus, influenza B virus and respiratory syncytial virus detection of the present invention have many advantages such as simple operation, rapid and efficient, accurate and reliable, cost-effective, and wide application. It has important application value and broad development prospects in the fields of clinical diagnosis, disease prevention and control, and public health monitoring. It is believed that with the continuous improvement and promotion of technology, it will bring greater convenience and benefits to the prevention and treatment of respiratory infections and play an important role in protecting public health.

[0093] The embodiments of the present invention are given for the purpose of illustration and description, and are not intended to be exhaustive or to limit the invention to the disclosed forms. Many modifications and variations will be apparent to those of ordinary skill in the art. The embodiments are selected and described in order to better illustrate the principles and practical applications of the present invention and to enable those of ordinary skill in the art to understand the present invention and thereby design various embodiments with various modifications suitable for specific uses.

Claims

1. A loop-mediated amplification primer set for detecting influenza A virus, influenza B virus, and respiratory syncytial virus, characterized in that: Specific loop-mediated amplification primers were designed for the influenza A virus M1 protein gene, the influenza B virus NEP gene, the conserved segment of the F gene of the respiratory syncytial virus, and the human RNaseP gene. Each set of primers includes two outer primers (OF / OB), two inner primers (FIP / BIP) and at least one loop primer (LF / LB). The specific primer sequences are as follows: Influenza A virus M1 gene: Outer primer-OF: ATGAGYCTTCTAACMGAGGTC; Outer primer-OB: CCRTTDAGGGCATTYTGRACA; Internal primer-FIP: TTTGAGGGGGCCTGAYGGGAAACGTAYGTTCTCTCTATCRT; Inner primer-BIP: ACAAGACCAATYCTGTCACCTCTGAAKCGTCTACGCTGCAGT; Loop primer-LB: GGRTTYGTRTTCACGCTCACCG; Influenza B virus NEP gene: Outer primer-OF: ACAATAARAAGGGATATGCGTAA; Outer primer-OB: CCATCTTCTTCATCCTCCA; Inner primer-FIP: GGACTTGTATCCATTGGGGTGTTATTGTCCTTGAGAGTGTTGG; Internal primer-BIP: CTRCATAGATTGAATGCATATGACCTGTAAGATCATCAGTRGCA; Loop primer-LB: AGAGTGGAAGRCTTGTTGCTAAAC; RSV F gene: Outer primer-OF:ACAGCAAGAYTAGATAGRATTGAT; Outer primer-OB: GTTGGATTGAGAGACACTTCATCTG; Internal primer-FIP: ACCAACCATRGCATCTCTTATWCCAAGTGAAATAYTAGGAATGCTYC; Internal primer-BIP: AGARCWGAAGCATTAATGACCAATGTGTCTTTGCCATYTTTTCRC; Loop primer-LF: GTCCTGCACTYGCWACTACTAATGT; Loop primer-LB: GCYATGGCAAGACTYAGGAATGA; Internal standard RNaseP: Outer primer-OF: CTTCAGCATGGCGGTGTT; Outer primer-OB: TCAGACCAACACCTCGGC; Internal primer-FIP: GCTGTCTCCACAAGTCCGCGGCAGATTTGGACCTGCGAG; Inner primer-BIP: CCTGGCCAACCTCATGCCACGACCTGACCGAGACCCATC; Loop primer-LF: AGAGCCTTCAGGTCAGAACCC; Loop Primer-LB: CAGACCATCGGGCCACACTC.

2. A kit for detecting influenza A virus, influenza B virus, and respiratory syncytial virus, characterized in that: Includes sample release agent, freeze-dried beads, chips, negative controls, and positive controls; The components of the nucleic acid releaser mainly include: 10-20 mM Tris-Cl, 10-50 mM KCl, 0.25-2.5 mM EDTA, 0.001-0.1% SDS (w / v), 0.05-0.5% TritonX-100 (v / v), 0.05-0.5% Tween-20 (v / v), 0.05-0.5% NP-40 (v / v), and 0.01%-0.1% Proclin-300; The freeze-dried ball mainly includes: 0.1-0.4U / μl commercial Bst polymerase, 1-4U / μl commercial reverse transcriptase, 0.01-0.02U / μl commercial UDG enzyme and matching commercial reaction buffer, 6-8mM MgSO4, 4-6mM dNTPs, 1× EveGreen fluorescent dye, and 1× freeze-dried protective agent; The four reaction wells in the chip are respectively embedded with influenza A virus, influenza B virus, respiratory syncytial virus and an internal standard RNaseP loop-mediated primer set in an air-dried form; The negative control substance is physiological saline, and the positive control substance is physiological saline containing influenza A virus, influenza B virus, and respiratory syncytial virus pseudovirus particles. The negative control and the positive control are embedded in a preservation tube in an air-dried form.

3. The kit according to claim 2, characterized in that The sample releasing agent is a reagent used to quickly lyse cells / viruses and release nucleic acids.

4. A detection method for influenza A virus, influenza B virus, and respiratory syncytial virus, characterized in that: The following steps are involved: S1: Use a sterile swab to swab a throat or nose swab, immerse the swab head in the sample release agent, and turn it upside down several times. The processing method of the negative control and positive control is as follows: take 150μl of sample release agent and add it to the storage tube containing the negative control and positive control, and turn it upside down to fully dissolve; S2: Directly pipette 125 μl of the sample in step S1 into the freeze-dried pellet, and pipette to fully dissolve the freeze-dried pellet; S3: Take 110 μl of the sample processed in step S2, add it to the chip, and insert the chip into the nucleic acid amplification analyzer for detection; S4: After the test is completed, the nucleic acid amplification analyzer automatically issues and prints the test results and report.

5. The detection method according to claim 4, characterized in that: The components of the sample release agent mainly include: 10-20mM Tris-Cl, 10-50mM KCl, 0.25-2.5mM EDTA, 0.001-0.1% SDS (w / v), 0.05-0.5% TritonX-100 (v / v), 0.05-0.5% Tween-20 (v / v), 0.05-0.5% NP-40 (v / v), and 0.01%-0.1% Proclin-300.

6. The detection method according to claim 4, characterized in that: The freeze-dried ball mainly includes: 0.1-0.4U / μl commercial Bst polymerase, 1-4U / μl commercial reverse transcriptase, 0.01-0.02U / μl commercial UDG enzyme and matching commercial reaction buffer, 6-8mM MgSO4, 4-6mM dNTPs, 1× EveGreen fluorescent dye, and 1× freeze-dried protective agent.

Images