System and method for performing traceless gene editing in cephalosporium acremonium based on CRISPR-Cas9 system

By constructing a CRISPR-Cas9 scarless gene editing system, the problems of resistance selection markers and Cas9 nuclease residues in industrial strains of Cephalosporin have been solved, enabling efficient gene editing and multiple genetic modification, thereby improving the production efficiency and industrial application potential of cephalosporin C.

CN122012571APending Publication Date: 2026-05-12TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Filing Date
2026-04-14
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies leave behind resistance selection marker genes and Cas9 nuclease encoding genes in industrial strains of Cephalosporin C, which hinders the fermentation production level and industrial application of cephalosporin C. Furthermore, the genetic manipulation system is imperfect, making it difficult to achieve efficient gene editing.

Method used

A CRISPR-Cas9 scarless gene editing system was constructed. The CRISPR-Cas9 gene-editing DNA fragment and the donor plasmid were co-transformed into *Cephalospora* protoplasts using PEG-mediated protoplast transformation. Homologous recombination donor plasmids containing upstream and downstream homologous arms of the target sequence were designed to remove residual resistance selection marker genes in the edited strain, thus achieving scarless knockout.

Benefits of technology

It enables precise and traceless gene editing of industrial strains of Cephalosporin C, improves the production efficiency of cephalosporin C, reduces production costs, enhances the industrial application potential of engineered bacteria, and supports the flexibility of multiple genetic modifications and gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012571A_ABST
    Figure CN122012571A_ABST
Patent Text Reader

Abstract

The invention discloses a traceless gene editing system and method in cephalosporium acremonium based on a CRISPR-Cas9 system, and belongs to the technical field of gene engineering. The method comprises the following steps: constructing a CRISPR-Cas9 gene editing DNA fragment containing Cas9 nuclease and an sgRNA expression cassette, designing a homologous recombination donor plasmid of a corresponding gene, co-transforming the editing fragment and the donor plasmid into a cephalosporium acremonium protoplast through a PEG-mediated protoplast transformation method, and sequentially realizing ku70 and sorB gene knockout and cefR gene promoter in-situ replacement, so as to obtain the recombinant cephalosporium acremonium protoplast. Meanwhile, by constructing a traceless knockout donor plasmid, a resistance selection marker and a Cas9 gene are removed, and traceless editing is achieved. The traceless editing system constructed by the method can realize multiple genetic modification, provides a new way for improving the production efficiency of cephalosporin C, and is suitable for genetic engineering modification of cephalosporium acremonium industrial strains.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for scarless gene editing in *Cephalosporium* based on the CRISPR-Cas9 system. Background Technology

[0002] Cephalosporin C is an important precursor to cephalosporin antibiotics widely used in clinical practice, possessing advantages such as strong stability, broad-spectrum resistance, and low toxicity. The filamentous fungus *Acremonium chrysogenum* is a crucial industrial microorganism for the production of cephalosporin antibiotics, and cephalosporin C in the pharmaceutical industry is currently produced through fermentation from it. However, the synthetic regulatory mechanism for high-yield cephalosporin C production in *Acremonium chrysogenum* is not yet fully elucidated, becoming a bottleneck for further genetic engineering modification of this strain. Unlike wild-type *Acremonium chrysogenum* and other common filamentous fungi, industrial strains of *Acremonium chrysogenum* lack a complete genetic manipulation system. Further technological optimization is needed for modern genetic engineering modification of industrial strains of *Acremonium chrysogenum* using gene knock-in, gene replacement, gene knockout, and promoter replacement methods. Given the importance of cephalosporin antibiotics in the pharmaceutical industry, modifying industrial strains of *Acremonium chrysogenum* through metabolic engineering and other synthetic biology techniques to further improve the fermentation production level of cephalosporin C and reduce its production cost is of great significance and potential.

[0003] The CRISPR-Cas9 system, as a highly efficient gene-editing tool, has been widely used in the genome editing of various microorganisms. Currently, precise gene manipulation has been successfully achieved in industrial filamentous fungi such as *Penicillium chrysogenum*, *Aspergillus nidus*, and *Aspergillus oryzae*. However, research progress in industrial strains of *Cephalosporium* is relatively slow. With the rapid development of genome editing technology, gene targeting of industrial strains of *Cephalosporium* can be achieved by constructing the CRISPR-Cas9 system. However, there are drawbacks, such as the presence of resistance selection marker genes and Cas9 nuclease-encoding genes remaining in the genome of the engineered strain after gene editing. This hinders the cephalosporin C fermentation production level of engineered strains of *Cephalosporium* and impedes the industrial application of engineered strains of *Cephalosporium* (CN119709817A, Publication Date: 2025.03.28).

[0004] Therefore, there is an urgent need to develop a scarless gene editing system for efficient gene targeting and other genetic engineering modifications of industrial *Cephalosporin* strains. Establishing an efficient scarless gene editing system in industrial *Cephalosporin* strains and implementing multiple genetic modification strategies will provide new possibilities for further targeted modification of *Cephalosporin* strains and improve the production efficiency of cephalosporin C. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention provides a method for scarless gene editing in Cephalosporium based on the CRISPR-Cas9 system.

[0006] On the one hand, the present invention provides a method for scarless gene editing in *Cephalospora* based on the CRISPR-Cas9 system, comprising the following steps: constructing a CRISPR-Cas9 gene editing DNA fragment containing a Cas9 nuclease-encoded gene expression cassette and an sgRNA expression cassette targeting the target sequence; designing a homologous recombination donor plasmid containing upstream and downstream homologous arm sequences of the target sequence; co-transforming *Cephalospora* protoplasts with the CRISPR-Cas9 gene editing DNA fragment and the donor plasmid using a PEG-mediated protoplast transformation method to achieve target gene editing, while simultaneously constructing and transforming a scarless knockout donor plasmid to remove residual resistance selection marker genes in the edited strain.

[0007] In one embodiment, the Cas9 nuclease-encoded gene expression cassette comprises a Cas9 gene, a promoter Pmbf1 operatively linked to the Cas9 gene, and a terminator TtrpC1. The nucleotide sequence of the promoter Pmbf1 is shown in SEQ ID NO. 1, the nucleotide sequence of the Cas9 gene is shown in SEQ ID NO. 2, and the nucleotide sequence of the terminator TtrpC1 is shown in SEQ ID NO. 3. The sgRNA expression cassette comprises a P5S promoter from *Cephalosporium*, a 5sRNA-encoded fragment, and an sgRNA fragment from *Aspergillus nidus*. The nucleotide sequence of the P5S promoter is shown in SEQ ID NO. 4, the nucleotide sequence of the 5sRNA-encoded fragment is shown in SEQ ID NO. 5, and the nucleotide sequence of the sgRNA fragment is shown in SEQ ID NO. 6. The first 1-20 nt bases of the sgRNA nucleotide sequence shown in SEQ ID NO. 6 can be substituted according to a specific target gene.

[0008] In one embodiment, the *Acetospora* is a high-yield industrial strain of *Acetospora*; the target sequence is any functional gene coding region or gene regulatory region of *Acetospora*, and the gene regulatory region is a gene promoter region.

