A molecular marker related to sulfuryl metabolite content in tea plant and application thereof
By screening tea germplasm resources through whole-genome association analysis and super-epigenesis technology, the problem of low breeding efficiency in existing technologies has been solved, and rapid and accurate screening of tea varieties with high sulfone metabolite content has been achieved, thereby improving breeding efficiency.
Patent Information
- Application Number
- CN202510040276.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-10
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2045-01-10
AI Technical Summary
Existing technologies lack a rapid and accurate method to screen tea germplasm resources with high sulfone metabolite content, resulting in low breeding efficiency.
The tea tree sulfotransferase gene CsST2A and its related molecular markers were developed. Through whole-genome association analysis and overexpression technology, specific primer pairs were used for PCR amplification and sequencing to screen out tea tree germplasm with high sulfo metabolite content.
It has achieved rapid screening of tea varieties with high sulfone metabolite content, shortened the breeding period and improved breeding efficiency.
Smart Images

Figure CN119752835B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology, in particular to a molecular marker related to the content of sulfonyl metabolites in tea plants and an application thereof. Background Art
[0002] The biochemical reaction in which different sulfotransferases introduce sulfonic acid groups (-SO3H) into metabolite molecules is called metabolite sulfonation. Sulfonation of small and large biomolecules is crucial for bioactivity by altering the biological and physical properties of molecules such as polysaccharides, proteins, hormones, and lipids. While these reactions have been widely explored in biosynthesis and medicine, little research has been conducted on sulfonation in plants.
[0003] Under normal conditions, sulfotransferase gene expression is high, and various hormone metabolites such as jasmonic acid undergo sulfonation, reducing the levels of these hormones and promoting growth. Under adverse conditions, sulfotransferase expression decreases, while the levels of various sulfo metabolites, such as jasmonic acid, increase, contributing to the plant's resistance to adversity. This suggests that metabolite sulfonation and its regulatory mechanisms are closely linked to the environment and participate in the regulation of growth and stress resistance in tea plants.
[0004] Therefore, there is an urgent need to develop a precise and rapid screening method for tea germplasm resources, so as to quickly and accurately screen out tea germplasm resources with high sulfone metabolite content and improve breeding efficiency. Summary of the Invention
[0005] The present invention aims to provide a molecular marker related to the content of sulfometabolites in tea plants and its application to address the above-mentioned problems in the prior art. The molecular marker can be used to quickly screen tea varieties with high sulfometabolite content, helping to shorten breeding years and improve breeding efficiency.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a tea tree sulfotransferase, the amino acid sequence of which is shown in SEQ ID NO.6.
[0008] The present invention also provides a tea plant sulfotransferase gene, the nucleotide sequence of which is shown in SEQ ID NO.5.
[0009] The present invention also provides the use of the tea tree sulfotransferase or tea tree sulfotransferase gene in increasing the content of sulfo metabolites in plants.
[0010] Furthermore, the content of sulfo metabolites in the plant is increased by overexpressing the tea tree sulfotransferase in the plant.
[0011] The application further provides a molecular marker related to the content of sulfo-metabolites in tea plants, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 2; and a SNP site exists at the 147th base of the nucleotide sequence, which is a C / A mutation.
[0012] The application further provides a primer pair for amplifying the above-mentioned molecular marker, which comprises a forward primer with a nucleotide sequence shown as SEQ ID NO. 3 and a reverse primer with a nucleotide sequence shown as SEQ ID NO. 4.
[0013] The application further provides application of the above-mentioned primer pair in preparation of a kit for screening tea plant germplasm with high content of sulfo-metabolites.
[0014] The application further provides a kit for screening tea plant germplasm with high content of sulfo-metabolites, which comprises the above-mentioned primer pair.
[0015] The application further provides application of the above-mentioned molecular marker, primer pair or kit in screening tea plant germplasm with high content of sulfo-metabolites.
