Beta-amyrin synthase mutant and application thereof in preparation of dammarendiol

Abstract

The invention relates to a beta-amyrin synthase mutant and application of the beta-amyrin synthase mutant in preparation of dammarendiol, and belongs to the technical field of genes. The beta-amyrin alcohol synthase mutant is subjected to the following amino acid mutation on a sequence as shown in SEQ ID NO: 75: M240L, and other amino acid sequences are kept unchanged; or M240L, Q483V, and other amino acid sequences are kept unchanged; the amino acid sequences are M240L, L251F, M253F and Q483V, or M240L, L251F, M253F and Q483V, and other amino acid sequences are kept unchanged; the amino acid sequences are M240L, L251F, M253F, L325V, Q483V and G491A, or M240L, L251F, M253F, L325V, Q483V and G491A, and other amino acid sequences are kept unchanged; the amino acid sequence of the gene can be L128T, M240L, L251F, M253F, L325V, V375S, Q483V or G491A, or other amino acid sequences are kept unchanged. According to the invention, mutation of key amino acids is determined through site-directed mutagenesis and site-directed mutagenesis of beta-AS, so that beta-AS has the function of catalytically generating dammarendiol.

Description

Technical Field

[0001] The invention belongs to the field of gene technology, and particularly relates to a beta-amyrin synthase mutant and application thereof in the preparation of dammarene diol. Background Art

[0002] The OSC (oxidosqualene cyclase) gene family has undergone divergent evolution in evolution, and gene duplication events are believed to have driven the diversification of the OSC gene family. After the duplication event, one of the genes accumulated mutations under relaxed selection pressure. In most cases, the gene will be lost due to harmful mutations; while some of them will acquire new functions due to mutations and be retained by relying on the adaptive advantages brought by the new functions. OSC genes except cycloartenol synthase (CAS) may all originate from the duplication event of the CAS gene. OSC genes with a catalytic mechanism of CCC conformation are more likely to originate from lanosterol synthase (LAS) rather than CAS genes. At present, the specific evolutionary path of the OSC gene family is still unclear, and the above speculation on the evolutionary mechanism of the OSC gene family needs to be verified.

[0003] DDS (dammarenediol synthase) cyclizes 2,3-oxidosqualene (OS) to form dammarenediol (DM-II), which is a key step in the biosynthesis of dammarane-type saponins, which are the main bioactive components in important medicinal plants such as Panax notoginseng and ginseng, and have anti-tumor, anti-inflammatory, hypoglycemic, immunomodulatory and central nervous system protective effects. Recently, the ginseng DDS gene family originated from the new functionalization of the β-AS gene and other mTTSs genes in Araliaceae plants after the whole genome duplication event. The evolution of the DDS gene further showed that its catalytic function came from the change of the nucleotide sequence of the β-AS gene after the whole genome duplication event. This strongly revealed that the catalytic function of the enzyme is the result of mutations in key residues of β-AS.

[0004] Therefore, how to overcome the shortcomings of existing technologies is an urgent problem to be solved in the field of genetic technology. Summary of the invention

[0005] The purpose of the present invention is to solve the deficiencies of the prior art and provide a β-amyrin synthase mutant and its application in the preparation of dammarenediol.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] The first aspect of the present invention provides a β-amyrin synthase mutant, wherein the β-amyrin synthase mutant undergoes the following amino acid mutations in the sequence shown in SEQ ID NO.75 (the mutant sequence is PgOSCPNY1):

[0008] M240L, and keep the other amino acid sequences unchanged;

[0009] Alternatively, M240L, Q483V, and keeping the rest of the amino acid sequence unchanged;

[0010] or, M240L, L251 F, M253F, Q483V, while keeping the other amino acid sequences unchanged;

[0011] or, M240L, L251 F, M253F, L325V, Q483V, G491A, while keeping the other amino acid sequences unchanged;

[0012] Alternatively, L128T, M240L, L251F, M253F, L325V, V375S, Q483V, G491A, and keep the other amino acid sequences unchanged.