[0009] In one embodiment, the construction of the homologous recombination donor plasmid includes: selecting 1000 bp-1500 bp homologous arms upstream and downstream of the target sequence, an resistance marker gene expression cassette, and an sgRNA complementary target DNA sequence and / or fluorescent protein expression cassette to be introduced as needed for the next round of gene editing; amplifying the vector backbone using plasmid pUC19 as a template; and seamlessly cloning and ligating the upstream and downstream homologous arms, the resistance selection marker gene expression cassette, and the sequence to be introduced as needed with the pUC19 vector backbone to obtain the homologous recombination donor plasmid.

[0010] In one embodiment, the resistance selection marker gene expression cassette includes a resistance gene, a promoter, and a terminator. The resistance gene is either the hygromycin phosphotransferase (hph) gene or the bleomycin resistance gene (ble). The sequence of the hygromycin phosphotransferase (hph) gene is shown in SEQ ID NO. 7, and the sequence of the bleomycin resistance gene (ble) is shown in SEQ ID NO. 8. The promoter is the PtrpC promoter, and its nucleotide sequence is shown in SEQ ID NO. 9. The terminator is either the TtrpC1 terminator or the TtrpC2 terminator, and the nucleotide sequences of the TtrpC1 terminator and the TtrpC2 terminator are shown in SEQ ID NO. 3 and SEQ ID NO. 10, respectively. The fluorescent protein expression cassette is an expression cassette composed of a red fluorescent protein mScarlet gene operatively linked to the promoter PgpdA and Ttef1 as the terminator for that gene. The nucleotide sequence of the promoter PgpdA is shown in SEQ ID NO. 11, the nucleotide sequence of the mScarlet gene is shown in SEQ ID NO. 12, and the nucleotide sequence of the terminator Ttef1 is shown in SEQ ID NO. 10. Shown in NO.13.

[0011] In one embodiment, the construction of the scarless knockout donor plasmid includes: selecting 1000bp-1500bp homologous arms upstream and downstream of the site where the resistance selection marker gene to be removed is located; amplifying the vector backbone using plasmid pUC19 as a template; and seamlessly cloning and ligating the upstream and downstream homologous arms with the pUC19 vector backbone to obtain a scarless knockout donor plasmid without the resistance selection marker gene, without the fluorescent protein expression cassette, and without the complementary target DNA sequence of the sgRNA for the next round of gene editing.

[0012] In one embodiment, the gene-edited strain is identified using PCR. Verification primers are designed to cross the outer side of the homologous arm of the target sequence and the regions of the resistance gene and / or fluorescent protein gene. The editing effect is verified based on the size of the amplified fragment. Positive transformants are passaged multiple times and then verified again by PCR to obtain homozygous gene-edited *Cephalosporium* engineered strains.

[0013] In one implementation, when performing multiple rounds of continuous gene editing, the complementary target DNA sequence of the sgRNA for the next round of gene editing is introduced into the homologous recombination donor plasmid constructed in each round. During each round of gene editing, the traceless knockout donor plasmid of the resistance selection marker gene from the previous round is added simultaneously, so as to achieve simultaneous multi-round gene editing and traceless removal of the resistance selection marker from the previous round.

[0014] On the one hand, the recombinant cephalosporin engineered strain prepared by the present invention has its genome edited with the target sequence, and does not contain resistance selection marker genes or fluorescent protein encoding genes. The target sequence is any functional gene coding region or gene regulatory region of cephalosporin, and the gene regulatory region is a gene promoter region.

[0015] On the other hand, the application of the method described in this invention in the genetic engineering modification of industrial strains of Cephalosporin can optimize the metabolic pathway of Cephalosporin and improve the fermentation production efficiency of cephalosporin C by knocking out, knocking in, or replacing any functional gene regulatory region of Cephalosporin.

[0016] Compared with existing technologies, the present invention has the following beneficial effects: The CRISPR-Cas9 scarless gene editing system constructed in this invention breaks through the technical bottleneck of the imperfect genetic manipulation system of *Cephalosporin* industrial strains, and realizes precise scarless gene editing of *Cephalosporin* industrial strains; after editing, there are no residual resistance selection markers and Cas9 nuclease encoding genes, avoiding the adverse effects of residual genes on cephalosporin C fermentation production, and enhancing the industrial application potential of engineered bacteria; it can sequentially complete multiple genetic modifications such as multi-gene knockout and promoter in situ replacement, greatly improving the efficiency and flexibility of *Cephalosporin* gene editing; the obtained engineered bacteria can effectively improve the production efficiency of cephalosporin C and reduce its production cost, providing an efficient technical means for strain optimization in the industrial production of cephalosporin antibiotics. Attached Figure Description

[0017] Figure 1 This is a schematic diagram illustrating the principle of gene knockout of the ku70 gene (a gene) in an industrial strain of Cephalosporium using a constructed CRISPR-Cas9 scarless gene editing system.

[0018] Figure 2 This is a schematic diagram illustrating the principle of knocking out the sorB gene (b gene) in an industrial strain of Cephalosporium using a constructed CRISPR-Cas9 scarless gene editing system.

[0019] Figure 3 This is a schematic diagram illustrating the principle of using the constructed CRISPR-Cas9 scarless gene editing system to replace the promoter of the accefR gene (x gene) in an industrial strain of Cephalosporium. Detailed Implementation

[0020] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result of the description. However, these embodiments are merely illustrative and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Unless otherwise specified, the experimental materials, reagents, instruments and methods used in the following examples are all conventional experimental materials, reagents, instruments and methods in the art, and can be purchased through commercial channels.

[0024] In this invention, plasmid extraction was performed using the Trans EasyPure Plasmid MiniPrep Kit from TransGen, DNA fragment recovery was performed using the OMEGA Cycle-Pure Kit (D6492-01), and gel recovery was performed using the TransGen Quick Gel Extraction Kit (EG101-01).

[0025] Osmotic buffer: 0.6M KCl, 25mM CaCl2, 10mM MgCl2.

[0026] CSL medium: corn steep liquor 30 g / L, soluble starch 30 g / L, glucose 10 g / L, CaCO3 5 g / L, pH 6.8 before sterilization (for solid medium, add 20 g / L agar powder).

[0027] YPS medium: sucrose 20 g / L, yeast extract 5 g / L, polypeptone 20 g / L, K2HPO4 1 g / L, MgSO4·7H2O 1 g / L, pH 7.0 before sterilization.

[0028] Cell wall hydrolytic enzyme lysis buffer: Cellulase, Lysing enzyme, and Yatalase were dissolved in osmotic buffer at a mass ratio of 3:3:4 to prepare a 10 mg / mL enzyme hydrolysate, which was then filtered through a 0.22 μm microporous membrane for sterilization.

[0029] Upper soft agar medium: 0.6M KCl, 25mM CaCl2, 10mM MgCl2, agar powder 7g / L.

[0030] Regeneration medium: 10% malt extract (v / v), 40 g / L maltose, 20 g / L peptone, 20 g / L sucrose, 0.6 M KCl, 25 mM CaCl2, 10 mM MgCl2, 20 g / L agar powder, pH 7.0 before sterilization.

