Antisense oligonucleotide for adjuvant therapy of oral squamous cell carcinoma and application of antisense oligonucleotide

Abstract

The invention discloses antisense oligonucleotide for adjuvant therapy of oral squamous cell carcinoma and application of the antisense oligonucleotide. According to the invention, the rs737540 site and the mutant allele rs737540-T thereof are identified, so that the problem of lack of specific biomarkers and targeted therapy means in the prior art is solved. By designing the antisense oligonucleotide aiming at the rs737540 mutation site, selective splicing of TARDBP and EGFR exon 4 can be specifically blocked, and OSCC cell proliferation is inhibited. Besides, the EGFR targeted drug cetuximab is used in a combined manner, so that a stronger anti-cancer effect is realized, and the blank in the existing treatment means is filled. The core breakthrough of the technology is that genetic variation and targeted therapy are combined, and a new research thought and a clinical application prospect are provided for precise medicine of oral squamous cell carcinoma.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to antisense oligonucleotides for adjuvant treatment of oral squamous cell carcinoma and applications thereof. Background Art

[0002] Oral squamous cell carcinoma (OSCC) is one of the most common types of oral cancer, with a high prevalence worldwide, especially in high-risk groups such as smokers and alcoholics. Currently, the diagnosis and treatment of OSCC mainly rely on traditional histological testing, surgical resection, chemotherapy and radiotherapy. However, due to the high heterogeneity of cancer, the treatment effect is often limited, especially after the disease progresses to the late stage, the survival rate of patients is low. Therefore, the study of the molecular mechanism of OSCC, especially biomarkers and targeted therapies related to specific gene mutations, has become a hot area of ​​research and clinical practice.

[0003] Although some biomarkers such as EGFR and p53 have been widely studied and applied in the diagnosis and prognosis of OSCC, these markers have also been found in other types of cancer, and their specificity is poor, making it difficult to distinguish different cancer types or predict the specific mutation background of patients. In addition, existing targeted drugs (such as cetuximab) are mainly based on the widespread expression of pathways or receptors, and precise treatment plans are not designed in combination with the patient's specific mutation sites. In many OSCC patients, the complex individual differences in mutation background cannot be effectively covered, and the treatment effect is limited. The research on antisense oligonucleotide (ASO) technology in various genetic diseases and cancers has gradually increased, but the application of antisense oligonucleotides targeting specific mutation sites in OSCC is still lacking. Summary of the invention

[0004] The object of the present invention is to provide a substance for inhibiting the expression of the rs737540-T gene on chromosome 13q32.2 for use in the preparation of a drug for treating oral squamous cell carcinoma in view of the above-mentioned deficiencies in the prior art.

[0005] Another object of the present invention is to provide an antisense oligonucleotide targeting the rs737540-T mutation site.

[0006] Another object of the present invention is to provide a pharmaceutical composition comprising the antisense oligonucleotide.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] Application of the rs737540-T allele at the rs737540 locus on chromosome 13q32.2 as a pathogenic locus in screening drugs for the treatment of oral squamous cell carcinoma.

[0009] Use of a substance that inhibits the binding of rs737540-T and TARDBP described in claim 1 in the preparation of a drug for treating oral squamous cell carcinoma

[0010] As a preferred embodiment of the present invention, the substance that inhibits the binding of rs737540-T and TARDBP described in claim 1 is selected from antisense oligonucleotides targeting the genotype.

[0011] As a preferred embodiment of the present invention, the substance that inhibits the binding of rs737540-T to TARDBP described in claim 1 is selected from the antisense oligonucleotide against the rs737540-T mutation site shown in SEQ ID NO.1.

[0012] The antisense oligonucleotide targeting the rs737540-T mutation site is characterized in that the sequence is shown in SEQ ID NO.1.

[0013] A composition consists of an antisense oligonucleotide targeting the rs737540-T mutation site shown in SEQ ID NO.1 and an EGFR targeting drug.

[0014] As a preferred embodiment of the present invention, the EGFR targeted drug is cetuximab.

[0015] The invention relates to application of the composition in preparing medicine for treating oral squamous cell carcinoma.