[0013] The second aspect of the present invention provides an isolated polynucleotide, characterized in that the polynucleotide encodes the above-mentioned β-amyrinol synthase mutant.

[0014] The third aspect of the present invention provides a vector, which contains the above-mentioned polynucleotide.

[0015] The fourth aspect of the present invention provides a host cell, wherein the host cell contains the above-mentioned vector, or the above-mentioned polynucleotide is integrated into its genome.

[0016] The fifth aspect of the present invention provides a method for producing the above-mentioned β-amyrin synthase mutant, comprising the steps of: culturing the above-mentioned host cell under suitable conditions to express the β-amyrin synthase mutant; and / or isolating the β-amyrin synthase mutant.

[0017] A sixth aspect of the present invention provides use of a β-amyrin synthase mutant in the preparation of dammarenediol, wherein the β-amyrin synthase mutant is used to catalyze 2,3-oxidized squalene to generate dammarenediol.

[0018] The seventh aspect of the present invention provides a method for preparing dammarene diol, characterized in that it comprises the following steps: contacting the β-amyrinol synthase mutant of claim 1 with a reaction substrate 2,3-squalene oxide to carry out a catalytic reaction, thereby obtaining dammarene diol.

[0019] Further, preferably, the catalytic reaction is specifically as follows: a β-amyrin synthase mutant is constructed on a pYES2 expression vector, transformed into BY4742 yeast cells and fermented to obtain dammarene diol.

[0020] Furthermore, preferably, after transformation into BY4742 yeast cells and fermentation for 7 days, the yeast cell product is extracted with methanol for analysis, and dammarenediol is subsequently detected by high performance liquid chromatography.

[0021] The inventors of the present invention inferred through the genetic evolution of DDS that the function of DDS in catalysis of dammarenediol synthase is a new function generated by the change in the gene nucleotide sequence of β-AS after the whole genome duplication event, and therefore further inferred that the enzyme catalysis function of DDS was generated because of the mutation of some key amino acid residues of β-AS. In the early stage, the inventors of the present invention characterized 22 genes with DDS function, and compared the amino acid sequences of these 22 DDS genes with 6 β-AS genes with known functions, performed homology modeling, molecular docking, etc., predicted the differential key amino acid residues related to DDS and β-AS catalysis, and determined the mutation of key amino acids through site-directed mutagenesis of β-AS (PgOSCPNY1) so that β-AS completes the function of catalyzing the generation of dammarenediol (Dammarenediol II, DM-II).

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] In the early stage of the present invention, 22 genes with DDS function were characterized, and the amino acid sequence of these 22 DDS genes and 6 β-AS genes with known functions were compared, homology modeling, molecular docking and other technologies were used to predict the key amino acid residues related to DDS and β-AS and catalysis, and the mutation of certain key amino acids was determined by site-directed mutagenesis of β-AS (PgOSCPNY1) to enable β-AS to complete the conversion of DDS catalytic function. It was revealed that the change of β-AS gene nucleotide sequence after the whole genome duplication event triggered the change of its amino acid sequence, thereby changing the catalytic function of the protein and generating a new function of DDS. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The functional characterization and sequence analysis of 22 OSCs genes with DDS function; A is the HPLC graph of the functional characterization of 22 OSCs genes with DDS function; B is the phylogenetic tree of OSCs; C is the sequence comparison analysis of 22 DDS and 6 β-AS;

[0025] Figure 2 Molecular docking diagram of the OSCs protein model docking with 2,3-oxidosqualene;

[0026] Figure 3 The amino acid residues of 28 models were analyzed and aligned;

[0027] Figure 4Figure 2 is a graph showing the detection of dammarenediol content in wild-type and mutant PgOSCPNY1; (a) is the detection of dammarenediol content by HPLC; (b)-(g) are dammarenediol standard and wild-type PgOSCPNY1, PgOSCPNY1 6M 、PgOSCPNY1 4M 、PgOSCPNY1 2M 、PgOSCPNY1 M240L GC-MS chart of the corresponding dammarene diol (trimethylsilane derivative). DETAILED DESCRIPTION

[0028] The present invention is further described in detail below in conjunction with embodiments.

