Method for performing gene targeting in cephalosporium acremonium based on CRISPR-Cas9 gene editing system and application

Abstract

The invention relates to a method for carrying out gene targeting on cephalosporium acremonium based on a CRISPR-Cas9 gene editing system and application. According to the method, cephalosporium acremonium is taken as a starting strain, a ku70 gene is knocked out to improve the homologous recombination probability of exogenous DNA of the strain, and meanwhile, a Cas9 nuclease coding sequence is integrated into a cephalosporium acremonium genome to obtain the recombinant cephalosporium acremonium engineering strain with high homologous recombination efficiency. And further transforming and recombining the cephalosporium acremonium engineering bacteria to perform gene targeting on the target gene DNA by constructing a recombinant vector containing homologous arms on two sides of the gene targeting target DNA sequence, an sgRNA expression box and a resistance selection marker. An efficient cephalosporium acremonium gene targeting platform is constructed, single-gene gene knockout with the homologous recombination efficiency exceeding 90% and deletion of genome large fragments exceeding 30 kb are achieved, and basic support is provided for genetic modification in cephalosporium acremonium.

Description

Technical Field

[0001] The present invention relates to a method and application of gene targeting in Cephalosporium acremonium based on a CRISPR-Cas9 gene editing system, and belongs to the technical field of genetic engineering. Background Art

[0002] Cephalosporin C is an important precursor of cephalosporin antibiotics widely used in clinical practice. Its advantages include strong stability, broad-spectrum resistance and low toxicity. Cephalosporin C is an important industrial microorganism, famous for its production of cephalosporin antibiotics. At present, cephalosporin C in the pharmaceutical industry is produced by fermentation of the filamentous fungus Acremonium chrysogenum. At present, the synthetic regulation mechanism of high yield of cephalosporin C in Acremonium chrysogenum has not been analyzed, which has become a bottleneck for genetic engineering of strains. Unlike the model fungus Aspergillus nidulans and other filamentous fungi that have been studied more, Acremonium chrysogenum lacks a complete genetic manipulation system. The application of gene targeting methods such as gene site knock-in, gene replacement, gene knockout and promoter replacement to conduct modern molecular genetic research on Acremonium chrysogenum strains needs further development and optimization. In view of the market prospects of cephalosporin antibiotics, it is of great significance and great development potential to transform Cephalosporium acremonium strains through synthetic biology technologies such as metabolic engineering, analyze the synthetic regulation mechanism of cephalosporin C, further improve the fermentation production level of cephalosporin C, and reduce production costs.

[0003] In filamentous fungi, gene targeting causes double-strand breaks in DNA, and the repair of double-strand breaks in DNA mainly relies on the non-homologous end joining pathway (NHEJ), which results in the integration of exogenous DNA into the genome of filamentous fungi mainly in the form of random insertion, while the efficiency of homologous recombination is very low. Studies have shown that knocking out the Ku70 gene can block some NHEJ, significantly increase the probability of exogenous DNA integrating into the genome in the form of homologous recombination, and achieve efficient gene targeting.

[0004] As an efficient gene editing tool, the CRISPR-Cas9 system has been widely used in genome editing of various microorganisms. At present, precise gene manipulation has been successfully achieved in industrial filamentous fungi such as Penicillium chrysogenum, Aspergillus nidulans and Aspergillus oryzae, while research in industrial fungi such as Cephalosporium acremonium is currently progressing slowly. With the rapid development of genome editing technology, it is urgent to construct a CRISPR-Cas9 system to carry out more efficient gene targeting of Cephalosporium acremonium and realize a variety of genetic modification strategies. The development of gene editing systems will also provide new possibilities for further directed modification of Cephalosporium acremonium species and improving the production efficiency of cephalosporin C. Therefore, it is particularly urgent to establish an efficient gene editing system in industrial strains of Cephalosporium acremonium and use gene editing methods to perform efficient gene targeting and other strain genetic engineering modifications. Summary of the invention

[0005] In order to solve the technical problem that the homologous recombination ability of Cephalosporium acremonium is low, resulting in limited application of gene targeting technology in the field of genetic modification of Cephalosporium acremonium, the present invention provides a method and application of gene targeting in Cephalosporium acremonium based on CRISPR-Cas9 gene editing system.

[0006] The object of the present invention is to provide a gene editing system based on CRISPR-Cas9 technology suitable for industrial strains of Cephalosporium acremonium, wherein the system includes a Cas9 gene operably connected to a promoter Pactin, a functional sgRNA gene including a targeting sequence operably connected to a constitutive 5S ribosomal RNA gene promoter P5S, and a screening marker gene operably connected to a promoter PtrpC, such as a hygromycin phosphotransferase gene hph, and TtrpC1 and TtrpC2 as terminators of Cas9 and the screening marker gene, respectively. The plasmid backbone is a random integration plasmid in a filamentous fungus, such as pHyg, and the Cas9 nuclease encoding gene is integrated into the genome of Cephalosporium acremonium through the random integration plasmid of the filamentous fungus. The donor DNA plasmid of the system is based on the plasmid pUC19 vector as the skeleton, including a 500-1500bp homology arm of the upstream gene sequence of the gene targeting target gene, a screening marker resistance gene expression cassette, such as an expression cassette of the glufosinate resistance gene bar, and a 500-1500bp homology arm of the downstream gene sequence of the gene targeting target gene.

