Bagasse microcrystalline cellulose immobilized enzyme polysulfone membrane packed bed reactor

Abstract

The invention discloses a bagasse microcrystalline cellulose immobilized enzyme polysulfone membrane packed bed reactor, and belongs to the technical field of biology. According to the immobilized D-pantoic acid lactone hydrolase packed bed reactor, commercial immobilized enzyme is not adopted, the enzyme activity is effectively improved through the physical adsorption effect or weak chemical adsorption effect of the enzyme and the adsorbent, the enzyme is not prone to leaking out in the reaction, and additional environmental pollution is avoided. In addition, the proenzyme reaction device and the external circulation quasi-immobilized enzyme reaction device can react simultaneously, all existing process parameters are not changed, and the reaction speed is greatly increased. After the reactor is repeatedly used for 10 times, the hydrolysis rate is kept at 28% or above, and after the immobilized enzyme is stored at 4 DEG C for 180 days, the initial enzyme activity is kept at 90% or above. The production cost is greatly reduced, and repeated disassembly and assembly are not needed, so that the disassembly and assembly time is saved, the production efficiency is improved, and good economic and social benefits are generated.

Description

Technical Field

[0001] The invention relates to a bagasse microcrystalline cellulose immobilized enzyme polysulfone membrane packed bed reactor, belonging to the field of biotechnology. Background Art

[0002] Enzyme immobilization technology is the key to the industrial application of enzymes because it can recycle and reuse enzymes and achieve efficient separation of products, substrates and enzymes. Classic enzyme immobilization has some obvious disadvantages, such as the complicated and time-consuming purification and desalting steps of enzymes, and the easy loss of enzyme activity. In addition, due to its material limitations, the mass transfer efficiency, enzyme activity and reusability of classic enzyme immobilization will also be affected.

[0003] CBM is a domain with independent folding and function that is widely present in carbohydrate activity enzymes (CAZymes). It has no catalytic activity but has the activity of specifically binding to specific carbohydrates (especially insoluble substrates), and the specific recognition and binding ability of substrates is 100%. In recent years, the strategy of fusion expression of carbohydrate binding module (CBM) with protein has been proved to be effective in the one-step purification and immobilization of enzymes. CBMs are domains with independent folding and function that are widely present in carbohydrate activity enzymes. They can specifically target, distinguish and bind carbohydrates with slightly different structures, especially insoluble polysaccharides. In addition, this strategy improves the properties of fusion enzymes, such as stability, activity, selectivity and specificity. The introduction of these domains provides a universal platform for the immobilization of a wide range of proteins, and the immobilization rate is close to 100%. Moreover, the immobilization carriers of this strategy are mostly insoluble natural polysaccharides, such as cellulose, chitin, etc. For example, patent CN109266633A uses CBM as a purification / immobilization tag in Escherichia coli and dextran as an adsorption carrier to prepare the target protein. For example, Qin, Z. et al. used Curdlan as a carrier to immobilize enzymes using CBM. (Qin, Z.; Lin, S.; Qiu, YJ; Chen, QM; Zhang, Y.; Zhou, JC; Zhao, LM One-step immobilization-purification of enzymes by carbohydrate-binding module family 56 tag fusion. Food Chem. 2019, 299, 9. DOI: 10.1016 / j.foodchem.2019.125037.) One type of CBM can specifically recognize cellulose. During the adsorption process, microcrystalline cellulose with a small particle size is required to increase the adsorption surface area. However, due to its small particle size and low viscosity, the immobilized enzyme of microcrystalline cellulose with a small particle size cannot be separated from the substrate by centrifugation or filtration.

[0004] Bagasse is increasingly valued as a good green renewable polymer material, and its comprehensive utilization methods are becoming more and more diverse. The chemical composition of bagasse is mainly lignocellulose, with cellulose accounting for 32% to 48% of the dry matter, hemicellulose accounting for 19% to 24%, lignin accounting for 23% to 32%, and ash accounting for about 4%. The chemical composition of bagasse makes it an ideal raw material for the development of environmentally friendly materials. However, at present, only a few extensive utilization methods such as pulping and papermaking, production of green and environmentally friendly tableware and artificial boards have achieved large-scale production, and the high-value utilization technology and green production process of bagasse have yet to be developed. The preparation of microcrystalline cellulose from bagasse is conducive to promoting the high-value utilization of bagasse, extending the sugarcane industry chain, and promoting the healthy and sustainable development of the industry.