[0029] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0030] 1 Materials and methods

[0031] 1.1 Source of OSC DNA sequence and cDNA synthesis

[0032] The DNA sequences of OSC were downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov / ), including PgPNA (AB265170.1), PnDS (KC422652.1), AaOSC2 (KF309252.1), CaDDS-like XM_027232213.1), CaOSCCAS(AY520818.1), CcDDS-like(XM_025137525.1), CrAS(JQ027033.1), EgDDS-like(XM_012985994.1) , EgDDS-like-X1(XM_012986775.1), HaDDS(XM_022179441.1), LsDDS-like(XM_023877103.1), ObOSC2(JQ809437.1), OeDDS-li ke(XM_023036651.1), Ofβ-As(KY992862.1), SiDDS-like(XM_011098260.2), TcOSC1(MK351896.1), TkOSC3(MG646378.1), PgOSCPNY1(AB009030), EtAS(AB206469), Gsβ-As1(FJ790411), Gsβ-As2(KJ467352), ObasOSC1(KF636411), TwOSC2(KY885468) and transcriptome sequencing

[0033] CpDDS1 (Cpi03G005455.t1, SEQ ID NO.76), CpDDS2 (Cpi03G005543.t1, SEQ ID NO.77), CpDDS3 (Cpi03G005530.t1, SEQ ID NO.78), EsDDS1 (Ese18G000975.t1, SEQ ID NO.79), EsDDS2 (Ese18G000970, SEQ ID NO.80). OSC gene was synthesized by Universe Gene Technology (Tianjin) Co., Ltd. (The above sequences are all OSC, DDS and β-AS are all subfamily genes of OSC)

[0034] 1.2 Protein characteristics and sequence analysis

[0035] Online calculation of the molecular mass (kDa) and isoelectric point (pI) of OSCs (the 22 DDS and 6 β-AS sequences mentioned above)

[0036] (http: / / www.detaibio.com / sms2 / protein_mw.html). DNAMA software was used to compare the protein sequences of the above 28 OSCs, and Excel worksheets were used to draw graphs and beautify the images.

[0037] 1.3 Phylogenetic analysis of protein sequences

[0038] The maximum likelihood (ML) phylogenetic tree was constructed using MEGA11 software. The confidence values ​​of individual branches were determined by performing 1000 bootstrap replicates on the original sequence data.

[0039] 1.4 Cloning of OSCs and construction of expression vectors

[0040] (1) PCR was performed using gene-specific primers to amplify cDNA of full-length OSCs (PgPNA, PnDS, AaOSC2, CaDDS-like, CaOSCCAS, CcDDS-like, CpDDS1, CpDDS2, CpDDS3, CrAS, EgDDS-like, EgDDS-like-X1, EsDDS1, EsDDS2, HaDDS, LsDDS-like, ObOSC2, OeDDS-like, Ofβ-As, SiDDS-like, TcOSC1, TkOSC3, PgOSCPNY1). The reaction system was prepared according to the instructions of Phanta-Max Super-Fidelity DNA Polymerase.

[0041] The primers used in the PCR reaction are shown in Table 1, and the PCR reaction system is shown in Table 2. The PCR reaction program is: 95°C pre-denaturation for 180s; 95°C denaturation for 15s, 60°C annealing for 15s, 72°C extension for 100s, a total of 35 cycles; 72°C extension for 300s, 4°C+∞.

[0042] Table 1

[0043]

[0044]

[0045] Table 2

[0046] Reagents Volume (μL) Phanta 12.5 Forward primer (10uM) 1.0 Reverse primer (10uM) 1.0 Each OSC gene cDNA (100-200ng / uL) 2.0 <![CDATA[ddH2O]]> 8.5 Overall system 25.0

[0047] Note: The reaction system was prepared according to the instructions of Phanta-Max Super-Fidelity DNA Polymerase. Phanta is the reagent in Novozymes high-fidelity PCR Phanta-Max Super-Fidelity DNA Polymerase.