[0007] In one embodiment, the screening marker gene is the hygromycin phosphotransferase gene hph, the sequence of the promoter Pactin that initiates Cas9 expression is shown in SEQ ID NO.1; the sequence of Cas9 is shown in SEQ ID NO.2; the sequence of the constitutive 5S ribosomal RNA gene promoter P5S is shown in SEQ ID NO.3; the sgRNA sequence including the targeting sequence designed for the edited target gene is shown in SEQ ID NO.4; the sequence of the promoter PtrpC is shown in SEQ ID NO.5; the sequence of the hygromycin phosphotransferase hph gene is shown in SEQ ID NO.6; the sequence of the terminator TtrpC1 is shown in SEQ ID NO.7; the sequence of the terminator TtrpC2 is shown in SEQ ID NO.8.

[0008] 2. The purpose of the present invention is also to provide a method for constructing a recombinant cephalosporium engineered bacterium with high homologous recombination efficiency based on the above-mentioned gene editing system, and the method uses the above-mentioned CRISPR-Cas9 gene editing system to knock out the ku70 gene of the cephalosporium strain. First, construct a Cas9-sgRNA plasmid and a DonorDNA plasmid targeting the ku70 gene sequence; prepare cephalosporium protoplasts, and then transform the Cas9-sgRNA plasmid and the DonorDNA plasmid into the cephalosporium protoplasts and culture them at the same time to obtain transformants; screen the transformants by hygromycin resistance, and then verify the transformation of the knockout ku70 gene by genomic PCR; obtain a pure and knockout ku70 gene cephalosporium recombinant bacterium Ac-Δku70 by continuous screening of transformants and hygromycin resistance, that is, a high homologous recombination efficiency cephalosporium chassis strain.

[0009] In one embodiment, the method comprises a sgRNA expression cassette comprising a Ku70 gene sequence targeted and driven by a constitutive 5S ribosomal RNA gene promoter P5S on a Cas9-sgRNA plasmid.

[0010] In another embodiment, the method includes amplifying the 1500bp homology arm 5HA (Ku70) upstream of the Ku70 gene and the 1500bp homology arm 3HA (Ku70) downstream of the Ku70 gene on the donor DNA plasmid used to knock out the ku70 gene in Cephalosporium acremonium, using the glufosinate resistance gene Bar as a selection marker and amplifying the pUC19 vector backbone from the plasmid pUC19, connecting the above fragments into a donor DNA plasmid vector ku70-Donor, the sequence of which is shown in SEQ ID NO.9.

[0011] 3. The purpose of the present invention is also to provide a method for high-efficiency gene targeting of Cephalosporium acremonium based on the above-mentioned CRISPR-Cas9 gene editing system and a recombinant engineered bacterium with high homologous recombination efficiency. The method first constructs a donor Donor DNA plasmid vector, with the plasmid pUC19 vector as the backbone, including a constitutive 5S ribosomal RNA gene promoter P5S operably connected to a functional sgRNA expression cassette targeting a gene targeting target DNA sequence, a 500-1500bp homology arm of an upstream gene sequence of the gene targeting target DNA sequence, a selection marker resistance gene expression cassette, such as an expression cassette of the bleomycin resistance gene ble, and a 500-1500bp homology arm of a downstream gene sequence of the gene targeting target DNA sequence. Secondly, the protoplasts of the recombinant engineered bacteria Ac-Δku70 of Cephalosporium acremonium were prepared, and then the Donor DNA plasmid was transformed into the protoplasts of the recombinant engineered bacteria of Cephalosporium acremonium for cultivation to obtain transformants; the transformants were screened by bleomycin resistance, and then the transformants with successful targeting of the target DNA sequence were verified by genomic PCR; the pure gene-targeted Cephalosporium acremonium mutant strain was obtained by subculturing the transformants and continuously screening for bleomycin resistance.

[0012] In one embodiment, gene targeting of Cephalosporium acremonium based on the CRISPR-Cas9 gene editing system includes the following steps:

[0013] (1) Using Cephalosporium acremonium as the starting strain, the ku70 gene was knocked out by gene editing technology to increase the probability of homologous recombination of exogenous DNA in the strain, and at the same time, the Cas9 nuclease encoding gene was integrated into the Cephalosporium acremonium genome to obtain a recombinant Cephalosporium acremonium engineered strain with high homologous recombination efficiency;

[0014] (2) A recombinant Donor DNA vector containing an sgRNA expression cassette targeting the target DNA sequence, homologous arms on both sides of the gene targeting target DNA sequence, and a resistance screening marker gene expression cassette was constructed, and the recombinant Cephalosporium acremonium engineered bacteria protoplasts were transformed to perform gene targeting on the target gene DNA. Pure gene-targeted Cephalosporium acremonium mutant strains were obtained by transformant propagation and resistance screening.

[0015] In another embodiment, the above-mentioned method for gene targeting of Cephalosporium acremonium is used to knock out a single gene in the genome of Cephalosporium acremonium, and the homologous recombination efficiency of the single gene knockout in the method is higher than 90%.