[0031] Example 1: Construction of CRISPR-Cas9 gene-editing DNA fragments

[0032] (1) Using the filamentous fungal random integration plasmid pHyg (Skatrud, PLet al.. Efficient integrative transformation of Cephalosporium acremonium[J]. Current Genetics,1987, 12(5):337-348.) as a template, primers Backbone-F and Backbone-R were designed to amplify the linear fragment Backbone of the randomly integrated backbone of the Cas9-sgRNA plasmid. The backbone DNA fragment of this plasmid was obtained by gel recovery.

[0033] (2) Primers FNCas9N-F and FNCas9N-R were designed using the fungal gene editing plasmid pAMA1-Cas9-sgRNA (Meng, Guoliang et al..Efficient CRISPR-Cas9 system based on autonomously replicating plasmid with an AMA1 sequence and precisely targeted gene deletion in the edible fungus, Cordyceps militaris. Current Genetics, 2022, 15(10): 2594-2606.) as a template. The Flag-NLS-Cas9-NLS fragment was amplified and the Cas9 gene DNA fragment was obtained by gel recovery, as shown in SEQ ID NO.2. The fragment backbone and the Cas9 gene DNA fragment were seamlessly cloned using the pEASY® -Basic Seamless Cloning and Assembly Kit of Beijing TransGen Biotech Co., Ltd. Homologous recombination ligation of the fragments was used to obtain the vector pHyg-Cas9.

[0034] (3) Using the genomic DNA of the high-yielding industrial bacteria of Cephalosporium as a template, primers Pmbf1-F and Pmbf1-R were designed to amplify the DNA fragment of the highly active constitutive promoter Pmbf1 of the Cas9 gene, as shown in SEQ ID NO.1. The terminator is TtrpC1, and its nucleotide sequence is shown in SEQ ID NO.3.

[0035] (4) Primers P5S-F and P5S-R were designed using *Cephalosporium* genomic DNA as a template to amplify the DNA fragment of the promoter P5S of the constitutive 5S ribosomal RNA gene, as shown in SEQ ID NO.4; primers 5sRNA-F and 5sRNA-R were designed using *Cephalosporium* industrial strain genomic DNA as a template to amplify the DNA fragment encoding 5sRNA, as shown in SEQ ID NO.5; primers sgRNA-F and sgRNA-R were designed using the gene-editing plasmid PFC330 from *Aspergillus nidus* as a template to amplify the sgRNA fragment, as shown in SEQ ID NO.6. gcgactttcgatgtcatcgagttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (This is a general template for gene editing. The sequence shown underlined in SEQ ID NO.6, i.e., the 1st to 20th nt of 5'-3', can be replaced with a specific target sgRNA as needed). The above three fragments are assembled into a complete sgRNA expression cassette using fusion PCR.

[0036] (5) The above-mentioned Pmbf1 promoter fragment and the assembled sgRNA expression cassette were ligated to the linearized pHyg-Cas9 vector using a seamless cloning homologous recombination method to obtain the recombinant plasmid pAcCas9.

[0037] (6) Subsequently, using the recombinant plasmid pAcCas9 as a template, primers Pmbf1-F2 and sgRNA-R2 were designed upstream of the Cas9 nuclease-encoding gene expression cassette and downstream of the sgRNA expression cassette, respectively. This amplified DNA fragments containing the Cas9 nuclease-encoding gene expression cassette and the sgRNA expression cassette for the CRISPR-Cas9 system. 10-30 μg of the CRISPR-Cas9 gene editing DNA fragment was obtained by gel extraction. This fragment consists of a Cas9 expression cassette composed of the promoter Pmf1, the Cas9 gene, and the terminator TtrpC1, and an sgRNA expression cassette composed of the P5S promoter, a 5sRNA-encoding fragment, and an sgRNA fragment. The bases in the 1st to 20th nt of the sgRNA nucleotide sequence can be substituted according to the specific target gene.

[0038] Example 2: Knockout of the ku70 gene in *Cephalosporium* industrial strain using a CRISPR-Cas9-based scarless gene editing system.

[0039] A schematic diagram illustrating the principle of gene knockout of the ku70 gene (a gene) in *Cephalosporium* industrial strains using the CRISPR-Cas9 scarless gene editing system is shown below. Figure 1 As shown, the first round of gene editing involved constructing a Cas9-sgRNA-a expression cassette fragment targeting the ku70 gene sequence and a target DNA sequence pre-inserted to complement the sgRNA of the sorB gene, the next gene editing site. A Donor DNA-a plasmid containing a selection marker hygromycin resistance gene expression cassette and an mScarlet expression cassette was also constructed. The Cas9-sgRNA-a expression cassette fragment and the Donor DNA-ku70 fragment were simultaneously transformed into protoplasts of *Cephalosporin* industrial strains to obtain transformants. Transformants were obtained through resistance selection and genomic PCR verification. The transformants were then passaged to obtain a homozygous *Cephalosporin* recombinant strain Ac-Δa with the ku70 gene knocked out. The specific experimental procedure is as follows:

[0040] 1. Based on the sequence information of the ku70 gene, approximately 1500 bp upstream and downstream fragments of the ku70 gene were selected as homologous arms. Using *Cephalosporium* genomic DNA as a template, primers 5HAku70-F and 5HAku70-R were designed to amplify the upstream homologous arm 5HA (ku70), and primers 3HAku70-F and 3HAku70-R were designed to amplify the downstream homologous arm 3HA (ku70). Primers hphbox-F and hphbox-R were designed to amplify the hygromycin resistance gene (hph) expression cassette. The hph gene sequence is shown in SEQ ID NO.7. The hygromycin resistance gene (hph) expression cassette also contains the promoter PtrpC (as shown in SEQ ID NO.9) and the terminator TtrpC1 (as shown in SEQ ID NO.3). Primers pUC19BB-F and pUC19BB-R were used to amplify the pUC19 vector backbone from plasmid pUC19. The four fragments mentioned above—upstream homologous arm 5HA (ku70), downstream homologous arm 3HA (ku70), hygromycin phosphotransferase hph gene expression cassette, and pUC19 vector backbone—were recovered by agarose gel electrophoresis and ligated by homologous recombination using a seamless cloning kit to construct the Donor backbone plasmid ku70-Donor with ku70 knocked out.

[0041] Furthermore, the target DNA sequence complementary to the sgRNA targeting the next gene editing sorB gene target sequence site, the expression cassette from the red fluorescent protein mScarlet (the mScarlet gene (SEQ ID NO.12) operatively linked to the promoter PgpdA (SEQ ID NO.11) and Ttef1 (SEQ ID NO.13) serving as the mScarlet gene terminator)) and the ku70-Donor plasmid backbone were homologously ligated with each other using a seamless cloning kit to construct the homologous recombination donor Donor plasmid Donor DNA-ku70, whose nucleotide sequence is shown in SEQ ID NO.14.