[0048] (2) The target gene primers are designed with a pYES2 connection site sequence (homologous arm) to facilitate homologous recombination between the target gene and the vector.

[0049] (3) constructing expression vector primers to amplify the target gene containing the vector homology arms, and cutting and recovering the PCR product;

[0050] (4) Digest the yeast expression vector pYES2 with BamHI and recover the product to obtain the linearized vector pYES2. The enzyme digestion system is shown in Table 3. The enzyme digestion reaction conditions are: 37°C for 1h, 65°C for 15min, and 10°C+∞.

[0051] Table 3

[0052] Reagents Volume (μL) BamHI restriction endonuclease 0.5 pYES2 plasmid 10.0 CutSmart buffer (*10) 2.0 <![CDATA[ddH2O]]> 7.5 Overall system 20.0

[0053] (4) Use Seamless Cloning and Assembly Kit recombines the vector and target gene fragment to obtain the recombinant plasmid pYES2-OSC. The recombination system is:

[0054] 0.7 μL linearized vector pYES2, 2.3 μL target gene, 3 μL 2×SDMM (homologous recombination enzyme).

[0055] The recombination reaction procedure was 50°C for 20 min, 10°C+∞.

[0056] (5) The recombinant plasmid pYES2-OSC was transformed into DH5a competent E. coli and cultured on LB solid plates containing 100 mg / L Amp (Table 4) at 37°C overnight. The specific method is as follows:

[0057] (5.1) Take 10 μL of the recombinant plasmid pYES2-OSC and add it to 50 μL of E. coli competent cells and mix thoroughly (carefully pipette with a pipette). Place the mixture on an ice box (to maintain the competent state of E. coli and facilitate the entry of the plasmid into E. coli) for 30 minutes.

[0058] (5.2) After heat shock at 42°C for 90 seconds, remove from the tube and place in an ice bath for 2 to 5 minutes.

[0059] (5.3) Add 450 μL of antibiotic-free LB medium and place in a shaking incubator at 37°C and 220 rpm for 50 min.

[0060] (5.4) After 50 min, take 100 μL of bacterial solution and spread it on LB solid medium containing 100 mg / L Amp. Incubate in a constant temperature incubator at 37°C for 8-12 h.

[0061] (5.5) When a single colony is observed to grow, perform bacterial picking and shaking (add 500 μL of LB medium containing 100 mg / L Amp to a 2 mL centrifuge tube) and shake the bacterial suspension at 220 r / min at 37°C. Bacterial picking means taking the plate with a single colony to a sterile operating table, using a special bacterial picking device to pick a single colony and put it into a centrifuge tube containing LB medium containing 100 mg / L Amp, sealing the tube, and taking it out to a shaker to shake the bacteria until the bacterial solution becomes turbid.

[0062] (6) Select a monoclonal colony for PCR. The primers used in PCR are shown in Table 5. The reaction system is shown in Table 6. The reaction procedure is as follows: pre-denaturation at 95°C for 300 s; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 100 s, for a total of 35 cycles; extension at 72°C for another 300 s, and 4°C +∞.

[0063] Table 4

[0064] Reagents volume Tryptone 10g Yeast Extract 5g NaCl 10g Solid plus agar powder 20g / L

[0065] Table 5

[0066] Primer number Primer sequences SEQ ID No. Detection of PY-F ggagaaaaaaccccggatcggactactagcag 57 Detection of PY-R aagcgtgacataactaattacatgatgcggccctc 58

[0067] Table 6

[0068] Reagents Volume (μL) 2×FastTaq Premix 12.5 Detection of PY-F (10uL) 1.0 Detection of PY-R (10uL) 1.0 Bacterial liquid 2.0 <![CDATA[ddH2O]]> 8.5 Overall system 25.0

[0069] After the PCR reaction program is completed, take 5uL of PCR product for agarose gel electrophoresis, the electrophoresis program is 185V, 180mA, 20min. Take out the run gel and put it into the gel imager for observation. If there is a clear band in the range of 2000-3000bp, it is a sequencing-positive bacterium, which is used for sequencing to detect the authenticity of the target gene transferred into Escherichia coli cells.