[0016] The present invention also aims to provide a method for deleting a large genome fragment of Cephalosporium acremonium based on a CRISPR-Cas9 gene editing system and a recombinant engineering bacterium with high homologous recombination efficiency. The method first constructs a donor DonorDNA plasmid vector, using a plasmid pUC19 vector as a skeleton, including two suitable sgRNAs designed to target the two end sequences of the target genome fragment to be deleted, which are respectively connected to the constitutive 5S ribosomal RNA gene promoter P5S to construct an sgRNA1 expression cassette and an sgRNA2 expression cassette, amplify a 500-2000bp homology arm of the upstream DNA sequence of the target genome fragment to be deleted, and screen a marker resistance gene expression cassette, such as an expression cassette of the bleomycin resistance gene ble and a 500-2000bp homology arm of the downstream DNA sequence of the target genome fragment to be deleted. Secondly, the protoplasts of the recombinant engineered bacteria Ac-Δku70 of Cephalosporium acremonium were prepared, and the constructed Donor DNA plasmid was then transformed into the protoplasts of the recombinant engineered bacteria of Cephalosporium acremonium for cultivation to obtain transformants; the transformants were screened by bleomycin resistance, and then the transformants with successful deletion of the target genome large fragment were verified by genomic PCR; the pure and large genome fragment deleted Cephalosporium acremonium mutant strain was obtained by subculturing the transformants and continuously screening for bleomycin resistance.

[0017] In one embodiment, a CRISPR-Cas9-based gene editing system is used to delete a long DNA fragment in the genome of Cephalosporium acremonium, and the method can achieve the deletion of a long fragment of the genome of Cephalosporium acremonium exceeding 30 kb.

[0018] Beneficial effects achieved by the present invention:

[0019] The CRISPR-Cas9 gene editing system applicable to industrial strains of Cephalosporium acremonium provided by the present invention can construct an efficient gene targeting platform for Cephalosporium acremonium, and single gene knockout with a homologous recombination efficiency of more than 90% and deletion of large genomic DNA fragments of more than 30kb can be achieved on the resulting recombinant strain. The technical scheme of the present invention can significantly improve the homologous recombination efficiency of Cephalosporium acremonium and achieve the deletion of large DNA fragments in the genome of Cephalosporium acremonium, providing an efficient genetic operation platform for functional genomics research and strain genetic engineering transformation of Cephalosporium acremonium. The method provided by the present invention is particularly suitable for improving the efficiency of gene targeting technology in Cephalosporium acremonium, and provides basic support for genetic transformation such as large-scale genome editing in Cephalosporium acremonium. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1The process of constructing an engineered bacterium of Cephalosporium acremonium with high homologous recombination efficiency; A is the gene editing plasmid pAcCas9, which includes the Cas9 expression module, the sgRNA expression module, and the resistance screening gene expression module; B is the Ku70-Donor plasmid map, including the upstream sequence homology arm 5HA (ku70) of the ku70 gene, the glufosinate resistance expression box Bar, and the downstream gene sequence homology arm 3HA (ku70) of the ku70 gene; C is a schematic diagram of the ku70 gene knockout principle; D is a genomic PCR verification diagram of the transformant obtained by knocking out the Cephalosporium acremonium ku70 gene.

[0021] Figure 2 Figure 2 is a process for knocking out the sorB gene in the engineered bacteria of Cephalosporium acremonium; A is the Donor plasmid map KO-sorB for knocking out the sorB gene, including the sgRNA expression cassette targeting the sorB gene sequence, the sorB gene upstream sequence homology arm 5HA, the bleomycin resistance expression cassette Ble and the sorB gene downstream gene sequence homology arm 3HA; B is a schematic diagram of the sorB gene knockout principle; C is a genomic PCR verification diagram of the transformant obtained by knocking out the sorB gene of Cephalosporium acremonium.

[0022] Figure 3 The figure is a process for knocking out 30kb large fragment DNA in the engineered bacteria of Cephalosporium acremonium; wherein A is the Donor plasmid map KO-sor cluster for knocking out 30kb large fragment DNA of sorbicillinoids gene cluster, including two sgRNA expression boxes targeting the sorbicillinoids gene cluster sequence, 5HA-S, the homology arm of the upstream sequence of the sorbicillinoids gene cluster, the bleomycin resistance expression box Ble and the homology arm of the downstream gene sequence of the sorbicillinoids gene cluster 3HA-S; B is a schematic diagram of the principle of knocking out large fragments of sorbicillinoids gene cluster; C is a genome PCR verification diagram of the transformants obtained by knocking out 30kb large fragment DNA of sorbicillinoids gene cluster of Cephalosporium acremonium. DETAILED DESCRIPTION

[0023] The present invention discloses a method and application thereof for knocking out ku70 gene based on CRISPR-Cas9 technology to construct an engineered bacterium with high homologous recombination efficiency of Cephalosporium acremonium, as well as a method for targeting Cephalosporium acremonium gene on this basis. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0024] The present invention will be further described below in conjunction with embodiments:

[0025] Unless otherwise specified, the experimental materials, reagents, instruments and methods used in the following examples are conventional experimental materials, reagents, instruments and methods in the art and can be purchased through commercial channels.

[0026] In the present invention, the plasmid extraction adopts the Trans EasyPure Plasmid MiniPrep Kit of Quanshijin Company, the DNA fragment recovery adopts the Cycle-Pure Kit (D6492-01) of OMEGA Company, and the gel recovery adopts the Quick Gel Extraction Kit (EG101-01) of Quanshijin Company.

[0027] Osmotic pressure buffer: 0.6 M KCl, 25 mM CaCl2, 10 mM MgCl2.

[0028] CSL culture medium: corn slurry 30 g / L, soluble starch 30 g / L, glucose 10 g / L, CaCO3 5 g / L, pH 6.8 before sterilization (add 20 g / L agar powder to the solid culture medium).

[0029] YPS medium: sucrose 20 g / L, yeast powder 5 g / L, polypeptone 20 g / L, K2HPO4 1 g / L, MgSO4·7H2O1 g / L, pH 7.0 before sterilization.