[0016] The application further provides a method for screening tea plant germplasm with high content of sulfo-metabolites, which comprises the following steps:
[0017] The cDNA of the tea plant to be detected is used as a template, and the above-mentioned primer pair is used for PCR amplification to obtain an amplification product;
[0018] The amplification product is sequenced and genotyped; and the content level of sulfo-metabolites of the tea plant to be detected is determined according to the genotyping result: the content of sulfo-metabolites of the tea plant with a CC genotype is higher than that of the tea plants with AC and AA genotypes.
[0019] The application discloses the following technical effects:
[0020] The application finds a gene CsST2A for controlling the content of multiple sulfo-metabolites by a whole genome association analysis method, which encodes a sulfo-transferase CsST2A of tea plants.
[0021] The application further develops a molecular marker related to the content of sulfo-metabolites in tea plants, which can be used for quickly screening tea plant varieties with high content of sulfo-metabolites, and is helpful for shortening the breeding period and improving the breeding efficiency. BRIEF DESCRIPTION OF DRAWINGS
[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative effort.
[0023] Figure 1 Figure for identification result of whole genome association analysis; wherein, A is the relative content distribution graph of metabolite cmp911 (sulfoxylated eugenol); B is the sample quantile-total quantile graph (Quantile-Quantile graph); C is the Manhattan graph;
[0024] Figure 2 Figure for content statistics of sulfoxylated metabolites cmp778 (a) and cmp911 (b) in different genotypic tea materials; wherein, CENO_A represents CC genotype; CENO_AB represents AC genotype; CENO_B represents AA genotype;
[0025] Figure 3 Figure for detection result of sulfoxylated metabolite content after transient overexpression of sulfo transferase gene in tobacco; wherein, ST2A1-3 represents overexpressed tobacco; EV1-3 represents wild type tobacco. DETAILED DESCRIPTION
[0026] The detailed description of the various exemplary embodiments of the present application is not to be considered as limiting the present application, but rather as a description of certain aspects, features and embodiments of the present application.
[0027] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the stated range, and any other stated value or intermediate value in the stated range, is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. All publications mentioned in the specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference in the specification is not an admission that it is prior art with respect to the present application.
[0029] Many modifications and variations to the illustrative embodiments described herein will be apparent to those of ordinary skill in the art from the foregoing description. Such modifications and variations are intended to fall within the scope of the present application. Other embodiments will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The examples and embodiments described herein are exemplary only.
[0030] As used herein, the terms “comprises”, “comprising”, “includes”, “including”, “has”, “having” or variants thereof are open-ended, and specifically do not exclude additional, unrecited elements or method steps.
[0031] The secondary mass spectrometry detection results of sulfuryl metabolites cmp911 (sulfocymene) and cmp778 (unknown sulfuryl metabolite) appearing in the following examples are shown in Table 1. The chemical structural formula of sulfocymene is as follows:
[0032]
[0033] Table 1 Secondary mass spectrometry detection results of sulfuryl metabolites cmp911 and cmp778
[0034]
[0035] Example 1 Location of sulfuryl transferase gene CsST2A
[0036] The present application collects 220 tea germplasm resources (Table 2), analyzes the transcriptome mRNA of tea Fudingdabaiguo with the genome of tea Fudingdabaiguo as the reference genome, and obtains the genotype files of 220 tea. At the same time, the flower and leaf of 220 tea germplasm resources are qualitatively and quantitatively analyzed by LC-MS, 170 sulfuryl metabolites are identified in tea according to the characteristic ion fragments of sulfuryl metabolites, and the content of metabolites is used as phenotype data and genotype data for correlation analysis. A significant correlation QTL located on chromosome 9 of FDDB tea genome is found, and sulfuryl transferase gene CsST2A (SEQ ID NO. 1) is identified in the QTL, which contains CDS region variation affecting the content of sulfuryl metabolites. Figure 1
[0037] Based on the variation, the present application develops a molecular marker, and the nucleotide sequence thereof is shown as SEQ ID NO. 2.