[0005] D-pantoic acid lactone is an important intermediate for producing D-pantoic acid. There are many methods for preparing D-pantoic acid lactone, which mainly include chemical splitting, direct fermentation, asymmetric reductase and hydrolysis splitting. Among them, using D-pantoic acid lactone hydrolase to split DL-type pantoic acid lactone is simple and easy to operate, the reaction conditions are relatively mild, and it will not pollute the environment, and it has a good application prospect. However, the current D-pantoic acid lactone hydrolase splits DL-type pantoic acid lactone to produce D-pantoic acid, but there are problems such as difficulty in preparing immobilized enzymes, low activity of immobilized enzymes, high manual operation intensity, and more wastes. There are reports on combining D-pantoic acid lactone hydrolase with CBM to construct immobilized D-pantoic acid lactone hydrolase, but there is still a certain distance from continuous, large-scale, industrialized hydrolysis of DL-pantoic acid lactone, and thus the hydrolysis efficiency of DL-pantoic acid lactone is still not ideal. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention provides a bagasse microcrystalline cellulose immobilized enzyme polysulfone membrane packed bed reactor, aiming to solve the technical problems of low efficiency, complex operation and low degree of mechanization of traditional D-pantoic acid lactone hydrolase immobilization.

[0007] The first technical solution provided by the present invention is a bagasse microcrystalline cellulose immobilized enzyme polysulfone membrane packed bed reactor, in which a polysulfone hollow fiber membrane is installed in the packed bed reactor, the polysulfone hollow fiber membrane is provided with gradient pores, the gradient pores are a micro-nano bead network structure with a pore size increasing from the outer surface layer to the inner surface layer along the radial cross-section of the polysulfone hollow fiber membrane, and the polysulfone hollow fiber membrane is filled with bagasse microcrystalline cellulose; the bagasse microcrystalline cellulose uses a CBM binding module as a gripper to adsorb the immobilized enzyme, the CBM binding module is a structural domain in the carbohydrate-active enzyme with independent folding and function, the CBM binding module has no catalytic activity but has the activity of specifically binding to specific carbohydrates.

[0008] In certain embodiments, the pore size of the outer layer of the polysulfone hollow fiber membrane is 0.01-2.0 μm, the pore size ratio of the inner layer to the outer layer is 10:1-200:1, and the porosity is 40-80%.

[0009] In certain embodiments, the particle size of bagasse microcrystalline cellulose is 20 to 100 μm.

[0010] In certain embodiments, the enzyme may be a D-pantolactone hydrolase.

[0011] In certain embodiments, the CBM binding module may be derived from the carbohydrate binding domain CBM24 from Clostridium thermocellum (C. thermocellum, HF912724.1). The coding sequence of the CBM binding module is shown in SEQ ID NO:2.

[0012] In certain embodiments, a yeast expression system is used to express the enzyme and the CBM binding module in fusion.

[0013] In certain embodiments, the yeast may be Pichia pastoris GS115.

[0014] The present invention provides a method for fusion expression of a carbohydrate binding module CBM that can specifically bind to microcrystalline cellulose and a D-pantoic acid lactone hydrolase in Pichia pastoris GS115, thereby achieving extracellular overexpression of the fusion D-pantoic acid lactone hydrolase Dlac-CBM, one-step purification and immobilization of the D-pantoic acid lactone hydrolase.

[0015] The present invention provides a method for fusion expression of D-pantoic acid lactone hydrolase and CBM binding module, wherein the CBM binding module is a structural domain widely present in carbohydrate activity enzymes (CAZymes) and has independent folding and function, and the CBM binding module has no catalytic activity but has the activity of specifically binding to specific carbohydrates (especially insoluble substrates); the coding sequence of the CBM binding module is shown in SEQ ID NO: 1, and the method comprises the following steps:

[0016] S1, synthesizing the coding sequence of the CBM binding module with a linker and inserting it into the pPIC9K vector carrying the D-pantoic acid lactone hydrolase coding sequence to construct pPIC9K-Dlac-CBM;

[0017] S2, linearize pPIC9K-Dlac-CBM, then transform it into Pichia pastoris GS115 competent cells, and screen to obtain positive clones GS115-pPIC9K-Dlac-CBM;

[0018] S3, culture the positive clone GS115-pPIC9K-Dlac-CBM, and use methanol to induce the positive clone to express the fusion enzyme Dlac-CBM;

[0019] S4, collecting the supernatant of the fermentation broth of the positive clones and using it to prepare a D-pantolactone hydrolase packed bed reactor.

[0020] In certain embodiments, the CBM binding module is derived from a domain derived from Clostridium thermocellum that can specifically bind to microcrystalline cellulose.

[0021] In certain embodiments, the coding sequence of the CBM binding module with a linker is inserted into the Not I site of pPIC9K-Dlac. The linker is used to connect the CBM binding module and the D-pantoic acid lactone hydrolase. The linker is preferably a rigid linker.

[0022] In certain embodiments, pPIC9K-Dlac-CBM is linearized with Sac I.

[0023] The second technical scheme provided by the present invention is a preparation method of an immobilized D-pantolactone hydrolase packed bed reactor, wherein GS115-pPIC9K-Dlac-CBM is used as a strain and a fermentation supernatant containing a large amount of fusion enzyme Dlac-CBM is obtained through high-density fermentation, and the fermentation supernatant is mixed with bagasse microcrystalline cellulose filled in a polysulfone hollow fiber membrane for reaction, and the fusion enzyme is adsorbed by bagasse microcrystalline cellulose to quickly achieve one-step purification and preparation of immobilized D-pantolactone hydrolase.