[0042] 2. Based on the sequence information of the ku70 gene, the optimal ku70-sgRNA sequence cgagaagcaggagatcaaga (as shown in SEQ ID NO.17) was searched and selected on the Sequence Scan for CRISPR website (http: / / crispr.dfci.harvard.edu / SSC). Using the pAcCas9 plasmid from Example 1 as a template, primers 70sgRNA1-F and 70sgRNA1-R were designed to amplify the fragment ku70-sgRNA-1. This fragment contains the promoter P5S sequence, a DNA sequence encoding 5sRNA, and a 20bp sgRNA sequence targeting the ku70 gene (as shown in SEQ ID NO. 17). Using the pAcCas9 plasmid as a template, primers 70sgRNA2-F and 70sgRNA2-R were designed to amplify the fragment ku70-sgRNA-2. This fragment is the entire sgRNA sequence containing the designed 20bp sequence targeting the ku70 gene (replacing the underlined portion of the sequence shown in SEQ ID NO. 6 with the sequence shown in SEQ ID NO. 17). Using the pAcCas9 plasmid as a template, primers AcCas9-F and AcCas9-R were designed to amplify the vector backbone of the pAcCas9 plasmid. The three fragments were recovered by agarose gel electrophoresis and homologous recombination was performed using a seamless cloning kit to construct the plasmid ku70-cas9 (Cas9-sgRNA-a) for CRISPR-Cas9 editing of the ku70 gene.

[0043] Using plasmid Cas9-sgRNA-a as a template, the DNA fragment Cas9-sgRNA-a containing the Cas9 nuclease-encoding gene expression cassette and the sgRNA expression cassette (containing the promoter P5S sequence, the DNA sequence encoding 5sRNA, and the sgRNA sequence targeting the ku70 gene) was amplified using primers Pmbf1-F2 and sgRNA-R2. 10-30 μg of the CRISPR-Cas9 gene editing DNA fragment Cas9-sgRNA-a was obtained by gel recovery.

[0044] 3. Preparation of Cephalosporium protoplasts

[0045] In a clean bench, inoculate 2-3 loops of fresh *Cephalospora* mycelium cultured on a solid slant at 28°C for 5-7 days into CSL liquid fermentation medium and incubate at 220 rpm and 28°C for 4 days. Inoculate the CSL culture at a 10% volume ratio into YPS liquid medium and incubate at 220 rpm and 28°C for 16-20 hours. Collect hyphae by centrifugation at 7000 rpm for 5 minutes, wash the cells 2-3 times with osmotic buffer, centrifuge again to collect the cells, resuspend in osmotic buffer containing 10 mM DTT, and incubate at 100 rpm and 28°C with shaking for 1 hour. Collect the cells by centrifugation at 7000 rpm for 5 minutes, wash 2-3 times with osmotic buffer (centrifuging at 7000 rpm for 5 minutes each time), add 10 mL of cell wall hydrolase lysis buffer, and incubate at 30°C and 100 rpm for 2-3 hours until protoplasts are released from the hyphae. Terminate the reaction by adding 5 times the volume of osmotic buffer and filter through 4-6 layers of sterile lens paper to remove hyphae. The filtrate was centrifuged at 2000 rpm for 5 min to collect protoplasts. The protoplasts were washed with osmotic buffer to remove residual enzyme digest, and then resuspended with an appropriate amount of osmotic buffer. The protoplasts were aliquoted into 100 μL tubes for polyethylene glycol (PEG)-mediated exogenous DNA protoplast genetic transformation.

[0046] 4. Screening and identification of Ku70 gene knockout strains

[0047] Protoplast transformation: 15 μg of the constructed Cas9-sgRNA-a fragment and 15 μg of Donor DNA-ku70 plasmid were mixed and simultaneously transformed into the prepared *Cephalospora* protoplasts using PEG-mediated protoplast transformation. The mixture was then plated on double-layer plates (lower layer: regeneration medium; upper layer: soft agar medium; both layers were supplemented with 100 μg / ml hygromycin). After 7-10 days, several single colonies were randomly selected from the single colonies growing on the resistant double-layer plates, and their genomic DNA was extracted. PCR was used to verify the knockout of the ku70 gene. A pair of primers, 70check-F1 and 70check-R1, was designed to span the DNA region lateral to the upstream homologous arm of the ku70 gene and the target DNA region complementary to the sgRNA of the next-round gene-editing sorB gene target sequence site. Another pair of primers, 70check-F2 and 70check-R2, was designed to span the DNA region lateral to the downstream homologous arm of the ku70 gene and the target DNA region complementary to the sgRNA of the next-round gene-editing sorB gene target sequence site. PCR amplification was performed using extracted genomic DNA as a template. If homologous recombination and substitution successfully resulted in the knockout of the ku70 gene, DNA fragments of 3600 bp and 3700 bp could be amplified. The target band was amplified in almost all of the 15 single colonies picked from the resistant doublet plate, indicating that the ku70 gene of *Cephalosporium* was successfully knocked out by the CRISPR-Cas9 gene editing system. The transformants with the brightest PCR bands were further passaged for 5 generations on hygromycin-containing plates, and then confirmed by PCR using the extracted genomic DNA as a template to obtain homozygous recombinant ceftriaxone with the ku70 gene knocked out. This ceftriaxone was then used as the subsequent multi-gene-edited ceftriaxone chassis strain Ac-Δku70.

[0048] Example 3: Knockout of the sorB gene in *Cephalosporium* industrial strain with ku70 gene knockout using a scarless gene editing system based on CRISPR-Cas9.

[0049] A schematic diagram illustrating the principle of the CRISPR-Cas9 scarless gene editing system knocking out the sorB gene (b gene) in *Cephalosporium* industrial strains is shown below. Figure 2As shown, a Cas9-sgRNA-b expression cassette fragment targeting the sorB gene sequence was constructed. A target DNA sequence complementary to the sgRNA of gene c (the next gene editing site) was pre-inserted into the Donor DNA-b1 plasmid, which contained the bleomycin resistance gene expression cassette but not the mScarlet expression cassette. A Donor DNA-b2 plasmid, containing the upstream and downstream homologous arms of the ku70 gene (the gene targeted in the previous round) but without the selection marker or the mScarlet expression cassette, was also constructed. The Cas9-sgRNA-b expression cassette fragment, Donor DNA-b1 plasmid, and Donor DNA-b2 plasmid were simultaneously transformed into the protoplasts of the recombinant *Ac-Δa* strain of *Cephalospora*. Transformants were selected by red fluorescence inactivation and bleomycin resistance screening. Through passage and continuous resistance screening of the transformants, a homozygous *Ac-Δb* strain with sorB gene knockout and ku70 gene knockout without scarring was obtained. The specific experimental procedure is as follows:

[0050] 1. Construct the Donor DNA-b1 plasmid, a homologous recombination donor for knocking out the sorB gene.

[0051] Based on the sequence information of the sorB (Sorbicillinoid biosynthetic cluster protein B) gene in the *Cephalospora* genome, 800 bp segments upstream and downstream of the sorB gene were selected as homologous arms. Using *Cephalospora* genomic DNA as a template, primers 5HAsorB-F and 5HAsorB-R were designed to amplify the upstream 800 bp homologous arm 5HA (sorB), and primers 3HAsorB-F and 3HAsorB-R were designed to amplify the downstream 800 bp homologous arm 3HA (sorB). Primers blebox-F and blebox-R were designed to amplify the bleomycin resistance gene (BLE) expression cassette.