[0030] Cell wall hydrolase lysis solution: dissolve cellulase, lysing enzyme and compound enzyme yatalase in osmotic pressure buffer at a mass ratio of 3:3:4 to prepare 10 mg / mL enzymatic solution, and filter through a 0.22 μm microporous filter membrane for sterilization.

[0031] Upper soft agar medium: 0.6M KCl, 25mM CaCl2, 10mM MgCl2, agar powder 7g / L.

[0032] Regeneration medium: malt extract 100 (v / v), maltose 40 g / L, polypeptone 20 g / L, sucrose 20 g / L, 0.6M KCl, 25mM CaCl2, 10mM MgCl2, agar powder 20 g / L, pH 7.0 before sterilization.

[0033] Table 1. Primers used in the examples of the present invention

[0034]

[0035]

[0036] Example 1. Construction of CRISPR-Cas9 gene editing plasmid

[0037] (1) Primers Backbone-F and Backbone-R were designed using the filamentous fungus random integration plasmid pHyg (Skatrud, P. et al.. Efficient integrative transformation of Cephalosporium acremonium [J]. Current Genetics, 1987, 12 (5): 337-348.) as a template to amplify the randomly integrated backbone linear fragment Backbone of the Cas9-sgRNA plasmid, and the plasmid backbone DNA fragment was obtained by gel recovery.

[0038] (2) Using the fungal gene editing plasmid pAMA1-Cas9-sgRNA (Meng, Guoliang et al.. Efficient CRISPR-Cas9 system based on autonomously replicating plasmid with an AMA1 sequence and precisely targeted gene deletion in the edible fungus, Cordyceps militaris. Current Genetics, 2022, 15(10): 2594-2606.) as a template, primers FNCas9N-F and FNCas9N-R were designed to amplify the Flag-NLS-Cas9-NLS fragment, and the Cas9 gene DNA fragment was obtained by gel recovery; the Backbone fragment and the Cas9 fragment were separated using the Beijing Quanshijin Biotechnology Co., Ltd. -BasicSeamless Cloning and Assembly Kit was used for seamless cloning, and the fragments were homologously recombined to obtain the vector pHyg-Cas9.

[0039] (3) Using the genomic DNA of the high-yield industrial fungus Cephalosporium acremonium as a template, primers Pactin-F and Pactin-R were designed to amplify the highly active constitutive promoter DNA fragment Pactin of the Cas9 gene.

[0040] (4) Primers P5S-F and P5S-R were designed using the genomic DNA of Cephalosporium acremonium as a template, and the DNA fragment of the promoter P5S of the constitutive 5S ribosomal RNA gene was amplified; primers 5sRNA-F and 5sRNA-R were designed using the genomic DNA of industrial Cephalosporium acremonium as a template, and the DNA fragment encoding 5sRNA was amplified; primers sgRNA-F and sgRNA-R were designed using the gene editing plasmid PFC330 in Aspergillus nidulans as a template, and the sgRNA fragment was amplified; the above three fragments were assembled into a complete sgRNA expression cassette using fusion PCR.

[0041] (5) The Pactin promoter fragment and the assembled sgRNA expression cassette were connected to the linearized pHyg-Cas9 vector by seamless cloning homologous recombination to obtain the recombinant plasmid pAcCas9, as shown in the schematic diagram. Figure 1 As shown in A.

[0042] Example 2: Construction of Ku70-Donor, a recombinant vector of ku70 gene knockout donor DNA

[0043] According to the sequence information of ku70 gene, the fragments of about 1500bp upstream and downstream of ku70 gene were selected as homology arms, and the genomic DNA of Cephalosporium acremonium was used as template. Primers 5HAku70-F and primers 5HAku70-R were designed to amplify the upstream homology arm 5HA (ku70), and primers 3HAku70-F and 3HAku70-R were designed to amplify the downstream homology arm 3HA (ku70). Primers barbox-F and primer barbox-R were designed to amplify the expression cassette of the screening marker glufosinate resistance gene (bar). Primers pUC19BB-F and primers pUC19BB-R were used to amplify the pUC19 vector backbone from the plasmid pUC19. The upstream homology arm 5HA (ku70), downstream homology arm 3HA (ku70), glufosinate resistance gene (bar) expression cassette and pUC19 vector backbone fragments were recovered by agarose gel electrophoresis and homologous recombination ligation was performed using a seamless cloning kit to construct a homologous recombination donor plasmid ku70-Donor with ku70 knockout. The schematic diagram is shown in FIG. Figure 1 As shown in B.

[0044] According to the sequence information of the ku70 gene, the optimal sgRNA sequence cgagaagcaggagatcaaga was retrieved and selected on the Sequence Scan for CRISPR website (http: / / crispr.dfci.harvard.edu / SSC). Using the pAcCas9 plasmid as a template, primers 70sgRNA1-F and primers 70sgRNA1-R were designed to amplify the fragment ku70-sgRNA-1, which contains the promoter P5S sequence, the DNA sequence encoding 5sRNA, and the sgRNA sequence targeting the Ku70 gene; using the pAcCas9 plasmid as a template, primers 70sgRNA2-F and primers 70sgRNA2-R were designed to amplify the fragment ku70-sgRNA-2, which is the entire sgRNA sequence containing the 20bp sequence targeting the Ku70 gene designed above. Using the pHyg-cas9 plasmid as a template, primers AcCas9-F and primers AcCas9-R were designed to amplify the vector backbone of the pAcCas9 plasmid. The above four fragments were recovered by agarose gel electrophoresis and connected by homologous recombination using a seamless cloning kit to construct the plasmid ku70-cas9 for CRISPR-Cas9 editing of the Ku70 gene.