[0024] In some embodiments, the steps include:

[0025] (1) preparing bagasse microcrystalline cellulose;

[0026] (2) filling the bagasse microcrystalline cellulose prepared in step (1) into a polysulfone hollow fiber membrane installed in a packed bed reactor, thereby obtaining a bagasse microcrystalline cellulose polysulfone membrane packed bed reactor;

[0027] (3) Immobilization of fused D-pantoic acid lactone hydrolase Dlac-CBM: The fermentation supernatant containing the fused D-pantoic acid lactone hydrolase Dlac-CBM was loaded into a bagasse microcrystalline cellulose polysulfone membrane packed bed reactor, and then incubated at 35°C to allow the Dlac-CBM in the fermentation supernatant to be fully adsorbed by the bagasse microcrystalline cellulose in the packed bed reactor. After the incubation, the packed bed reactor was equilibrated with Tris-HCl buffer to remove unbound Dlac-CBM and other impurities, thereby obtaining an immobilized D-pantoic acid lactone hydrolase packed bed reactor.

[0028] In certain embodiments, in step (1), the preparation method of sugarcane bagasse microcrystalline cellulose is as follows: sugarcane bagasse powder and water are mixed in a ratio of 1g:10mL, boiled for 10min, and filtered under reduced pressure to obtain a filter residue; the filter residue is dried, and then sodium hydroxide aqueous solution is added in a ratio of 1g:20mL of residue to liquid, placed in a 70°C water bath and heated at a constant temperature, slowly stirred for 90min, after the stirring is completed, it is cooled to room temperature and filtered and the filter residue is washed to neutrality, the filter residue is dried in a vacuum drying oven, and then, water is added in a ratio of 1g:20mL of material to liquid and the pH value is adjusted to 1-2 with 10% hydrochloric acid, the temperature is raised to 50°C in a constant temperature water bath, stirred for reaction for 2h, and after the stirring is completed, it is filtered and the filter residue is washed to neutrality. The filter residue obtained is sugarcane bagasse cellulose. The obtained bagasse cellulose was added with NaClO in a solid-liquid ratio of 1g:10mL, and the pH value was adjusted to 4-5 with 10% hydrochloric acid. The temperature of the constant temperature water bath was raised to 80°C, stirred for 2h, filtered and the filter residue was washed to neutrality, and placed in a vacuum drying oven for drying. The prepared bagasse cellulose was acidified with 6% hydrochloric acid, the acidification temperature was 60°C, the acidification time was 90min, after the acidification was completed, suction was filtered and the precipitate was repeatedly washed with distilled water until it was neutral, and then hydrogen peroxide was added in a solid-liquid ratio of 1g:10mL, heated in a constant temperature water bath at a temperature of 80°C, the water bath time was 90min, the filter residue was washed to neutrality by suction filtration, dehydrated with anhydrous ethanol, and dried to obtain bagasse microcrystalline cellulose (MCC).

[0029] In certain embodiments, in step (2), the loading amount of bagasse microcrystalline cellulose is 0.8-1.5 g / g hollow fiber membrane.

[0030] In certain embodiments, in step (2), the particle size of bagasse microcrystalline cellulose is 20 to 100 μm.

[0031] In certain embodiments, in step (2), the polysulfone hollow fiber membrane is provided with gradient pores, wherein the gradient pores are micro-nano bead-like network structures whose pore diameter increases gradually from the outer surface layer to the inner surface layer along the radial cross section of the polysulfone hollow fiber membrane.

[0032] In certain embodiments, the pore size of the outer layer of the polysulfone hollow fiber membrane is 0.01-2.0 μm, the pore size ratio of the inner layer to the outer layer is 10:1-200:1, and the porosity is 40-80%.

[0033] In certain embodiments, in step (3), the loading amount of the fused D-pantolactone hydrolase Dlac-CBM is 50-100 U / g bagasse microcrystalline cellulose.

[0034] In certain embodiments, in step (3), the flow rate of the fermentation supernatant is 20-40 mL / min, and the enzyme activity of the fermentation supernatant is 500-1200 U / mL.

[0035] In certain embodiments, in step (3), the incubation time is 30-100 min.

[0036] In certain embodiments, in step (3), after the incubation is completed, the packed bed reactor is equilibrated with 600 mM Tris-HCl buffer, pH 7.5, at a flow rate of 10 mL / min.

[0037] The third technical solution provided by the present invention is a method for producing D-pantolactone, wherein the method comprises passing a DL-pantolactone solution through the immobilized D-pantolactone packed bed reactor described in the second technical solution, and utilizing bagasse cellulase-immobilized D-pantolactone hydrolase to hydrolyze DL-pantolactone to obtain D-pantolactone.