[0052] The pUC19 vector backbone was amplified from plasmid pUC19 using primers pUC19BB-F2 and pUC19BB-R2. The five fragments—upstream homologous arm 5HA (sorB), downstream homologous arm 3HA (sorB), the bleomycin resistance gene (ble) expression cassette (including promoter PtrpC, terminator TtrpC2, and the ble gene sequence as shown in SEQ ID NO. 8-SEQ ID NO. 10), the target DNA sequence complementary to the sgRNA at the next gene editing target cefR gene promoter sequence site (SEQ ID NO. 19), and the pUC19 vector backbone—were recovered by agarose gel electrophoresis and ligated using a seamless cloning kit to construct the Donor plasmid Donor DNA-sorB (Donor DNA-b1) (SEQ ID NO. 15), which knocks out the sorB gene.

[0053] 2. Constructing a CRISPR-Cas9 gene editing DNA fragment Cas9-sgRNA-b that knocks out the sorB gene.

[0054] Based on the sorB gene sequence information, the optimal sorB-sgRNA sequence aaggctgccagtccgtgccg (as shown in SEQ ID NO. 18) was retrieved and selected from the Sequence Scan for CRISPR website. Using the pAcCas9 plasmid as a template, primers sorBsgRNA1-F and sorBsgRNA1-R were designed to amplify the fragment sorB-sgRNA-1. This fragment contains the promoter P5S sequence, the DNA sequence encoding 5sRNA, and the 20bp sgRNA sequence targeting the sorB gene (as shown in SEQ ID NO. 18). Using the pAcCas9 plasmid as a template, primers sorBsgRNA2-F and sorBsgRNA2-R were designed to amplify the fragment sorB-sgRNA-2. This fragment is the entire sgRNA sequence containing the designed 20bp sequence targeting the sorB gene (replacing the underlined sequence in SEQ ID NO. 6 with the sequence shown in SEQ ID NO. 18). The two fragments, sorB-sgRNA-1 and sorB-sgRNA-2, were assembled into a complete sgRNA expression cassette, sorB-sgRNA, using fusion PCR. Primers AcCas9-F2 and AcCas9-R2 were designed to amplify the vector backbone of the pAcCas9 plasmid using the pAcCas9 plasmid as a template. The sorB-sgRNA fragments and the pAcCas9 plasmid vector backbone were recovered by agarose gel electrophoresis and ligated using a seamless cloning kit for homologous recombination to construct the plasmid Cas9-sgRNA-b for CRISPR-Cas9 editing of the sorB gene.

[0055] Using plasmid Cas9-sgRNA-b as a template, the DNA fragment Cas9-sgRNA-b containing the Cas9 nuclease-encoding gene expression cassette and the sgRNA expression cassette was amplified using primers Pmbf1-F2 and sgRNA-R2. 20 μg of the CRISPR-Cas9 gene editing DNA fragment Cas9-sgRNA-b was obtained by gel recovery.

[0056] 3. Construct the Donor DNA plasmid Donor DNA-b2, a homologous recombination donor for the scarless knockout of the ku70 gene.

[0057] The Donor plasmid Donor DNA-ku70, used for knocking out ku70, was constructed according to Example 2. The downstream homologous arm 3HA (ku70) was amplified using primers 3HAku70-F and 3HAku70-R2, and the upstream homologous arm 3HA (ku70) was amplified using primers 5HAku70-F2 and 5HAku70-R. The pUC19 vector backbone was amplified from plasmid pUC19 using primers pUC19BB-F-2 and pUC19BB-R-2. The three fragments—the upstream homologous arm 5HA (ku70), the downstream homologous arm 3HA (ku70), and the pUC19 vector backbone—were recovered by agarose gel electrophoresis and ligated using a seamless cloning kit to construct the Donor plasmid Donor DNA-b2 (as shown in SEQ ID NO. 20) for scarless knockout of ku70.

[0058] 4. Knockout of the sorB gene in engineered Cephalosporium strains

[0059] Protoplasts of the engineered *Ac-Δku70* strain were prepared according to the method described in Example 2. 20 μg of the CRISPR-Cas9 gene-editing DNA fragment Cas9-sgRNA-b, 15 μg of the constructed Donor DNA plasmid Donor DNA-b1, and 15 μg of the constructed Donor DNA plasmid Donor DNA-b2 were transformed into the *Ac-Δku70* protoplasts using PEG-mediated protoplast transformation. The transformed protoplasts were plated in a double-layer agar plate (lower layer: regeneration medium; upper layer: soft agar; both layers were supplemented with 100 μg / ml bleomycin). After 7-10 days, several single colonies were randomly selected from the single colonies that grew on the resistant double-layer agar plate, and their genomic DNA was extracted. PCR was used to verify the knockout of the sorB gene.

[0060] A pair of primers, sorBcheck-F1 and sorBcheck-R1, were designed to span the upstream outer DNA region of the sorB gene homologous arm and the bleomycin resistance gene (BLE) DNA region. Another pair of primers, sorBcheck-F2 and sorBcheck-R2, were designed to span the downstream outer DNA region of the sorB gene homologous arm and the bleomycin resistance gene (BLE) DNA region. PCR amplification was performed using extracted genomic DNA as a template. If homologous recombination and substitution successfully resulted in sorB gene knockout, DNA fragments of 2300 bp and 900 bp could be amplified. The successful amplification of the target DNA fragments from 15 transformants out of 20 single colonies picked from a resistance doublet plate confirms the sorB gene knockout.

[0061] A pair of primers, 70check-F1 and 70check-R3, spanning the DNA regions of the upstream outer and downstream homologous arms of the ku70 gene, was designed. Another pair of primers, 70check-F3 and 70check-R2, spanning the DNA regions of the downstream outer homologous arm and the upstream homologous arm, was also designed. PCR amplification was performed using extracted genomic DNA as a template. If the ku70 gene is successfully knocked out without scarring, DNA fragments of approximately 1800 bp and 1800 bp will be amplified, and the red fluorescence of the transformants will disappear. Of the 15 transformed individuals selected, 3 successfully amplified the target DNA fragment, and the red fluorescence of the transformants disappeared, indicating that the ku70 gene was knocked out without scarring. The verified positive transformants were further passaged for 5 generations on bleomycin-resistant plates supplemented with 100 μg / ml. After confirmation by PCR using the extracted genomic DNA as a template, homozygous sorB gene knockout and ku70 gene scarless knockout of the *Cephalospora* recombinant strain were obtained, which served as the subsequent multiplex gene-edited *Cephalospora* chassis strain Ac-ΔsorB.

[0062] Example 4: In situ promoter replacement of the pathway-specific regulatory factor gene cefR in *Cephalosporium* industrial strains with knockout ku70 and sorB genes using a CRISPR-Cas9-based scarless gene editing system.