[0045] Example 3: Construction of a Cephalosporium acremonium chassis strain with high homologous recombination efficiency based on CRISPR-Cas9 technology

[0046] (1) Preparation of Cephalosporium acremonium protoplasts

[0047] In the clean bench, use an inoculation loop to take 2-3 loops of fresh cephalosporium acremonium cultured on a solid slant at 28°C for 5-7 days and inoculate CSL liquid fermentation medium, 220rpm, 28°C for 4 days. Inoculate the culture in CSL medium into YPS liquid medium at a volume ratio of 10%, and culture at 220rpm, 28°C for 16-20h. Collect the mycelium by centrifugation at 7000rpm for 5min, wash the mycelium 2-3 times with osmotic pressure buffer, collect the mycelium by centrifugation, resuspend in osmotic pressure buffer containing 10mM DTT, and incubate at 100rpm, 28°C for 1h. Collect the mycelium by centrifugation at 7000rpm for 5min, wash it 2-3 times with osmotic pressure buffer (centrifugation at 7000rpm for 5min each time), add 10mL cell wall hydrolase lysis solution, enzymolysis at 30°C, 100rpm for 2-3h, and examine under a microscope until the mycelium releases a large number of protoplasts. Add 5 times the volume of osmotic pressure buffer to terminate the reaction, and filter out the mycelium through 4-6 layers of sterilized lens paper. The filtrate was centrifuged at 2000 rpm (note to reduce the acceleration) for 5 min to collect the protoplasts, and the protoplasts were washed with osmotic pressure buffer to remove the residual enzymatic solution, and then the protoplasts were resuspended with an appropriate amount of osmotic pressure buffer and packaged into 100 μL / tube for polyethylene glycol (PEG)-mediated genetic transformation of protoplasts with exogenous DNA.

[0048] (2) Screening and identification of ku70 gene knockout strains

[0049] Protoplast transformation: Mix 5 μg of the ku70-cas9 plasmid and 10 μg of the ku70-Donor plasmid constructed in Example 2, and use the PEG-mediated protoplast transformation method to simultaneously transform them into the prepared Cephalosporium acremonium protoplasts, and apply double-layer plates (the lower layer is the regeneration medium, the upper layer is the soft agar medium, and both the upper and lower plates are added with 100 μg / ml hygromycin and 100 μg / ml glufosinate). After 7-10 days, randomly pick several single colonies from the single colonies grown on the resistant double-layer plates, and extract their genomic DNA. The PCR method is used to verify the knockout of the ku70 gene. Figure 1 As shown in Figure C, a pair of primers 70check-F and 70check-R were designed to span the DNA region outside the homologous arm of the ku70 gene and the DNA region of the glufosinate resistance gene (bar), and PCR amplification was performed using the extracted genomic DNA as a template. If homologous recombination substitution successfully occurs and the ku70 gene is knocked out, a 2100 bp DNA fragment can be amplified. Figure 1As shown in D, the 15 single colonies picked from the resistant double-layer plate can basically amplify the target band, indicating that the ku70 gene of Cephalosporium acremonium was successfully knocked out by the CRISPR-Cas9 gene editing system. The transformant with the brightest PCR-verified band was streaked for 5 generations on a double-resistant plate supplemented with 100 μg / ml hygromycin and 100 μg / ml glufosinate ammonium, and the pure and knocked-out ku70 gene recombinant Cephalosporium acremonium was obtained after confirmation using the above-mentioned genomic DNA extracted as a template for PCR verification, which was used as the Cephalosporium acremonium chassis strain Ac-Δku70 for subsequent gene targeting.

[0050] Example 4: Detection of homologous recombination efficiency of Cephalosporium acremonium chassis strain Ac-Δku70 by knocking out the sorB gene

[0051] 4.1 Construction of homologous recombination donor DNA plasmid KO-sorB to knock out the sorB gene

[0052] According to the sequence information of the sorB (Sorbicillinoid biosynthetic cluster protein B) gene in the genome of Cephalosporium acremonium, 800bp fragments of the upstream and downstream of the sorB gene were selected as homology arms, and the genomic DNA of Cephalosporium acremonium was used as a template to design primers 5HAsorB-F and 5HAsorB-R to amplify the upstream 800bp homology arm 5HA (sorB), and primers 3HAsorB-F and 3HAsorB-R to amplify the downstream 800bp homology arm 3HA (sorB). Primers blebox-F and blebox-R were designed to amplify the expression cassette of the screening marker bleomycin resistance gene (ble).

[0053] According to the sequence information of the sorB gene, the optimal sgRNA sequence aggtggcaaccgtggaccg was retrieved and selected on the Sequence Scan for CRISPR website. Using the pAcCas9 plasmid as a template, primers sorBsgRNA1-F and primers sorBsgRNA1-R were designed to amplify the fragment sorB-sgRNA-1, which contains the promoter P5S sequence, the DNA sequence encoding 5sRNA, and the sgRNA sequence targeting the sorB gene; using the pAcCas9 plasmid as a template, primers sorBsgRNA2-F and primers sorBsgRNA2-R were designed to amplify the fragment sorB-sgRNA-2, which is the entire sgRNA sequence containing the 20bp sequence targeting the sorB gene designed above. The two fragments of sorB-sgRNA-1 and sorB-sgRNA-2 were assembled into a complete sgRNA expression cassette sorB-sgRNA by fusion PCR.