[0038] In certain embodiments, the DL-pantolactone solution is passed through the packed bed reactor, wherein the unreacted DL-pantolactone solution is returned to the packed bed reactor.

[0039] In certain embodiments, the flow rate of the DL-pantolactone solution is 20 to 50 mL / min, and the concentration of the DL-pantolactone solution is 15 to 50 g / L.

[0040] In certain embodiments, the pH of the reaction solution in the packed bed reactor is always maintained between 7.0 and 7.5.

[0041] In certain embodiments, the temperature of the packed bed reactor is controlled at 35°C.

[0042] The concentration of Dlac-CBM in the above reaction solution is preferably 0.1-10 mg / mL.

[0043] The technical effects of the present invention are as follows:

[0044] (1) The original enzyme reaction device and the external circulation quasi-immobilized enzyme reaction device can react simultaneously without changing all existing process parameters, greatly improving the reaction speed; the reactor retains more than 28% of the hydrolysis rate after being reused 10 times, and the immobilized enzyme retains more than 90% of the initial enzyme activity after being stored at 4°C for 180 days.

[0045] (2) Low cost. Commercial immobilized enzymes are not used. Physical adsorption or weak chemical adsorption between enzymes and adsorbents is relied upon to effectively improve enzyme activity. The enzyme is not easily leaked during the reaction and does not cause additional environmental pollution.

[0046] (3) The production cost of the immobilized D-pantolactone hydrolase packed bed reactor provided by the present invention is greatly reduced, and there is no need for repeated disassembly and installation, thereby saving disassembly and installation time, improving production efficiency, and generating good economic and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Electron microscopic images of bagasse microcrystalline cellulose polysulfone membrane packed bed reactor; A: bagasse microcrystalline cellulose, B: immobilized bagasse microcrystalline cellulose (swelling occurs), C: immobilized bagasse microcrystalline cellulose in polysulfone membrane hollow fiber membrane, D: polysulfone membrane hollow fiber membrane.

[0048] Figure 2 This is a physical picture of the immobilized D-pantolactone hydrolase packed bed reactor of the present invention.

[0049] Figure 3 The schematic diagram of the present invention is a schematic diagram of the hydrolysis of D-pantolactone by the immobilized D-pantolactone hydrolase packed bed reactor. DETAILED DESCRIPTION

[0050] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0051] Test method:

[0052] Enzyme activity and hydrolysis rate determination method: 7mL 20% (w·v -1 ) of DL-PL aqueous solution, 7 mL of pH 7.5 Tris-HCl (1 mol·L -1) and a certain amount of enzyme solution were placed in a 25 mL shaking flask, reacted at 30°C for 20 minutes, filtered to remove impurities, and then the enzyme activity and hydrolysis rate were calculated by HPLC analysis of the reduction of D-PL and the increase of D-pantoic acid. The blank control was the enzyme solution inactivated by boiling for 10 minutes. 700 μL of the reaction solution was added to 300 μL of methanol to terminate the reaction, and HPLC analysis was performed. The HPLC analysis conditions were Chiralcel IG-3 column (4.6 mm × 250 mm, 3 μm, Diacel, Tokyo, Japan), using formic acid: methanol (0.1%, 70:30, v·v-1) as eluent, flow rate of 0.3 mL·min-1, 35°C, 210 nm; Zorbax SBC18, 5 μmol·L-1 250×4.6 mm, mobile phase of acetonitrile: 0.02 mol·L-1 KH2PO4 = 1:9 (v·v-1), pH adjusted to 3.0 with HCl, flow rate of 1 mL·min-1, wavelength of 215 nm, column temperature of 25°C. The pH value of the sample was about 5-7, the elution time of D-pantoic acid was 4.0 min, and the elution time of D-PL was 6.9 min. Enzyme activity is defined as the amount of enzyme required to hydrolyze 1 μmol DL-PL into D-pantoic acid per minute under certain conditions, which is defined as 1 enzyme activity unit (U), which is used to calculate the enzyme activity units per liter of enzyme solution or per gram of immobilized enzyme (U / L or U / g). The hydrolysis rate is the comparison of the reduction of D-PL before and after hydrolysis.

[0053] The raw materials used in the examples are:

[0054] 1. Source of pPIC9K-Dlac plasmid: A genetically engineered Pichia pastoris and a method for preparing D-pantolactone hydrolase disclosed in patent document CN112553226A.

[0055] 2. YPD medium formula: 20.0 g peptone, 10.0 g yeast extract powder, 20.0 g glucose, 15.0 g agar, add 1 L distilled water, pH 6.5 ± 0.2.

[0056] 3. Source of grapefruit peel microcrystalline cellulose: self-made, now published in the following literature: Li Qingwang, Jian Yeye. Extraction of grapefruit peel cellulose and research on functional jelly candy [J]. Food Industry, 2023, (11): 105-107.