[0016] A pharmaceutical composition comprising the antisense oligonucleotide or the composition described in the present invention.

[0017] As a preferred embodiment of the present invention, the pharmaceutical composition further contains pharmaceutical excipients for preparing the antisense oligonucleotide or the composition into a pharmaceutical preparation.

[0018] Beneficial effects:

[0019] (1) Highly specific therapeutic effect:

[0020] The ASO base sequence (CAUGAAGAAGAAGGACAUUC) of the present invention can specifically recognize and bind to the T allele of the rs737540 mutation site, and block its binding to the TARDBP protein. Through this highly specific molecular recognition, ASO effectively prevents the abnormal splicing of EGFR exon 4 mediated by TARDBP, thereby reducing the activation of the EGFR signaling pathway and inhibiting the proliferation of OSCC cells. Compared with existing nonspecific treatment methods, the present invention provides a more targeted treatment scheme that can significantly reduce the risk of accidentally injuring normal cells.

[0021] (2) Higher sensitivity:

[0022] The ASO of the present invention can sensitively respond to changes in the rs737540 mutation site and perform targeted intervention on specific mutant oral squamous cell carcinoma cells. Through in vitro cell experiment detection, the abnormal splicing phenomenon of EGFR exon 4 in the ASO treatment group was significantly reduced.

[0023] 3. Treatment accuracy is significantly improved:

[0024] Through the combined use of antisense oligonucleotides and cetuximab, the present invention can effectively prevent the overactivation of the EGFR pathway while blocking the TARDBP and EGFR splicing pathways. This combined treatment regimen significantly improves the accuracy of treatment and can more accurately combat OSCC patients carrying the rs737540 mutation. In in vitro and in vivo experiments, the tumor cell proliferation rate in the combined treatment group was significantly reduced, showing a stronger effect of inhibiting tumor growth.

[0025] 4. Reduced drug resistance and side effects:

[0026] As an EGFR targeted drug, cetuximab is prone to drug resistance when used alone, while the ASO of the present invention reduces the drug resistance of cancer cells to EGFR monotherapy by regulating the upstream regulatory mechanism of EGFR selective splicing. In addition, combined use can reduce the dosage of cetuximab, reduce drug-related side effects such as skin reactions and gastrointestinal adverse reactions, and improve patients' treatment tolerance and quality of life.

[0027] The present invention significantly improves the therapeutic effect of oral squamous cell carcinoma by targeting the rs737540 mutation site and combining it with EGFR targeted therapeutic drugs. In terms of high specificity, sensitivity and treatment accuracy, this technical solution is superior to the existing technology and significantly reduces drug resistance and drug side effects. This innovative treatment strategy provides a more effective treatment option for patients with oral squamous cell carcinoma, especially those carrying the rs737540-T mutation, and has broad clinical application prospects.

[0028] Figures and Description

[0029] Figure 1 : Expression of epidermal growth factor receptor in patients with different rs737540 genotypes.

[0030] Figure 2 : EGFR-001 expression in patients with different rs737540 genotypes.

[0031] Figure 3 :Western blotting analysis showed that antisense oligonucleotides inhibited the binding of TARDBP to RNA.

[0032] Figure 4: Inhibitory effects of different concentrations of antisense oligonucleotides and cetuximab on oral squamous cell carcinoma cells.

[0033] Figure 5 : The efficacy of antisense oligonucleotide combined with cetuximab is better than that of cetuximab or antisense oligonucleotide alone.

[0034] Figure 6 : The combined effect of different concentrations of cetuximab and antisense oligonucleotides.

[0035] Figure 7 :RNA pull down results showed the binding efficiency between rs737540-T and TARDBP at different concentrations of antisense oligonucleotides.