[0070] 1.5 Molecular docking

[0071] AlphaFold2 provides a stable computational method that can regularly predict protein structures. This method can predict protein structures accurate to the atomic level even when no similar structures are known (Jumper et al., 2021). AlphaFold2 was used to model the protein structures of 22 DDS (dammarenediol synthase) and 6 β-AS (β-amyrinol synthase). The models were evaluated online (https: / / swissmodel.expasy.org / qmean / ) to determine the quality of the 3D model in terms of stereochemistry. The quality of the model was evaluated using the Structural Assessment program (https: / / swissmodel.expasy.org / assess / ). The relationship between the energy advantage area of ​​the dihedral angle of the protein skeleton and the amino acid residues is intuitively displayed. The protein model of OSCs was docked with 2,3-oxidosqualene (2,3-oxidosqualene) using AutoDock4 (Morris et al., 2009). All molecular structures were visualized using PyMOL ( Figure 2 ).

[0072] 1.6 Site-directed mutagenesis of amino acid sites

[0073] Through sequence alignment analysis and molecular docking of 22 DDS and 6 β-AS, 27 key amino acid difference sites were found ( Figure 3 ), each predicted candidate amino acid residue of β-AS (PgOSCPNY1) was replaced with alanine (this one was selected because it was in the same genetic background as the reverse mutant DDS PgPNA gene in the same ginseng, and its key amino acid residues were consistent with the other five β-AS) to clarify the catalytic activity of these amino acid residues, and then these clear amino acid residues were mutated to the corresponding DDS (PgPNA) sites. Design mutation primers to perform PCR-based site-directed mutagenesis on the expression plasmid of PgOSCPNY1, the primers are shown in Table 7, and the reaction program is shown in Table 8.

[0074] Table 7

[0075]

[0076]

[0077] Table 8

[0078]

[0079] 1.7 Products extracted from BY4742 strain

[0080] The pYES2-OSCs expression plasmid was transformed into the BY4742 yeast expression strain by lithium acetate transformation.

[0081] Table 9

[0082] Reagents volume PEG4000 (50% aqueous solution) 240ul LiAC (1.0 mol / L) 36ul Salmon sperm DNA (2.0 mg / ml) 10ul pYES2-OSCs plasmid and water 74ul

[0083] Note: Add 400ng pYES2-OSCs plasmid and mix well.

[0084] In order to screen the BY4742 transformants of the pYES2-OSCs expression plasmid, a solid synthetic complete medium (SC-Ura) without uracil was used (see Table 10), and 2% glucose by mass was added to the medium. After culturing in a 30°C incubator for 4-5 days, a single colony was selected, and then the positive single colony was placed in a SC-Ura medium supplemented with 2% glucose by mass, and cultured at 30°C at a rotation speed of 220 rpm for 2 days.

[0085] Table 10

[0086] Reagents volume YNB (Inorganic Nitrogen Yeast Medium) 0.67%(6.7g / L) Threonine (Thr) 0.1g / L Lysine (Lys) 0.1g / L Cysteine ​​(Cys) 0.1g / L Tryptophan (Trp) 0.1g / L Arginine (Arg) 0.1g / L Leucine (Leu) 0.1g / L Valine (Val) 0.05g / L Tyrosine (Try) 0.05g / L Proline (Pro) 0.05g / L Serine (Ser) 0.05g / L Methionine (Met) 0.05g / L Isoleucine (Ile) 0.05g / L Aspartic acid (Asp) 0.05g / L Phenylalanine (Phe) 0.05g / L Histidine (His) 0.05g / L Adenine (Ade) 0.1g / L Liquid culture medium pH5.6 Solid culture medium pH 6.5 Agar (added to solid culture medium, not added to liquid culture medium) 20g / L

[0087] The yeast cells were collected and induced with 100 mL SC-Ura medium containing 2% galactose by mass, and cultured at 30° C. with shaking at 220 rpm for 5 days.