[0063] The procedure using a CRISPR-Cas9-based scarless gene editing system to replace the promoter of the pathway-specific regulator gene cefR within the CPC synthetic gene cluster in situ with the strong promoter PgpdA is similar to the aforementioned procedure of knocking out the sorB gene in the engineered strain Ac-Δku70 of Cephalosporium. A schematic diagram of the principle is shown below. Figure 3As shown, a Cas9-sgRNA-x expression cassette fragment targeting the cefR gene promoter sequence was constructed, along with an sgRNA expression cassette without the next round of gene editing sites, and a Donor DNA-x1 plasmid containing an resistance selection marker and an mScarlet expression cassette. A Donor DNA-x2 plasmid containing the upstream and downstream homologous arms of the previous gene-targeting gene x-1 was also constructed, but without the resistance selection marker and mScarlet expression cassette. The Cas9-sgRNA-x expression cassette fragment, Donor DNA-x1 plasmid, and Donor DNA-x2 plasmid were simultaneously transformed into the protoplasts of the recombinant *Ac-Δx* strain of *Cephalospora*. Transformants were selected using red fluorescence and resistance screening. Through passage and continuous resistance screening of the transformants, homozygous knockout genes a, b, and up to gene x were obtained in the *Ac-Δx* recombinant *Cephalospora* strain. After the final round of gene editing, a Cas9-sgRNA-y expression cassette fragment targeting the resistance gene sequence was constructed, along with an sgRNA expression cassette lacking the next round of gene editing sites, and a Donor DNA-y plasmid lacking the resistance selection marker and mScarlet expression cassette. The Cas9-sgRNA-y expression cassette fragment and the Donor DNA-y plasmid were simultaneously transformed into the protoplasts of the recombinant *Ac-Δx-1* strain of *Cephalospora*. Transformants were screened by red fluorescence inactivation and resistance inactivation. Through passage of transformants and continuous screening using red fluorescence inactivation and resistance inactivation, homozygous, traceless knockout genes a, b, and x were obtained in the *Ac-Δx+1* recombinant *Cephalospora* strain. The specific experimental procedure is as follows:

[0064] 1. Construct the Donor DNA-x1 plasmid, a homologous recombination donor for in situ replacement of the cefR gene.

[0065] Based on the sequence information of the promoter region of the cefR gene (gene number: ACRE_003280) in the *CefR* genome, 1000 bp segments upstream and downstream of the cefR gene promoter region were selected as homologous arms. Using *CefR* genomic DNA as a template, primers 5HAcefR-F and 5HAcefR-R were designed to amplify the upstream 1000 bp homologous arm 5HA (PcefR), and primers 3HAcefR-F and 3HAcefR-R were designed to amplify the downstream 1000 bp homologous arm 3HA (PcefR). Primers hphbox-F and hphbox-R were designed to amplify the expression cassette of the hygromycin resistance gene (hph), a selection marker.

[0066] The pUC19 vector backbone was amplified from plasmid pUC19 using primers pUC19BB-F3 and pUC19BB-R3. The five fragments—upstream homologous arm 5HA (PcefR), downstream homologous arm 3HA (PcefR), hygromycin resistance gene (hph) expression cassette, expression cassette from the red fluorescent protein mScarlet (the mScarlet gene operatively linked to promoter PgpdA and Ttef1 serving as the mScarlet gene terminator), and the pUC19 vector backbone—were recovered by agarose gel electrophoresis and ligated using a seamless cloning kit for homologous recombination to construct the Donor plasmid DonorDNA-x1, which replaces the cefR gene promoter in situ.

[0067] 2. Constructing the CRISPR-Cas9 gene editing DNA fragment Cas9-sgRNA-x to replace the cefR gene promoter in situ.

[0068] Based on the sequence information of the promoter region of the cefR gene, the optimal cefR-sgRNA sequence ccgtctgctgggcctcggct (as shown in SEQ ID NO.19) was retrieved and selected from the Sequence Scan for CRISPR website. The Cas9 cleavage target for gene editing of the cefR gene is 24 bp upstream of the cefR translation start site. Using pAcCas9 plasmid as a template, primers cefRsgRNA1-F and cefRsgRNA1-R were designed to amplify the fragment cefR-sgRNA-1. This fragment contains the promoter P5S sequence, the DNA sequence encoding 5sRNA, and a 20bp sgRNA sequence targeting the promoter region of the cefR gene (as shown in SEQ ID NO. 19). Using pAcCas9 plasmid as a template, primers cefRsgRNA2-F and cefRsgRNA2-R were designed to amplify the fragment cefR-sgRNA-2. This fragment is the entire sgRNA sequence containing the designed 20bp sequence targeting the promoter region of the cefR gene (replacing the underlined sequence in SEQ ID NO. 6 with the sequence shown in SEQ ID NO. 19). The two fragments cefR-sgRNA-1 and cefR-sgRNA-2 were assembled into the complete sgRNA expression cassette cefR-sgRNA using fusion PCR. Using the pAcCas9 plasmid as a template, primers AcCas9-F3 and AcCas9-R3 were designed to amplify the vector backbone of the pAcCas9 plasmid. The cefR-sgRNA expression cassette fragment and the vector backbone of the pAcCas9 plasmid were recovered by agarose gel electrophoresis and homologous recombination was performed using a seamless cloning kit to construct the plasmid Cas9-sgRNA-x for CRISPR-Cas9 editing of the promoter region of the cefR gene. Its nucleotide sequence is shown in SEQ ID NO.16.

[0069] Using plasmid Cas9-sgRNA-x as a template, the DNA fragment Cas9-sgRNA-x containing the Cas9 nuclease-encoding gene expression cassette and the sgRNA expression cassette was amplified using primers Pmbf1-F2 and sgRNA-R2. Figure 3 As shown in the figure, 20 μg of the CRISPR-Cas9 gene editing DNA fragment Cas9-sgRNA-x was obtained by gel recovery.

[0070] 3. Construct the Donor DNA plasmid Donor DNA-x2, a homologous recombination donor for the sorB gene knockout without scarring.

[0071] The Donor plasmid Donor DNA-b2 (nucleotide sequence shown in SEQ ID NO. 15), a homologous recombination donor for knocking out sorB, was constructed according to Example 3. The upstream 800bp homologous arm 5HA (sorB) was amplified using primers 5HAsorB-F and 5HAsorB-R2, and the downstream 800bp homologous arm 3HA (sorB) was amplified using primers 3HAsorB-F2 and 3HAsorB-R. The pUC19 vector backbone was amplified from plasmid Donor DNA-b2 using primers pUC19BB-F3-2 and pUC19BB-R3-2. The three fragments—the upstream homologous arm 5HA (sorB), the downstream homologous arm 3HA (sorB), and the pUC19 vector backbone—were recovered by agarose gel electrophoresis and ligated using a seamless cloning kit to construct the Donor plasmid Donor DNA-x2 (as shown in SEQ ID NO. 21) for scarless knockout of the sorB gene.

[0072] 4. Promoter of in situ replacement of the cefR gene in engineered Cephalosporium strains

[0073] Protoplasts of the engineered *Ac-ΔsorB* strain were prepared according to the method described in Example 2. 20 μg of the CRISPR-Cas9 gene-edited DNA fragment Cas9-sgRNA-x, 15 μg of the constructed Donor DNA plasmid Donor DNA-x1, and 15 μg of the constructed Donor DNA plasmid Donor DNA-x2 were transformed into *Ac-ΔsorB* protoplasts using PEG-mediated protoplast transformation. The transformed protoplasts were plated in a double-layer agar (lower layer: regeneration medium; upper layer: soft agar; both layers were supplemented with 100 μg / ml hygromycin). After 7-10 days, several single colonies were randomly selected from the single colonies that grew on the resistant double-layer agar plates, and their genomic DNA was extracted. PCR was used to verify the in situ substitution of the cefR gene promoter.