[0057] 4. Lignin microcrystalline cellulose Source: Homemade, now published in the following literature: Enzyme immobilisation on wood-derived cellulose scaffolds via carbohydrate-binding module fusion constructs

[0058] 5. Polysulfone hollow fiber membrane column: Gently bend the polysulfone hollow fiber membrane filament (disclosed in patent CN103816818A) into a U shape, pass it through the inner hole of the large tube, ensure that the total length of the U-shaped part of each membrane filament is 30 cm, and use Hezhong 200 fully transparent epoxy fast-curing glue to seal the gaps between the membrane filaments and between the membrane filaments and the tube mouth to form a membrane column.

[0059] Example 1 Preparation of bagasse microcrystalline cellulose polysulfone membrane packed bed reactor

[0060] The specific steps are as follows:

[0061] (1) Preparation of bagasse microcrystalline cellulose: Weigh a certain amount of bagasse powder (PS), then mix the bagasse powder with distilled water at a ratio of 1g:10mL, boil for 10min, and filter under reduced pressure to obtain a filter residue. The filter residue is placed in a vacuum drying oven to dry, and then a pre-prepared sodium hydroxide aqueous solution is added at a ratio of 1g:20mL of the residue to liquid, and placed in a water bath at 70°C for constant temperature heating, slowly stirred for 90min, and after the stirring is completed, it is cooled to room temperature and filtered and the filter residue is washed to neutrality, and the filter residue is dried in a vacuum drying oven, and then distilled water is added at a ratio of 1g:20mL of the material to liquid ratio and the pH value is adjusted to 1-2 with 10% hydrochloric acid, and the temperature is raised to 50°C in a constant temperature water bath for stirring and reaction for 2h. After the stirring is completed, it is filtered and the filter residue is washed to neutrality. The filter residue obtained is bagasse cellulose. The obtained bagasse cellulose was added with NaClO in a solid-liquid ratio of 1g:10mL, and the pH value was adjusted to 4-5 with 10% hydrochloric acid. The temperature of the constant temperature water bath was raised to 80°C, stirred for 2h, filtered and the filter residue was washed to neutrality, and placed in a vacuum drying oven for drying. The prepared bagasse cellulose was acidified with 6% hydrochloric acid, the acidification temperature was 60°C, and the acidification time was 90min. After the acidification, the precipitate was filtered and repeatedly washed with distilled water until it was neutral, and then hydrogen peroxide was added in a solid-liquid ratio of 1g:10mL, and heated in a constant temperature water bath at a temperature of 80°C, the water bath time was 90min, and the filter residue was washed to neutrality by suction filtration, dehydrated with anhydrous ethanol, and dried to obtain bagasse microcrystalline cellulose (MCC), such as Figure 1 shown.

[0062] (2) Polysulfone membrane packed bed reactor: The polysulfone hollow fiber membrane column is a dead-end filtration component connected to a peristaltic pump.

[0063] The polysulfone hollow fiber membrane is provided with gradient pores, which are micro-nano bead-like network structures with pore sizes increasing from the outer surface to the inner surface along the radial cross section of the polysulfone hollow fiber membrane. The pore size of the outer surface of the polysulfone hollow fiber membrane is 0.01 to 2.0 μm, the pore size ratio of the inner surface to the outer surface is 10:1 to 200:1, and the porosity is 40 to 80%.

[0064] (3) Filling: The bagasse microcrystalline cellulose was washed three times with Tris-HCl buffer (600 mmol / L, pH 7.5), and then the mixture of microcrystalline cellulose and buffer was slowly passed into the polysulfone membrane hollow fiber membrane reactor using a peristaltic pump ( Figure 1 )middle.

[0065] Example 2 Preparation method of immobilized D-pantolactone hydrolase packed bed reactor

[0066] The steps of the preparation method include:

[0067] 1. Construction of recombinant yeast GS115-pPIC9K-Dlac-CBM: A CBM sequence with a rigid linker was synthesized and inserted into the Not1 site of pPIC9K-Dlac to construct pPIC9K-Dla-CBM.

[0068] The nucleotide sequence encoding the CBM binding module with a rigid linker is shown in SEQ ID NO: 1 (the underlined and bold sequence is the linker):

[0069] GAAGCTGCAGCTAAAG AAGCAGCAGCTAAGATGGATTTGAAGGTTGAGTTTTATAACTCAAATCCATCTGACACTACTAATTCTATTAACCCACAATTTAAAGTTACTAATACTGGTTCTTCTGCTATCGACTTATCTAAATTGACTTTGAGATACTACTATACTGTTGATGGTCAAAAAGATCAAACTTTTTGGTGTGATCATGCTGCTATTATTGGTTCTAATGGTTCTTATAACGGAATCACTTCAAATGTTAAA GGTACTTTTGTTAAAATGTCTTCATCTACTAATAACGCTGATACTTATTTGGAAATTTCTTTTACTGGTGGTACTTTGGAACCTGGTGCACATGTTCAAATTCAAGGAAGGTTCGCTAAGAATGACTGGTCTAATTATACACAGTCTAACGACTACTCTTTAAATCTGCTTCTCAATTTGTTGAATGGGATCAAGTTACTGCTTATTTGAATGGTGTTTTGGTTTGGGGTAAAGAACCTGGT

[0070] pPIC9K-Dlac-CBM was linearized with SacI and then electroporated into Pichia pastoris GS115 competent cells. The transformed cells were plated on amino-free yeast carbon source glucose agar (MD) medium and cultured at 30°C for 4 days. Positive clones were picked and cultured in shake flasks. The supernatant of the culture solution was collected and confirmed to have D-pantoic acid lactone hydrolase activity by running gel and enzyme activity assay, thereby confirming that the positive clone was indeed GS115-pPIC9K-Dlac-CBM.