[0054] Primers pUC19BB-F and primers pUC19BB-R were used to amplify the pUC19 vector backbone from the plasmid pUC19. The five fragments of the upstream homology arm 5HA (sorB), downstream homology arm 3HA (sorB), bleomycin resistance gene (ble) expression cassette, sgRNA expression cassette sorB-sgRNA and pUC19 vector backbone were recovered by agarose gel electrophoresis, and homologous recombination connection was performed using a seamless cloning kit to construct the homologous recombination donor plasmid KO-sorB with sorB gene knockout, as shown in the schematic diagram. Figure 2 As shown in A, the sequence is SEQ ID NO.10.

[0055] 4.2 Verification of sorB gene knockout efficiency in engineered Cephalosporium acremonium

[0056] Protoplasts of the engineered bacteria Ac-Δku70 of Cephalosporium acremonium were prepared according to the method in Example 3. 10 μg of the constructed KO-sorB plasmid was used to transform the protoplasts of Ac-Δku70 using the PEG-mediated protoplast transformation method, and coated on a double-layer plate (the lower layer was a regeneration medium, the upper layer was a soft agar medium, and 100 μg / ml hygromycin and 100 μg / ml bleomycin were added to the upper and lower plates). After 7-10 days, several single colonies were randomly selected from the single colonies grown on the resistant double-layer plate, their genomic DNA was extracted, and PCR was used to verify the knockout of the sorB gene. Figure 2 As shown in Figure B, a pair of primers sorBcheck-F and sorBcheck-R were designed to span the DNA region outside the homology arm of the sorB gene and the DNA region of the bleomycin resistance gene (ble), and PCR amplification was performed using the extracted genomic DNA as a template. If homologous recombination replacement successfully occurs and the sorB gene is knocked out, a 1600 bp DNA fragment can be amplified. Figure 2 C shows the genome PCR verification image of the transformants obtained by knocking out the sorB gene of Cephalosporium acremonium. The target DNA fragment was successfully amplified from 19 transformants among the 20 single colonies picked from the resistant double-layer plate, indicating that the homologous recombination efficiency of sorB gene knockout in the engineered bacteria of Cephalosporium acremonium with ku70 gene knocked out using the CRISPR-Cas9 gene editing system was 95%.

[0057] This example illustrates that the engineered bacteria of Cephalosporium acremonium with high homologous recombination efficiency constructed by knocking out the ku70 gene using the CRISPR-Cas9 gene editing system is an efficient Cephalosporium acremonium gene targeting platform, which can achieve single gene knockout with a homologous recombination efficiency of more than 90%.

[0058] Example 5: Deletion of a 30 kb DNA fragment of the sorbicillinoids gene cluster based on the engineered strain of Cephalosporium acremonium with high homologous recombination efficiency

[0059] 5.1 Construction of homologous recombination donor DNA plasmid KO-sor cluster

[0060] According to the sequence information of the sorbicillinoids gene cluster in the genome of Cephalosporium acremonium, a large DNA fragment of about 30.9 kb from the 3' end of the sorA gene coding region to the 3' end of the sorR2 gene coding region in the sorbicillinoids gene cluster was selected as the deletion target. According to the sequence information of the sorbicillinoids gene cluster, the SequenceScan for CRISPR website was searched and the optimal sgRNA targeting the target DNA sequence was selected at both ends of the target to be deleted: target1: cagcagcagggccaggacgg at the 3' end of the sorA gene coding region and target2: tgcggggaccagcttcctgg at the 3' end of the sorR2 gene coding region.

[0061] Using pAcCas9 plasmid as template, primer sorBsgRNA1-F and primer sorsgRNA1-1R were designed to amplify the fragment sor-sgRNA1-1, which contains the promoter P5S sequence, the DNA sequence encoding 5sRNA, and the sgRNA sequence targeting the 3' end of the sorA gene coding region; using pAcCas9 plasmid as template, primer sorsgRNA1-2F and primer sorsgRNA1-2R were designed to amplify the fragment sor-sgRNA1-2, which is the entire sgRNA sequence containing the above-designed 20bp sequence targeting the 3' end of the sorA gene coding region. The two fragments of sor-sgRNA1-1 and sor-sgRNA1-2 were assembled into a complete sgRNA expression cassette 1 (sor-sgRNA1) for editing the sorbicillinoids gene cluster by fusion PCR.

[0062] Similarly, using pAcCas9 plasmid as template, using primer 70sgRNA1-F and designing primer sorsgRNA2-1R to amplify fragment sor-sgRNA2-1, this fragment contains the promoter P5S sequence, the DNA sequence encoding 5sRNA and the sgRNA sequence targeting the 3' end of the coding region of the sorR2 gene; using pAcCas9 plasmid as template, designing primer sorsgRNA2-2F and primer sorsgRNA2-2R to amplify fragment sor-sgRNA2-2, this fragment is the entire sgRNA sequence containing the above-designed 20bp sequence targeting the 3' end of the coding region of the sorR2 gene. The two fragments of sor-sgRNA2-1 and sor-sgRNA2-2 were assembled into a complete sgRNA expression cassette 2 (sor-sgRNA2) for editing the sorbicillinoids gene cluster by fusion PCR.

[0063] According to the sequence information of the sorbicillinoids gene cluster to be deleted in the genome of Cephalosporium acremonium, 1500bp fragments of the 3'end upstream of the coding region of the sorA gene and the 3'end downstream of the coding region of the sorR2 gene were selected as homology arms. Using the genomic DNA of Cephalosporium acremonium as a template, primers 5HA(sor)-F and primers 5HA(sor)-R were designed to amplify the upstream 1500bp homology arm 5HA(sor). Similarly, primers 3HA(sor)-F and 3HA(sor)-R were designed to amplify the downstream 1500bp homology arm 3HA(sor). Primers blebox-F and primer blebox-R were used to amplify the screening marker bleomycin resistance gene (ble) expression cassette. Primers pUC19BB-F and primers pUC19BB-R were used to amplify the pUC19 vector backbone from the plasmid pUC19.