[0088] The cultured cells were resuspended in 0.1M potassium dihydrogen phosphate buffer (pH 7.0) containing 2% glucose by mass, and stirred at 220 rpm for 1 day at 30°C. After the yeast cells were collected, the lysate was prepared by ultrasonic extraction with analytical methanol for 1 hour. The ultrasonic crusher used for ultrasonic extraction had an output power of 500W and an operating frequency of 20KHz.

[0089] The lysed yeast solution was centrifuged at 3900 rpm for 20 min, and the supernatant was extracted three times with n-hexane. The three n-hexane extraction solutions were combined and evaporated by rotary evaporation at 50°C.

[0090] The evaporated solid extract was dissolved in 200 ml of analytical methanol solution. The obtained sample was filtered through a 0.22 mm organic phase filter membrane and detected by Agilent 1260 high performance liquid chromatograph. The elution program of HPLC is shown in Table 9. HPLC was identified using an Agilent Zorbax Eclipse XDB-C18 column (4.6×250 mm, 5 μm; Agilent Technologies, Santa Clara, CA, USA).

[0091] Table 11

[0092]

[0093] 2 Results

[0094] 2.1 Functional characterization of 22 DDS genes

[0095] The successfully recombined plasmid pYES2-OSCs (PgPNA, PnDS, AaOSC2, CaDDS-like, CaOSCCAS, CcDDS-like, CpDDS1, CpDDS2, CpDDS3, CrAS, EgDDS-like, EgDDS-like-X1, EsDDS1, EsDDS2, HaDDS, LsDDS-like, ObOSC2, OeDDS-like, Ofβ-As, SiDDS-like, TcOSC1, TkOSC3) was transformed into the BY4742 strain and the products were extracted after fermentation. The products were then detected by LC-MS.

[0096] Liquid chromatography-mass spectrometry (LC-MS) used an Agilent 1290 Infinity II system equipped with a 1290 Quad pump, a 1290 Viasampler autosampler, a 1290 MCT column oven, a diode array detector G1314A VWD (210 nm UV), and an API-ES mass spectrometer. The system was controlled by a 6125B controller, and the results were calculated using Agilent LC-MS Solution software. The mass spectrometry analysis conditions were: positive ion mode, voltage: 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency voltage: 750 V; scan range: 100-1000 m / z; scan mode: SRM. The analytical conditions were described in a previous study. The chromatographic column was an Agilent Zorbax Eclipse XDB-C18, and the mobile phases were pure water (a) and acetonitrile (B) (Table 9). The cation analysis of DDS fermentation product DM-II by LC-MS revealed an M / Z of 445 [M+H] + 、467[M+Na] + 、483[M+K] + 、427[M-H2O+H] + 、409[M-2H2O+H] + ( Figure 4 ). The results showed that these 22 OSC enzyme genes have the function of expressing enzymes that catalyze the formation of dammarenediol-II ( Figure 1 A).

[0097] 2.2 Phylogenetic tree analysis of 22 DDS genes

[0098] During plant evolution, the molecular origin and functional diversity of OSCs are also unclear. To further understand the evolutionary relationship between the 22 DDS genes, a phylogenetic tree of OSCs was constructed using MEGA11 software. Figure 1 As shown in B, all 22 enzyme genes with DDS function are clustered into the functional branch of DDS, and this result is consistent with our functional characterization.

[0099] 2.3 Protein sequence alignment

[0100] Sequence alignment analysis of 22 DDS and 6 β-AS revealed that there were 7 different key amino acid residues between DDS and β-AS near the conserved domains QXXXXXW, MWCYCR, DCTAE and C-terminus of these 28 OSCs (PgOSCPNY1 L128 、PgOSCPNY1 V376 、PgOSCPNY1 Q483 、PgOSCPNY1 G491 、PgOSCPNY1 H561 、PgOSCPNY1 F613 、PgOSCPNY1 E740 )( Figure 1 C).