[0038] SEQ ID NO. 1:
[0039] atggaaaacactcaaggaagggaaagcaatccaatcatcagagacaaagaagaagaagaagatggccatgacaatccactagcattgcttcccaaagagaagggatggataggtctggatctctatctctaccaaggcttttggtg mccctcaatggaaattcagcgagtaatgtctttccaacaacacttcaaagctcaggacaccgacctcatactcgccaccatgcccaaatcaggcaccacctggttgaaggccttgacattcgctatcgccaaccgtcatcgctacaccaacacgctttcccaacacccccttctcacttccaaccctcacgacctcatcccttttcacgagatcaatctctctgctaataaagacggccatcaagacagtcatattctaaacctctccaactttcagtctagcattttctccacccatatgccataccattcattacctgactcaatcaagacctctaattgtcgcgttgtttatctctgtcgcaatccctacgacgcctttgtctccgcctggcatttcttgtctaagcctagaccagagagccttgagcctctatcgtgtattgatgcttttgacatgtattgtaggggtgtcatcggttttgggcccttctgggacaatgtattggggtactggaaggagagcctgaagaggcctcaaaaggtgctgtttttgatgtacgaggacttgaaagaagatattatttttcagatgaagaggctagcagagtttatgagcgttccgttctctttagaggaagagagtgaaggtgtgatagaagagatatcaaggttgtgcaactttaacaatatgagagagttggaggtgaacaaaactggtaaattccttggacactttgagaatgagacgctcttcaggagaggtgaagtgggtgattggatcaatcattttacacctgagatggtggaacgcttgaacaaggtcattgaagaaaagttgggaggctctgggctccaccactcacaattgttaccaatgcag,m为c或a。
[0040] SEQ ID NO.2:
[0041] atggaaaacactcaaggaagggaaagcaatccaatcatcagagacaaagaagaagaagaagatggccatgacaatccactagcattgcttcccaaagagaagggatggataggtctggatctctatctctaccaaggcttttggtg m ccctcaatggaaattcagcgagtaatgtctttccaacaacacttcaaagctcaggacaccgacctcatactcgccaccatgcccaaatcaggcaccacctggttgaaggccttgacattcgctatcgccaaccgtcatcgctacaccaacacgctttcccaacacccccttctcacttccaaccctcacgacctcatcccttttcacgagatcaatctctctgctaataaagacggccatcaagacagtcatattctaaacctctccaactttcagtctagcattttctccacccatatgccata, m is c or a.
[0042] Table 2 220 tea tree germplasm resources
[0043]
[0044]
[0045]
[0046] Example 2 Correlation of CDS region variation with sulfo-metabolite content
[0047] Leaf mRNA was extracted, and after library construction, second-generation transcriptome sequencing was directly performed. The sequencing results were aligned to the FDDB genome to obtain the genotype information of the tea tree sample, and the nucleotide C / A variation located at the start codon 147bp of the CsST2A region was identified. The following primers were designed:
[0048] Forward primer: 5'-atggaaaacactcaaggaagg-3' (SEQ ID NO. 3);
[0049] Reverse primer: 5'-tatggcatatgggtggagaa-3' (SEQ ID NO. 4).
[0050] According to the sequencing result, it is found that a SNP site is located at 147 bp from the start codon in the CsST2A region, which is a C / A base mutation. When the base of the mutation site is C, the protein has normal activity, at this time, the coding gene is CsST2A-1 with the nucleotide sequence as shown in SEQ ID NO. 5, and the amino acid sequence of the encoded sulfotransferase is as shown in SEQ ID NO. 6; when the base of the mutation site is A, it is a stop codon, the protein does not have normal activity, and the coding gene is CsST2A-2 with the nucleotide sequence as shown in SEQ ID NO. 7, and the amino acid sequence of the encoded sulfotransferase is as shown in SEQ ID NO. 8.