[0064] The upstream homology arm 5HA (sor), downstream homology arm 3HA (sor), bleomycin resistance gene (ble) expression cassette, sgRNA expression cassette 1 (sor-sgRNA1), sgRNA expression cassette 2 (sor-sgRNA2) and pUC19 vector backbone six fragments were recovered by agarose gel electrophoresis, and homologous recombination connection was performed using a seamless cloning kit to construct a homologous recombination donor plasmid KO-sor cluster with a large fragment of 30.89 kb of the sorbicillinoids gene cluster knocked out. The schematic diagram is shown in the figure Figure 3 As shown in A, the sequence is SEQ ID NO.11.

[0065] 5.2 Verification of large DNA fragment deletion efficiency of sorbicillinoids gene cluster in engineered Cephalosporium acremonium

[0066] Protoplasts of the engineered bacteria Ac-Δku70 of Cephalosporium acremonium were prepared according to the method in Example 3. 10 μg of the constructed KO-sor cluster plasmid was used to transform the protoplasts of Ac-Δku70 using the PEG-mediated protoplast transformation method, and coated on double-layer plates (the lower layer was a regeneration medium, the upper layer was a soft agar medium, and 100 μg / ml hygromycin and 100 μg / ml bleomycin were added to the upper and lower plates). After 7-10 days, several single colonies were randomly selected from the single colonies grown on the resistant double-layer plates, their genomic DNA was extracted, and PCR was used to verify the deletion of the large DNA fragment of the sorbicillinoids gene cluster. Figure 3 As shown in B, a pair of primers sorcheck-F and downstream primer sorcheck-R were designed to span the DNA region of the 1500bp homology arm outside the 3' end of the sorA gene coding region and the 1500bp homology arm outside the 3' end of the sorR2 gene coding region, and PCR amplification was performed using the extracted genomic DNA as a template. If homologous recombination replacement successfully occurs, resulting in the deletion of a large DNA fragment of the sorbicillinoids gene cluster, a DNA fragment of about 4500bp will be amplified. Figure 3 C shows the genome PCR verification image of the transformant obtained by deleting the 30.89kb large DNA fragment of the sorbicillinoids gene cluster of Cephalosporium acremonium. One transformant successfully amplified the target DNA fragment from the 13 single colonies picked from the resistant double-layer plate. The amplified DNA fragment was recovered by agarose gel electrophoresis and sent to Beijing Qingke Biological Company for sequencing verification, confirming that the 30.89kb large DNA fragment of the sorbicillinoids gene cluster in the engineered strain of Cephalosporium acremonium was successfully deleted.

[0067] This example illustrates that the engineered bacteria of Cephalosporium acremonium with high homologous recombination efficiency constructed by knocking out the ku70 gene using the CRISPR-Cas9 gene editing system is an efficient gene targeting platform for Cephalosporium acremonium, which can achieve the deletion of large genomic fragments exceeding 30 kb.

[0068] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A gene editing system based on CRISPR-Cas9 technology suitable for industrial strains of Cephalosporium acremonium, characterized in that: The system includes a Cas9 gene operably linked to a promoter Pactin, a functional sgRNA gene including a targeting sequence operably linked to a constitutive 5S ribosomal RNA gene promoter P5S, a selection marker gene operably linked to a promoter PtrpC, such as a hygromycin phosphotransferase gene hph, and TtrpC1 and TtrpC2 as terminators for the Cas9 and selection marker gene, respectively, on a Cas9-sgRNA plasmid.

2. A gene editing system based on CRISPR-Cas9 technology suitable for industrial strains of Cephalosporium acremonium, characterized in that: The donor DNA plasmid of the system is based on the plasmid pUC19 vector as the backbone, including a 500-1500 bp homology arm of the upstream gene sequence of the gene targeting target gene, a screening marker resistance gene expression cassette, such as an expression cassette of the glufosinate resistance gene bar, and a 500-1500 bp homology arm of the downstream gene sequence of the gene targeting target gene.

3. The gene editing system according to claim 1, characterized in that The screening marker gene is the hygromycin phosphotransferase gene hph, the sequence of the promoter Pactin that starts Cas9 expression is shown in SEQ ID NO.1; the sequence of Cas9 is shown in SEQ ID NO.2; the sequence of the constitutive 5S ribosomal RNA gene promoter P5S is shown in SEQ ID NO.3; the sgRNA sequence including the targeting sequence designed for the edited target gene is shown in SEQ ID NO.4; the sequence of the promoter PtrpC is shown in SEQ ID NO.5; the sequence of the hygromycin phosphotransferase hph gene is shown in SEQ ID NO.6; the sequence of the terminator TtrpC1 is shown in SEQ ID NO.7; and the sequence of the terminator TtrpC2 is shown in SEQ ID NO.

8.

4. The gene editing system according to any one of claims 1 to 3, characterized in that: The plasmid backbone is a random integration plasmid in filamentous fungi, such as pHyg, through which the Cas9 nuclease encoding gene is integrated into the genome of Cephalosporium acremonium.