[0101] 2.4 Molecular docking results

[0102] In order to determine the key amino acid substitutions in the 22 DDS and 6 β-AS that affect the cyclization reaction and lead to differences in enzyme activity, the 22 DDS and 6 β-AS models were then constructed using AlphaFold2. Therefore, the first step of our study was to perform computer modeling and molecular docking analysis (docking enzymes to key amino acids related to substrate binding and catalysis). Figure 2 ) It is known that the same amino acid residues after DDS and 2,3-oxidized squalene molecules are docked, taking PgPNA as an example: 242L, 243P, 245E, 246F, 253F, 260M, 268Y, 550L, 552P (242L: the 242nd amino acid in the amino acid sequence of PgPNA is leucine, and the amino acid abbreviations are shown in Table 14); the same amino acid residues after β-AS and 2,3-oxidized squalene molecules are docked, taking PgOSCPNY1 as an example: 240M, 241P, 243E, 266Y, 326W, 547L, 549P; the different amino acid residue sites after 2,3-oxidized squalene and DDS and β-AS molecules are docked: DDS, 242L (PgPNA) and β-AS, 240M (PgOSCPNY1) (mutation sites are shown in Table 12, and mutant numbers are shown in Table 13).

[0103] Table 12

[0104]

[0105] Note: L128T: leucine at position 128 mutated to threonine; M240L: methionine at position 240 mutated to leucine; L251F: leucine at position 251 mutated to phenylalanine; M253F: methionine at position 253 mutated to phenylalanine; L325V: leucine at position 325 mutated to valine; V375A: valine at position 375 mutated to alanine; Q483V: glutamine at position 483 mutated to valine; G491A: glycine at position 491 mutated to alanine.

[0106] Table 13

[0107] Mutant number Mutant site <![CDATA[PgOSCPNY1 1M ]]> <![CDATA[PgOSCPNY1 M240L ]]> <![CDATA[PgOSCPNY1 2M ]]> <![CDATA[PgOSCPNY1 M240L+Q483V ]]> <![CDATA[PgOSCPNY1 4M ]]> <![CDATA[PgOSCPNY1 M240L+L251F+M253F+Q483V ]]> <![CDATA[PgOSCPNY1 6M ]]> <![CDATA[PgOSCPNY1 M240L+L251F+M253F+L325V+Q483V+G491A ]]> <![CDATA[PgOSCPNY1 8M ]]> <![CDATA[PgOSCPNY1 L128T+M240L+L251F+M253F+L325V+V375S+Q483V+G491A ]]>

[0108] Note:PgOSCPNY1 2M Indicates iterative mutation of 2 sites, PgOSCPNY1 4M Indicates iterative mutation of 4 sites, PgOSCPNY1 6M Indicates iterative mutation of 6 sites, PgOSCPNY1 8M Indicates iterative mutation of 8 sites. (See Figure 4 a)

[0109] Table 14

[0110] Chinese name English name abbreviation symbol Molecular weight type Alanine Alanine Ala A 89.079 Fatty Acids Arginine Arginine Arg R 174.188 Basic amino acids Asparagine Asparagine Asn N 132.104 Amides Aspartic acid Aspartic acid Asp D 133.089 Acidic amino acids Cysteine Cysteine Cys C 121.145 Sulfur-containing Glutamine Glutamine Gln Q 146.131 Amides Glutamate Glutamic acid Glu E 147.116 Acidic amino acids Glycine Glycine Gly] G 75.052 Fatty Acids Histidine Histidine His H 155.141 Basic amino acids Isoleucine Isoleucine Ile I 131.16 Fatty Acids Leucine Leucine Leu L 131.16 Fatty Acids Lysine Lysine Lys K 146.17 Basic amino acids Methionine Methionine Met M 149.199 Sulfur Phenylalanine Phenylalanine Phe F 165.177 Aromatic Proline Proline Pro P 115.117 Imino acid Serine Serine Ser S 105.078 Hydroxyl Threonine Threonine Thr T 119.105 Hydroxyl Tryptophan Tryptophan Trp W 204.213 Aromatic Tyrosine Tyrosine Tyr Y 181.176 Aromatic Valine Valine Val V 117.133 Fatty Acids