[0036] Figure 8 : The therapeutic effect of combined drug therapy on tumor formation in nude mice. DETAILED DESCRIPTION

[0037] Example 1

[0038] Experimental methods:

[0039] First, based on transcriptome sequencing of normal oral mucosal tissue and GSA genotyping data of the sample population, sQTLs were screened by bioinformatics methods and multiple test corrections were performed. We conducted GWAS analysis in the Chinese population and used logistic regression analysis to evaluate the association between sQTLs and OSCC risk. For the selected target genetic variant sites, the Ensembl database (GRCh 37) and minegene experiments were analyzed to explore the way in which the sites regulate alternative splicing, and the POSTAR 3 database was used to screen potentially affected RNA binding proteins.

[0040] Experimental results:

[0041] Among all the sQTLs detected, only 5314 sQTLs reached the significance threshold of P value < 0.01, accounting for only 0.36% of the total 315 sQTLs. 2 <0.8, we found that rs737540 located on chromosome 13q32.2 was the most significant risk locus associated with OSCC (OR = 1.2, P = 6.84 × 10 -4 ), which is also the OSCC risk locus where EGFR is located on the chromosome. When conducting association analysis with EGFR, we found that rs737540 did not show an eQTL effect (P eQTL =0.177), but rather had independent sQTL effects ( Figure 1). Through eQTL analysis of EGFR transcripts, we found that the rs737540-T allele significantly upregulated the expression of EGFR-001 compared with the rs737540-C allele ( Figure 2 ). Specifically, rs737540 is an intronic variant located between exon 4 and exon 5 of EGFR.

[0042] We observed that EGFR-004 lacks exons compared to EGFR-001. This led us to hypothesize that rs737540 regulates exon 4 skipping, thereby modulating alternative splicing of EGFR and affecting the expression of splice isoforms. To gain insight into the allele-specific activity of rs737540, we utilized the POSTAR 3 database, which revealed that TARDBP selectively binds to the rs737540 sequence.

[0043] Therefore, we concluded that rs737540-T could increase the proliferation and susceptibility risk of oral squamous cell carcinoma by promoting TARDBP-mediated alternative splicing of EGFR exon 4 in oral squamous cell carcinoma.

[0044] Example 2

[0045] To explore the drug targeting effect of rs737540-T, we designed an antisense oligonucleotide (base sequence: CAUGAAGAAGAAGGACAUUC) that overlaps with its position, and co-cultured CAL 27 cells overexpressing rs737540-T with 40μl / mol antisense oligonucleotide. To find the optimal concentration of antisense oligonucleotides for oral squamous cell carcinoma cells, we tested the drug resistance of HN 6 and CAL 27 cells with 5 different concentrations of antisense oligonucleotides by CCK8 assay. We also explored the effect of antisense oligonucleotides combined with cetuximab on the growth of OSCC cells. To further explore the difference in the effects of different concentrations of drugs, 5 different concentrations of cetuximab and 5 different concentrations of antisense oligonucleotides were combined for OSCC cells. We also conducted animal experiments, in which CAL27 cells overexpressing rs737540-T were inoculated into the axilla of BALB / c nude mice, and antisense oligonucleotides, cetuximab and combined drug treatment were received every three days to compare the drug effects.

[0046] Experimental Results

[0047] RNA pull-down assay showed that antisense oligonucleotides inhibited the binding of TARDBP to rs737540-T ( Figure 3). After 24 hours of adding antisense oligonucleotide, it was found that when its concentration was 20μl / mol, the inhibitory effect on OSCC cell growth was the strongest. When the concentration of cetuximab was 100μg / ml, the growth of OSCC cells was most inhibited ( Figure 4 ). Experiments have shown that at any concentration, the effect of cetuximab combined with antisense oligonucleotides is better than that of cetuximab or antisense oligonucleotides alone ( Figure 5 ), when the concentration of antisense oligonucleotide was 20μg / ml and the concentration of cetuximab was 100μl / mol, the inhibitory effect on OSCC cells was the most obvious ( Figure 6 ). The results showed that 20μg / ml antisense oligonucleotides had a synergistic effect when combined with 100μl / mol cetuximab, and had the greatest inhibitory effect on OSCC cell proliferation. RNA pull-down experiments also confirmed the worst binding effect of TARDBP under 20μl / mol antisense oligonucleotides ( Figure 7 ). The results of animal experiments showed that the combined drug group had the best tumor inhibition effect. ( Figure 8 )