[0051] The genotype and the contents of sulfone metabolites cmp911 and cmp778 of 220 tea tree materials are detected, and it is found that the contents of sulfone metabolites cmp911 and cmp778 of tea tree materials with genotype CC are significantly higher than those of materials with genotype AA and AC. Figure 2 )。
[0052] The nucleotide sequence of the gene CsST2A-1 (SEQ ID NO. 5):
[0053]
[0054] Amino acid sequence of the sulfotransferase encoded by the gene CsST2A-1 (SEQ ID NO. 6):
[0055] MENTQGRESNPIIRDKEEEEDGHDNPLALLPKEKGWIGLDLYLYQGFWCPSMEIQRVMSFQQHFKAQDTDLILATMPKSGTTWLKALTFAIANRHRYTNTLSQHPLLTSNPHDLIPFHEINLSANKDGHQDSHILNLSNFQSSIFSTHMPYHSLPDSIKTSNCRVVYLCRNPYDAFVSAWHFLSKPRPESLEPLSCIDAFDMYCRGVIGFGPFWDNVLGYWKESLKRPQKVLFLMYEDLKEDIIFQMKRLAEFMSVPFSLEEESEGVIEEISRLCNFNNMRELEVNKTGKFLGHFENETLFRRGEVGDWINHFTPEMVERLNKVIEEKLGGSGLHHSQLLPMQ.
[0056] Nucleotide sequence of the gene CsST2A-2 (SEQ ID NO. 7):
[0057]
[0058] Amino acid sequence of sulfotransferase encoded by gene CsST2A-2 (SEQ ID NO. 8):
[0059] MENTQGRESNPIIRDKEEEEDGHDNPLALLPKEKGWIGLDLYLYQGFW* (* represents a termination mutation).
[0060] Example 3 Functional analysis of sulfotransferase
[0061] By transiently overexpressing CsST2A-2 gene in tobacco and injecting PAPS (3'-phosphoadenosine 5'-phosphosulfate) substrate, after 3 days, non-targeted metabolomics detection was performed on tobacco leaves, and 445 sulfone metabolites were identified by characteristic ion fragments 79.956, 96.959, which were different from the control group (t-test <0.05, |Log2(fold change)|>1). According to the above results, further analysis found that among the 445 sulfone metabolites identified in tobacco, 398 sulfone metabolites in the positive tobacco overexpressing CsST2A-1 gene were higher than the control, and only 47 sulfone metabolites were lower than the control, as shown in Table 1. Figure 3
[0062] The above-described embodiments are only descriptions of the preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art shall fall within the protection scope determined by the claims of the present application.
Claims
1. Use of a primer pair for amplifying molecular markers in the preparation of a kit for screening tea germplasm with high sulfonate metabolite content; The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 2; there is a SNP site at the 147th base of the nucleotide sequence, which is a C / A mutation; The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; The sulfo metabolite is sulfoeugenol, and its chemical structure is as follows: 。 2. Use of a molecular marker, primer pair or kit for screening tea germplasm with high sulfone metabolite content; The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 2; there is a SNP site at the 147th base of the nucleotide sequence, which is a C / A mutation; The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; The kit includes the primer pair; The sulfo metabolite is sulfoeugenol, and its chemical structure is as follows: 。 3. A method for screening tea plant germplasm with high sulfone metabolite content, characterized in that: The following steps are involved: Using the cDNA of the tea plant to be tested as a template, PCR amplification was performed using a primer pair to obtain an amplified product; Sequencing and genotyping the amplified products; judging the sulfometabolite content level of the tea plant to be tested according to the genotyping results: the sulfometabolite content of the CC genotype tea plant is higher than that of the AC and AA genotypes; The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; The sulfo metabolite is sulfoeugenol, and its chemical structure is as follows: 。
Citation Information
Patent Citations
Tea tree flavonoid glycosyl transferase and application thereof
CN116004563A
A neural specific cystosolic sulfotransferase for drug screening
WO2002018541A2