[0074] Primers cefRcheck-F1 and cefRcheck-R1 were designed to span the DNA region upstream of the homologous arm of the cefR gene promoter and the DNA region of the mScarlet gene. Another pair of primers, cefRcheck-F2 and cefRcheck-R2, were designed to span the DNA region downstream of the homologous arm of the cefR gene promoter and the DNA region of the mScarlet gene. Extracted genomic DNA was used as a template for PCR amplification. If homologous recombination successfully occurred, resulting in in-situ replacement of the cefR gene promoter, DNA fragments of 4500 bp and 3000 bp could be amplified. Of the 25 single colonies picked from antibiotic doublet plates, 15 transformants successfully amplified the target DNA fragments, and 10 of these transformants exhibited visible red fluorescence, indicating that the cefR gene promoter had been replaced in situ.

[0075] A pair of primers, sorBcheck-F1 and sorBcheck-R3, were designed to span the DNA regions of the upstream outer and downstream homologous arms of the sorB gene. Another pair of primers, sorBcheck-F3 and sorBcheck-R2, were designed to span the DNA regions of the downstream outer homologous arm and the upstream homologous arm of the sorB gene. Extracted genomic DNA was used as a template for PCR amplification. If the sorB gene was successfully knocked out without scarring, 1000bp and 1000bp DNA fragments could be amplified. Two out of ten transformants successfully amplified the target DNA fragments, demonstrating the successful scarless knockout of the sorB gene.

[0076] The verified positive transformants were further passaged for 5 generations on hygromycin-containing plates. After PCR verification using the extracted genomic DNA as a template, a homozygous cefR gene promoter was obtained, and the ku70 and sorB genes were knocked out without scarring. This resulted in the Ac-PgpdA-cefR (Ac-Δx) recombinant *Cephalosporin* strain.

[0077] 5. Remove the resistance gene selection markers remaining after in situ replacement of the cefR gene promoter in engineered Cephalosporium strains.

[0078] Following the final round of gene editing, a Cas9-sgRNA-y fragment targeting the hygromycin resistance gene sequence was constructed using the method described in Example 2. This fragment contains a Cas9 nuclease-encoded gene expression cassette and an sgRNA expression cassette targeting the hygromycin resistance gene sequence. Based on the sequence information of the hph gene promoter region, the optimal sgRNA sequence aagacgcgctacttcgagcgg (as shown in SEQ ID NO. 22) was retrieved and selected from the Sequence Scan for CRISPR website. Using the pAcCas9 plasmid as a template, primers hphsgRNA1-F and hphsgRNA1-R were designed to amplify the fragment hph-sgRNA-1. This fragment contains the promoter P5S sequence, the DNA sequence encoding 5sRNA, and the 20bp sgRNA sequence targeting the hph gene (as shown in SEQ ID NO. 22). Using the pAcCas9 plasmid as a template, primers hphsgRNA2-F and hphsgRNA2-R were designed to amplify the fragment hph-sgRNA-2. This fragment is the entire sgRNA sequence containing the designed 20bp sequence targeting the hph gene (replacing the underlined sequence in SEQ ID NO. 6 with the sequence shown in SEQ ID NO. 22). The two fragments hph-sgRNA-1 and hph-sgRNA-2 were assembled into the complete sgRNA expression cassette hph-sgRNA using fusion PCR. Using the pAcCas9 plasmid as a template, primers AcCas9-F2 and AcCas9-R2 were designed to amplify the vector backbone of the pAcCas9 plasmid. The hph-sgRNA expression cassette fragment and the vector backbone of the pAcCas9 plasmid were recovered by agarose gel electrophoresis and homologous recombination was performed using a seamless cloning kit to construct the plasmid Cas9-sgRNA-y for CRISPR-Cas9 editing of the hph gene.

[0079] Using plasmid Cas9-sgRNA-y as a template, the DNA fragment Cas9-sgRNA-y containing the Cas9 nuclease-encoding gene expression cassette and the sgRNA expression cassette was amplified using primers Pmbf1-F2 and sgRNA-R2. 20 μg of the CRISPR-Cas9 gene editing DNA fragment Cas9-sgRNA-y was obtained by gel recovery.

[0080] After the final round of gene editing, a homologous recombination donor plasmid, Donor DNA-y, was constructed for seamless in situ replacement of the cefR gene promoter. Unlike other plasmids, Donor DNA-y does not contain the sgRNA expression cassette for the next round of gene editing sites, nor does it contain the selection marker resistance gene expression cassette or the red fluorescent protein mScarlet expression cassette.

[0081] Based on the Donor plasmid Donor DNA-x1 constructed in Example 3 for in situ replacement of the cefR gene promoter, the upstream 1000bp homologous arm 5HA (PcefR) was amplified using primers 5HAcefR-F and 5HAcefR-R2. Primers 3HAcefR-F2 and 3HAcefR-R2 were designed to amplify the downstream 1000bp homologous arm 3HA (PcefR) containing the in situ replaced promoter. The pUC19 vector backbone was amplified from plasmid Donor DNA-x1 using primers pUC19BB-F4 and pUC19BB-R4. The upstream homologous arm 5HA (PcefR), the downstream homologous arm 3HA (PcefR), and the pUC19 vector backbone were recovered by agarose gel electrophoresis and homologous recombination was performed using a seamless cloning kit to construct the Donor plasmid Donor DNA-y, which is used to remove the resistance gene selection marker remaining in the in situ replacement of the cefR gene promoter in the engineered Cephalosporium. The sequence is shown in SEQ ID NO.23.

[0082] Protoplasts of the engineered *Ac-PgpdA-cefR* (Ac-Δx) strain were prepared according to the method described in Example 2. 20 μg of the CRISPR-Cas9 gene-edited DNA fragment Cas9-sgRNA-y and 20 μg of the constructed Donor DNA plasmid DonorDNA-y were transformed into the *Ac-PgpdA-cefR* protoplasts using PEG-mediated protoplast transformation. The transformed protoplasts were plated on double-layer plates (lower layer: regeneration medium; upper layer: soft agar medium; no hygromycin was added to either layer). After 7-10 days, several single colonies that showed no red fluorescence were randomly selected from the single colonies that grew on the double-layer plates. Genomic DNA was extracted from these colonies. PCR was used to verify the removal of the hygromycin resistance gene selection marker remaining after in situ replacement of the *cefR* gene promoter in the engineered *Ac-PgpdA-cefR* strain. Transformants were also selected based on the hygromycin resistance inactivation.