[0071] pPIC9K-Dlac-CBM was linearized with SacI and then electroporated into Pichia pastoris GS115 competent cells. The transformed cells were plated on amino-free yeast carbon source glucose agar (MD) medium and cultured at 30°C for 4 days. Positive clones were picked and cultured in shake flasks. The supernatant of the culture solution was collected and confirmed to have D-pantoic acid lactone hydrolase activity by running gel and enzyme activity assay, thereby confirming that the positive clone was indeed GS115-pPIC9K-Dlac-CBM.

[0072] 2. High-density expression of strain GS115-pPIC9K-Dlac-CBM and acquisition of crude enzyme solution of fused D-pantolactone hydrolase Dlac-CBM.

[0073] The high-density fermentation method and medium formulation refer to the Pichia yeast fermentation process guide (Invitrogen). Briefly, a single GS115-pPIC9K-Dlac-CBM was inoculated into 10 mL of YPD medium and cultured at 28°C and 220 rpm for 12 h. Then, 10 mL of seed solution was inoculated into 200 ml of YPD medium and cultured for 24 h to obtain secondary species. The secondary species was inoculated into a 3L fermenter containing 1 liter of BSM medium, the pH was controlled at 5.0-6.0, the temperature was 28-30°C, the stirring speed was 500 rpm, the ventilation ratio was 1-1.5 vvm, and the dissolved oxygen DO rebounded. Within 4-6 h after the DO rebound, 120 ml of 50% (w / v) glycerol was slowly added. When the dissolved oxygen rebounded again, the cells were starved for 1.5-2 h, and then the dissolved oxygen was controlled to be not less than 20%, 120 mL of 100% methanol was slowly added, the pH was adjusted to 5.5, and the rotation speed was maintained at 800 rpm to induce expression for 5 d. At the end of fermentation, the bacteria are removed by centrifugation or filtration, and the fermentation supernatant is collected as the crude enzyme solution for hydrolyzing Dlac-CBM with fusion D-pantoic acid lactone. After testing, the enzyme activity of the crude enzyme solution is 760.1 U / mL, the enzyme protein content is 1.8 mg / mL, and the specific enzyme activity is 422.27 U / mg.

[0074] 3. The fused D-pantolactone hydrolase Dlac-CBM is loaded onto the packed bed reactor.

[0075] The fermentation broth of GS115-pPIC9K-Dlac-CBM was centrifuged at 12000×g for 10 min and the supernatant was filtered with a 0.45 μm filter membrane, and then loaded into a hollow fiber membrane reactor filled with bagasse microcrystalline cellulose polysulfone membrane of Example 1 through a peristaltic pump. The reactor was incubated at 35°C for about 90 min to allow Dlac-CBM to be completely adsorbed onto the cellulose, with the protein concentration in the waste liquid no longer changing. The reactor was equilibrated with Tris-HCl buffer (0.6 mM, pH 7.5) at a rate of 1 mL / min to remove unbound Dlac-CBM and other proteins. Finally, as Figure 2 As shown, a bagasse microcrystalline cellulose immobilized D-pantolactone hydrolase polysulfone membrane hollow fiber membrane reactor was constructed.

[0076] Example 3D - Hydrolysis of pantolactone

[0077] like Figure 3 As shown, a peristaltic pump continuously adds 150 mL of DL-pantolactone substrate solution into the reactor at a rate of 30 ml / min, and a circulation is formed at the liquid outlet. Unreacted DL-PL will be introduced into the reactor again and continuously hydrolyzed by Cellulose@Dlac-CBM (cellulose immobilized enzyme) on its path. The entire reaction process is controlled at about 35°C by a temperature control device. If necessary, the entire device can be placed in an incubator. At the same time, in order to ensure that the pH in the reaction solution is always maintained between 7.0 and 7.5, ammonia water is added using a pH automatic control liquid addition system.

[0078] The results showed that the hydrolysis time was 6 hours, the reactor retained more than 28% of the hydrolysis rate after being reused 10 times, and the immobilized enzyme retained more than 90% of the initial enzyme activity after being stored at 4°C for 180 days.