[0048] Specific methods:

[0049] Overexpression plasmid transfection

[0050] All plasmids required for this experiment were synthesized by Shanghai GeneCare Gene: rs737540 (C / T) overexpression plasmid. Transfection kit, pipette, pipette tip, centrifuge tube and other routine laboratory supplies for cell culture. The day before transfection, inoculate cells in a 6-well plate, add 2 ml of serum-containing medium, and transfect cells at a density of 60-80%. Dilute 2 μg of the required plasmid in 200 μl buffer, vortex for 10 seconds and centrifuge. Add 4 μl reagent (DNA / reagent ratio 1:2), vortex for 1 second, centrifuge and incubate at room temperature for 10 minutes. Add the transfection mixture to the cells in serum-containing medium and incubate for 24 to 48 hours.

[0051] CCK-8 assay

[0052] The cells were inoculated in a 96-well plate (about 3,000 cells / well), 100 μl of culture medium was added to each well, and 5 replicates were set up for each group. After the cells adhered to the wall, different concentrations of drugs were added and co-cultured for 24 hours, and 10 μl of CCK-8 solution (Cell Counting Kit-8, CCK-8) was added to each well and shaken. After 2-4 hours of reaction, the absorbance value at a wavelength of 450 nm was detected using a multifunctional microplate reader, and the result curve was drawn.

[0053] RNA pull-down assay

[0054] RNA Pull-down Experiment Using PureBinding TM RNA-protein pull-down kit (GENESEED, China). First, a biotinylated fragment containing 1001 bp at the rs737540 locus was synthesized. Then, up to 50 pmol of biotinylated RNA was incubated with cell protein extracts from CAL27 and HN6 cells and 50 μL of streptavidin magnetic beads. The RNAPull-down beads bound to proteins were washed three times with washing buffer. 50 μL of capture buffer and loading buffer were added and reacted at 100°C for 10 min for protein capture. The samples were stored at -80°C for immunoblotting.

[0055] Nude mouse tumor formation experiment with combined drug administration

[0056] 1×10 7 / ml CAL27 cells were injected into the armpits of nude mice at 200ml / mouse, and the tumor formation was observed every day. On the 20th day, they were divided into four groups: control group, cetuximab group, antisense oligonucleotide group, and cetuximab + antisense oligonucleotide group. Drug injections were performed every three days until the nude mice were killed on the 40th day and the tumors were removed for observation and comparison.

Claims

1. Application of the rs737540-T allele at the rs737540 locus on chromosome 13q32.2 as a pathogenic locus in screening drugs for the treatment of oral squamous cell carcinoma.

2. Use of a substance that inhibits the binding of rs737540-T described in claim 1 to TARDBP in the preparation of a drug for treating oral squamous cell carcinoma.

3. The use according to claim 2, characterized in that The substance that inhibits the binding of rs737540-T and TARDBP in claim 1 is selected from antisense oligonucleotides targeting the genotype.

4. The use according to claim 2, characterized in that The substance that inhibits the binding of rs737540-T to TARDBP in claim 1 is selected from the antisense oligonucleotide targeting the rs737540-T mutation site shown in SEQ ID NO.

1.

5. An antisense oligonucleotide targeting the rs737540-T mutation site, characterized in that, The sequence is shown as SEQ ID NO.

1.

6. A composition characterized in that The method is composed of an antisense oligonucleotide targeting the rs737540-T mutation site shown in SEQ ID NO.1 and an EGFR targeting drug.

7. The composition according to claim 6, characterized in that The EGFR targeted drug is cetuximab.

8. Use of the composition according to claim 6 or 7 in the preparation of a medicament for treating oral squamous cell carcinoma.

9. A pharmaceutical composition, characterized in that Containing the antisense oligonucleotide according to claim 5, or the composition according to claim 6 or 7.

10. The pharmaceutical composition according to claim 9, characterized in that The pharmaceutical composition further contains pharmaceutical excipients for preparing the antisense oligonucleotide according to claim 5 or the composition according to claim 6 or 7 into a pharmaceutical preparation.

Images