[0083] A pair of primers, cefRcheck-F1 and cefRcheck-R3, was designed to span the DNA region upstream of the homologous arm of the cefR gene promoter region and the DNA region of the in-situ substituted promoter PgpdA. Another pair of primers, cefRcheck-F3 and cefRcheck-R2, was designed to span the DNA region downstream of the homologous arm of the cefR gene promoter region and the DNA region of the in-situ substituted promoter PgpdA. Extracted genomic DNA was used as a template for PCR amplification. If the cefR gene promoter region underwent successful, seamless in-situ promoter substitution, 1200 bp and 1200 bp DNA fragments were amplified. Four out of 15 transformants successfully amplified the target DNA fragment, indicating that the residual hygromycin resistance gene selection marker was successfully removed after in-situ substitution of the cefR gene promoter in the engineered *Cephalosporin* fungus.

[0084] The verified positive transformants were further streaked on plates for 5 generations. After confirming the results by combining red fluorescence inactivation and hygromycin resistance inactivation, and using the above-mentioned method of extracting genomic DNA as a template for PCR verification, a homozygous cefR gene promoter was obtained, which was replaced in situ. The residual hygromycin resistance gene selection marker was successfully removed, and the ku70 gene and sorB gene were knocked out without scarring. The resulting recombinant Cephalosporium strain was Ac-PgpdA-cefR-2 (Ac-Δx+1).

[0085] This invention utilizes CRISPR-Cas9 scarless gene editing to sequentially knock out the ku70 gene, the sorB gene, and replace the strong promoter PgpdA in situ upstream of the cefR gene. Simultaneously, it achieves zero residue of the selection marker and Cas9 nuclease-encoding gene in the engineered *Cephalospora* strain, making it a highly efficient scarless gene editing system for *Cephalospora*.

[0086] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for scarless gene editing in *Cephalosporium* based on the CRISPR-Cas9 system, characterized in that, Includes the following steps: A CRISPR-Cas9 gene editing DNA fragment containing a Cas9 nuclease-encoded gene expression cassette and a target sgRNA expression cassette was constructed. A homologous recombination donor plasmid containing upstream and downstream homologous arm sequences of the target sequence was designed. The CRISPR-Cas9 gene editing DNA fragment and the donor plasmid were co-transformed into *Cephalospora* protoplasts via PEG-mediated protoplast transformation to achieve target gene editing. Simultaneously, a scarless knockout donor plasmid was constructed and transformed to remove residual resistance selection marker genes in the edited strain.

2. The method according to claim 1, characterized in that, The Cas9 nuclease-encoded gene expression cassette comprises the Cas9 gene, a promoter Pmbf1 operatively linked to the Cas9 gene, and a terminator TtrpC1. The nucleotide sequence of the promoter Pmbf1 is shown in SEQ ID NO.1, the nucleotide sequence of the Cas9 gene is shown in SEQ ID NO.2, and the nucleotide sequence of the terminator TtrpC1 is shown in SEQ ID NO.

3. The sgRNA expression cassette comprises a P5S promoter from *Cephalosporium*, a 5sRNA-encoded fragment, and an sgRNA fragment from *Aspergillus nidus*. The nucleotide sequence of the P5S promoter is shown in SEQ ID NO.4, the nucleotide sequence of the 5sRNA-encoded fragment is shown in SEQ ID NO.5, and the nucleotide sequence of the sgRNA fragment is shown in SEQ ID NO.

6. The bases from the 1st to the 20th nt of the sgRNA nucleotide sequence shown in SEQ ID NO.6 can be substituted according to the specific target gene.

3. The method according to claim 1, characterized in that, The *Acetospora* strain is a high-yield industrial strain of *Acetospora*; the target sequence is any functional gene coding region or gene regulatory region of *Acetospora*, and the gene regulatory region is a gene promoter region.

4. The method according to claim 1, characterized in that, The construction of the homologous recombination donor plasmid includes: selecting 1000-1500 bp homologous arms upstream and downstream of the target sequence, an anti-resistance marker gene expression cassette, and introducing, as needed, the complementary target DNA sequence of sgRNA for the next round of gene editing and / or a fluorescent protein expression cassette; amplifying the vector backbone using plasmid pUC19 as a template; and seamlessly cloning and ligating the upstream and downstream homologous arms, the anti-resistance selection marker gene expression cassette, and the introduced sequence with the pUC19 vector backbone to obtain the homologous recombination donor plasmid.

5. The method according to claim 4, characterized in that, The resistance selection marker gene expression cassette includes a resistance gene, a promoter, and a terminator. The resistance gene is either the hygromycin phosphotransferase (hph) gene or the bleomycin resistance gene (ble). The sequence of the hygromycin phosphotransferase (hph) gene is shown in SEQ ID NO. 7, and the sequence of the bleomycin resistance gene (ble) is shown in SEQ ID NO.

8. The promoter is the PtrpC promoter, and its nucleotide sequence is shown in SEQ ID NO.

9. The terminator is either the TtrpC1 terminator or the TtrpC2 terminator, and their nucleotide sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 10, respectively. The fluorescent protein expression cassette is an expression cassette composed of the red fluorescent protein mScarlet gene operatively linked to the promoter PgpdA and Ttef1 as the terminator for this gene. The nucleotide sequence of the promoter PgpdA is shown in SEQ ID NO. 11, the nucleotide sequence of the mScarlet gene is shown in SEQ ID NO. 12, and the nucleotide sequence of the terminator Ttef1 is shown in SEQ ID NO.

10. Shown in NO.

13.

6. The method according to claim 1, characterized in that, The construction of the scarless knockout donor plasmid includes: selecting 1000bp-1500bp homologous arms upstream and downstream of the site where the resistance selection marker gene to be removed is located; amplifying the vector backbone using plasmid pUC19 as a template; seamlessly cloning and ligating the upstream and downstream homologous arms with the pUC19 vector backbone to obtain a scarless knockout donor plasmid without the resistance selection marker gene, without the fluorescent protein expression cassette, and without the complementary target DNA sequence of the sgRNA for the next round of gene editing.

7. The method according to claim 1, characterized in that, The gene-edited strains were identified using PCR. Validation primers were designed to cross the outer edge of the homologous arm of the target sequence and the regions of the resistance gene and / or fluorescent protein gene. The editing effect was verified based on the size of the amplified fragment. Positive transformants were passaged multiple times and then validated again by PCR to obtain homozygous gene-edited *Cephalospora* engineered strains.

8. The method according to claim 1, characterized in that, When performing multiple rounds of continuous gene editing, the complementary target DNA sequence of the sgRNA for the next round of gene editing is introduced into the homologous recombination donor plasmid constructed in each round. During each round of gene editing, the scarless knockout donor plasmid of the resistance selection marker gene from the previous round is added simultaneously, so that multiple rounds of gene editing and the scarless removal of the resistance selection marker from the previous round can be carried out simultaneously.

9. The recombinant cephalosporin engineered strain prepared using the method according to any one of claims 1-8, characterized in that, The genome of the target sequence has been edited and does not contain resistance selection marker genes or fluorescent protein encoding genes. The target sequence is any functional gene coding region or gene regulatory region of Cephalosporium, and the gene regulatory region is the gene promoter region.

10. The application of the method according to any one of claims 1-8 in the genetic engineering modification of industrial strains of Cephalosporium, characterized in that, By knocking out, knocking in, or replacing any functional gene regulatory region in *Cephalosporium*, the metabolic pathway of *Cephalosporium* can be optimized, thereby improving the fermentation production efficiency of cephalosporin C.