5. A method for constructing a recombinant Cephalosporium acremonium engineered bacterium with high homologous recombination efficiency according to the gene editing system of claims 1-3, characterized in that: CRISPR-Cas9 gene editing system constructed by claims 1 and 2 for the treatment of Cephalosporium acremonium strains ku70 First, construct a targeted ku70 Cas9-sgRNA plasmid and Donor DNA plasmid with gene sequences; prepare Cephalosporium acremonium protoplasts, and then transform Cas9-sgRNA plasmid and Donor DNA plasmid into Cephalosporium acremonium protoplasts at the same time for cultivation to obtain transformants; select transformants by hygromycin resistance, and then verify the knockout by genomic PCR ku70 Transformants of the gene; pure knockouts were obtained by subculturing the transformants and continuously screening for hygromycin resistance ku70 The recombinant strain of Cephalosporium acremonium Ac-Δku70 containing the gene is a Cephalosporium acremonium chassis strain with high homologous recombination efficiency; Preferably, it is a method for constructing a Cephalosporium acremonium chassis strain by knocking out genes based on the CRISPR-Cas9 gene editing system; Further preferably, the system contains a constitutive 5S ribosomal RNA gene promoter P5S on the Cas9-sgRNA plasmid, including targeting Ku70 sgRNA expression cassette of the gene sequence.

6. The method for constructing a recombinant Cephalosporium acremonium engineered bacterium with high homologous recombination efficiency according to claim 5, characterized in that: It is used to knock out Cephalosporium acremonium ku70 The construction of the gene donor DNA plasmid includes amplification Ku70 1500 bp upstream homology arm 5HA (Ku70) and Ku70 1500 bp homology arm 3HA (Ku70) downstream of the gene, using the glufosinate resistance gene Bar As a selection marker, the pUC19 vector backbone was amplified from the plasmid pUC19, and the above fragments were connected to form the donor DNA plasmid vector ku70-Donor, the nucleotide sequence of which is shown in SEQ ID NO.

9.

7. A method for gene targeting of Cephalosporium acremonium using the CRISPR-Cas9 gene editing system of claims 1-4, characterized in that: The method comprises the following steps: First, a donor DNA plasmid vector is constructed, with the plasmid pUC19 vector as the backbone, including a constitutive 5S ribosomal RNA gene promoter P5S, a functional sgRNA expression cassette that is operably linked to the target DNA sequence for gene targeting, a 500-1500 bp homology arm of the upstream gene sequence of the target DNA sequence for gene targeting, and a selection marker resistance gene expression cassette, such as the bleomycin resistance gene ble The expression cassette and the downstream gene sequence 500-1500 bp homology arm of the gene targeting target DNA sequence; Secondly, the protoplasts of the recombinant engineered bacteria Ac-Δku70 of Cephalosporium acremonium were prepared, and then the Donor DNA plasmid was transformed into the protoplasts of the recombinant engineered bacteria of Cephalosporium acremonium for cultivation to obtain transformants; the transformants were screened by bleomycin resistance, and then the transformants with successful targeting of the target DNA sequence were verified by genomic PCR; the pure gene-targeted Cephalosporium acremonium mutant strain was obtained by subculturing the transformants and continuously screening for bleomycin resistance.

8. The method according to claim 7, characterized in that It includes the following steps: (1) Using Cephalosporium acremonium as the starting strain, knockout of ku70 Gene, improve the probability of homologous recombination of exogenous DNA in the strain, and integrate the Cas9 nuclease encoding gene into the genome of Cephalosporium acremonium to obtain a recombinant Cephalosporium acremonium engineered bacterium with high homologous recombination efficiency; (2) By constructing a recombinant Donor DNA vector plasmid containing a sgRNA expression cassette targeting the target DNA sequence, homologous arms on both sides of the gene targeting target DNA sequence, and a resistance screening marker, the recombinant Cephalosporium acremonium engineered bacteria protoplasts are transformed to perform gene targeting on the target gene DNA, and a pure gene-targeted Cephalosporium acremonium mutant strain is obtained by transformant propagation and resistance screening; The method is used for gene targeting of a target DNA sequence of Cephalosporium acremonium; the homologous recombination efficiency of single gene knockout in the method is higher than 90%.

9. The method according to claim 8, characterized in that The method is used for deleting a large genome fragment of Cephalosporium acremonium; the specific steps include: firstly constructing a donor DNA plasmid vector, using a plasmid pUC19 vector as a skeleton, including two suitable sgRNAs designed to target the two end sequences of the target genome fragment to be deleted, respectively connecting with the constitutive 5S ribosomal RNA gene promoter P5S to construct an sgRNA1 expression cassette and an sgRNA2 expression cassette, amplifying a 500-2000 bp homology arm of the upstream DNA sequence of the target genome fragment to be deleted, and screening a marker resistance gene expression cassette, such as a bleomycin resistance gene ble The expression cassette and the downstream DNA sequence 500-2000 bp homology arm of the target large genomic fragment to be deleted are prepared. Secondly, the protoplasts of the recombinant engineering bacteria Ac-Δku70 of Cephalosporium acremonium are prepared, and the constructed Donor DNA plasmid is transformed into the protoplasts of the recombinant engineering bacteria of Cephalosporium acremonium for culture to obtain transformants; the transformants are screened by bleomycin resistance, and then the transformants with successful deletion of the target large genomic fragment are verified by genomic PCR; the pure and large genomic fragment-deleted Cephalosporium acremonium mutant strain is obtained by subculturing the transformants and continuously screening for bleomycin resistance.

10. The method according to claim 9, characterized in that The method is used to delete a long fragment of the Cephalosporium acremonium genome of 10-50 kb, such as 20-40 kb, such as 25-35 kb.

Images