[0111] 2.5 Directed mutagenesis results

[0112] The differential sites analyzed by sequence alignment and molecular docking were subjected to site-directed mutagenesis, and the results are as follows ( Figure 4 , Table 15):

[0113] Table 15 mutant product content

[0114] Mutant number Substrate product <![CDATA[Content (mg·L -l )]]> <![CDATA[PgOSCPNY1 1M ]]> 2,3-oxidosequbalene Dammarenediol-II 28.8917 <![CDATA[PgOSCPNY1 2M ]]> 2,3-oxidosequbalene Dammarenediol-II 0.115 <![CDATA[PgOSCPNY1 4M ]]> 2,3-oxidosequbalene Dammarenediol-II 0.2876 <![CDATA[PgOSCPNY1 6M ]]> 2,3-oxidosequbalene Dammarenediol-II 2.6912 <![CDATA[PgOSCPNY1 8M ]]> 2,3-oxidosequbalene Dammarenediol-II 4.6314 <![CDATA[PgOSCPNY1 1M ]]> 2,3-oxidosequbalene Dammarenediol-II 13.4208

[0115] The results showed that the key residue mutation motifs for the evolution of β-ASs to DDS had not been reported before this study. Triterpenoid saponins based on the DM-II skeleton have important pharmacological activities. Our results show that mutation design can manipulate the specific cyclization process of the product to improve the selectivity of new triterpenoid compounds. At the same time, this mutation experiment also explains the source of the difference in catalytic function between DDS and β-AS.

[0116] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A β-amyrin synthase mutant, characterized in that: The β-amyrin synthase mutant undergoes the following amino acid mutations in the sequence shown in SEQ ID NO.75: M240L, and keep the other amino acid sequences unchanged; Alternatively, M240L, Q483V, and keeping the rest of the amino acid sequence unchanged; Alternatively, M240L, L251F, M253F, Q483V, while keeping the other amino acid sequences unchanged; Alternatively, M240L, L251F, M253F, L325V, Q483V, G491A, while keeping the other amino acid sequences unchanged; Alternatively, L128T, M240L, L251F, M253F, L325V, V375S, Q483V, G491A, and keep the other amino acid sequences unchanged.

2. An isolated polynucleotide, characterized in that The polynucleotide encodes the β-amyrinol synthase mutant according to claim 1.

3. A carrier, characterized in that The vector contains the polynucleotide according to claim 2.

4. A host cell, characterized in that The host cell contains the vector as claimed in claim 3, or the polynucleotide as claimed in claim 2 is integrated into its genome.

5. A method for producing the β-amyrinol synthase mutant according to claim 1, characterized in that: The method comprises the steps of: culturing the host cell according to claim 6 under suitable conditions to express the β-amyrinol synthase mutant; and / or isolating the β-amyrinol synthase mutant.

6. Use of a β-amyrin synthase mutant in the preparation of dammarenediol, characterized in that: The beta-amyrin synthase mutant is used for catalyzing 2,3-oxidized squalene to generate dammarenediol.

7. A method for preparing dammarene diol, characterized in that: The method comprises the following steps: contacting the beta-amyrin synthase mutant of claim 1 with a reaction substrate 2,3-squalene oxide to carry out a catalytic reaction, thereby obtaining dammarenediol.

8. The method for preparing dammarene diol according to claim 7, characterized in that: The catalytic reaction is specifically as follows: a β-amyrin synthase mutant is constructed on a pYES2 expression vector, transformed into BY4742 yeast cells for fermentation, and dammarenediol is obtained.

Images