[0079] The protein concentration in the reaction solution was measured by the Coomassie Brilliant Blue method (Bradford method) (0.08 mg / mL), confirming that the polysulfone membrane did not cause the enzyme to leak out. The specific binding and recognition between CBM and bagasse cellulose made the enzyme and cellulose bind very tightly. At the same time, the special leak-proof structure of the polysulfone membrane also reduced the activity of the bagasse-immobilized enzyme, thus preventing enzyme leakage.

[0080] Example 4: Hydrolysis of D-pantolactone in fed-batch mode

[0081] The peristaltic pump continuously adds 150mL of 40g / L DL-pantolactone substrate solution into the reactor at 30ml / min, and forms a cycle at the outlet. The unreacted DL-PL will be introduced into the reactor again and continuously hydrolyzed by Cellulose@Dlac-CBM (cellulose immobilized enzyme) on its path. The entire reaction process is controlled at about 35°C by a temperature control device. If necessary, the entire device can be placed in an incubator. At the same time, to ensure that the pH in the reaction solution is always maintained between 7.0-7.5, ammonia water is added using a pH automatic control liquid addition system. When the concentration of D-pantolactone is lower than 30g / / L, a high-concentration DL-pantolactone solution of 100g / L is added to make the concentration of D-pantolactone 40g / L, and the hydrolysis reaction continues.

[0082] The result is: the reactor was operated continuously for 540 hours, and the hydrolysis rate of D-pantolactone was kept above 25%. The protein concentration in the reaction solution (0.05 mg / mL) was measured to confirm that the polysulfone membrane did not cause the enzyme to leak out.

[0083] Comparative Example 1

[0084] The cellulose immobilized enzyme was directly reacted with 40% DL-PL substrate solution, and the results were as follows: 1. The cellulose immobilized enzyme could not fully react with the substrate solution by means of oscillation or stirring (all of them would sink to the bottom), resulting in a low substrate hydrolysis rate of 15%; 2. In multiple batches of reactions, the cellulose immobilized enzyme could not be separated from the substrate solution, and centrifugation and filtration would cause part of the cellulose immobilized enzyme to be lost, resulting in the loss of the next cellulose immobilized enzyme; 3. The cellulose immobilized enzyme was directly exposed to the substrate solution, and the measurement of the protein concentration in the reaction solution (0.205 mg / mL) showed that part of the enzyme in the reaction solution was not tightly bound to cellulose and was lost; due to the above reasons, the hydrolysis rate of the cellulose immobilized enzyme dropped sharply in multiple batches of reactions, and the hydrolysis rate dropped rapidly after 3 to 5 batches, and was only 28.6% of the hydrolysis rate of the first batch.

[0085] Comparative Example 2

[0086] The bagasse microcrystalline cellulose in Example 1 was replaced with grapefruit peel microcrystalline cellulose, and other conditions or parameters were consistent with Example 1. An immobilized D-pantolactone packed bed reactor was prepared according to the method of Example 2, and the results were as follows:

[0087] 1. Take the same mass of grapefruit peel and bagasse as raw materials to extract microcrystalline cellulose by ultrasonic assisted chemical method. The extraction rate of grapefruit peel microcrystalline cellulose is 27%, and the extraction rate of bagasse microcrystalline cellulose is 45%. 2. Take the same mass of grapefruit peel microcrystalline cellulose and bagasse microcrystalline cellulose and incubate them at 35℃ to make the Dlac-CBM in the fermentation supernatant fully adsorbed by cellulose in the packed bed reactor. The enzyme activity of grapefruit peel microcrystalline cellulose immobilized enzyme is 13U / g, and the enzyme activity of bagasse microcrystalline cellulose immobilized enzyme is 29.25U / g.

[0088] Comparative Example 3

[0089] For example, the bagasse microcrystalline cellulose in Example 1 was replaced with lignin microcrystalline cellulose, and other conditions or parameters were the same as those in Example 1. An immobilized D-pantolactone packed bed reactor was prepared according to the method of Example 2. The specific results are as follows:

[0090] 1. Take the same mass of basswood and bagasse as raw materials to extract microcrystalline cellulose by ultrasonic-assisted chemical method. The extraction rate of basswood microcrystalline cellulose is 52%, and the extraction rate of bagasse microcrystalline cellulose is 45%. 2. Take the same mass of basswood microcrystalline cellulose and bagasse microcrystalline cellulose and incubate them at 35℃. Basswood microcrystalline cellulose cannot be directly processed into powder and cannot be loaded into the polysulfone hollow fiber membrane. The enzyme activity of basswood microcrystalline cellulose immobilized enzyme is 10.7U / g, and the enzyme activity of bagasse microcrystalline cellulose immobilized enzyme is 29.25U / g.

[0091] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A bagasse microcrystalline cellulose immobilized enzyme polysulfone membrane packed bed reactor, characterized in that: A polysulfone hollow fiber membrane is installed in a packed bed reactor, wherein the polysulfone hollow fiber membrane is provided with gradient pores, wherein the gradient pores are a micro-nano bead network structure with a pore size increasing gradually from the outer surface layer to the inner surface layer along the radial cross section of the polysulfone hollow fiber membrane, and the polysulfone hollow fiber membrane is filled with bagasse microcrystalline cellulose; the bagasse microcrystalline cellulose uses a CBM binding module as a gripper to adsorb immobilized enzymes, wherein the CBM binding module is a structural domain in a carbohydrate-active enzyme with independent folding and function, and the CBM binding module has no catalytic activity but has the activity of specifically binding to specific carbohydrates.

2. The reactor according to claim 1, characterized in that The pore size of the outer layer of the polysulfone hollow fiber membrane is 0.01-2.0 μm, the pore size ratio of the inner layer to the outer layer is 10:1-200:1, and the porosity is 40-80%. The particle size of the bagasse microcrystalline cellulose is 20-100 μm.

3. The reactor according to claim 1, characterized in that The enzyme may be a D-pantoic acid lactone hydrolase; and the CBM binding module may be derived from a carbohydrate binding domain CBM24 from Clostridium thermocellum.

4. A method for preparing an immobilized D-pantolactone hydrolase packed bed reactor, characterized in that: The strain GS115-pPIC9K-Dlac-CBM is used as the strain to obtain a fermentation supernatant containing a large amount of fusion enzyme Dlac-CBM through high-density fermentation. The fermentation supernatant is mixed with bagasse microcrystalline cellulose filled in a polysulfone hollow fiber membrane for reaction. The bagasse microcrystalline cellulose is used to adsorb the fusion enzyme to quickly achieve one-step purification and preparation of immobilized D-pantoic acid lactone hydrolase. The polysulfone hollow fiber membrane is provided with gradient pores, and the gradient pores are a micro-nano bead network structure with a pore size that increases gradually from the outer surface layer to the inner surface layer along the radial cross section of the polysulfone hollow fiber membrane.

5. The method according to claim 4, characterized in that The construction method of the strain GS115-pPIC9K-Dlac-CBM comprises the following steps: S1, synthesizing a coding sequence of a CBM binding module with a linker as shown in SEQ ID NO: 1, and inserting it into a pPIC9K vector carrying a D-pantoic acid lactone hydrolase coding sequence to construct pPIC9K-Dlac-CBM; S2, linearize pPIC9K-Dlac-CBM, then transform it into Pichia pastoris GS115 competent cells, and screen to obtain positive clones GS115-pPIC9K-Dlac-CBM.

6. The method according to claim 4 or 5, characterized in that: The steps include: (1) preparing bagasse microcrystalline cellulose; (2) filling the bagasse microcrystalline cellulose prepared in step (1) into a polysulfone hollow fiber membrane installed in a packed bed reactor, thereby obtaining a bagasse microcrystalline cellulose polysulfone membrane packed bed reactor; (3) Immobilization of fused D-pantoic acid lactone hydrolase Dlac-CBM: The fermentation supernatant containing the fused D-pantoic acid lactone hydrolase Dlac-CBM was loaded into a bagasse microcrystalline cellulose polysulfone membrane packed bed reactor, and then incubated at 35°C to allow the Dlac-CBM in the fermentation supernatant to be fully adsorbed by the bagasse microcrystalline cellulose in the packed bed reactor. After the incubation, the packed bed reactor was equilibrated with Tris-HCl buffer to remove unbound Dlac-CBM and other impurities, thereby obtaining an immobilized D-pantoic acid lactone hydrolase packed bed reactor.

7. The method according to claim 6, characterized in that The loading amount of bagasse microcrystalline cellulose is 0.8-1.5 g / g polysulfone hollow fiber membrane; the loading amount of fused D-pantoic acid lactone hydrolase Dlac-CBM is 50-100 U / g bagasse microcrystalline cellulose.

8. The method according to claim 6 or 7, characterized in that: In step (3), the flow rate of the fermentation supernatant is 20-40 mL / min, and the enzyme activity of the fermentation supernatant is 500-1200 U / mL; The incubation time is 30-100 min; After the incubation period, the packed bed reactor was equilibrated with 600 mM Tris-HCl buffer, pH 7.5, at a flow rate of 10 mL / min.

9. A method for producing D-pantolactone, characterized in that: The method comprises the steps of passing a DL-pantoic acid lactone solution through an immobilized D-pantoic acid lactone enzyme packed bed reactor prepared by the method described in any one of claims 4 to 8, hydrolyzing DL-pantoic acid lactone with bagasse cellulase-immobilized D-pantoic acid lactone hydrolase to obtain D-pantoic acid lactone, wherein the solution containing unreacted DL-pantoic acid lactone flows back to the packed bed reactor.

10. The method according to claim 9, characterized in that The flow rate of the DL-pantoic acid lactone solution is 20-50 mL / min, and the concentration of the DL-pantoic acid lactone solution is 15-50 g / L; the pH of the reaction solution in the packed bed reactor is always maintained between 7.0 and 7.5.

Images