Microbial remediation agent for heavy metal remediation and preparation method and application thereof

By preparing a microbial remediation agent loaded with Pseudomonas aeruginosa, and utilizing the co-precipitation and adsorption-reduction effects of the carrier material, the problems of poor remediation effect and high cost in the treatment of heavy metal pollution in lead-zinc tailings ponds were solved, achieving efficient and environmentally friendly heavy metal pollution remediation.

CN119752872BActive Publication Date: 2026-05-01SOUTH CHINA NORMAL UNIV +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411657288.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2026-05-01
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

Existing technologies for the remediation of heavy metal pollution in lead-zinc tailings ponds suffer from problems such as poor remediation effects, high costs, and the potential for secondary pollution, and there is a lack of highly efficient microbial remediation agents.

Method used

Microbial remediation agents were prepared by loading Pseudomonas aeruginosa onto a carrier composed of Chlorella proteolyticum liquid, silicon fertilizer, and nano-zero-valent iron. The carrier reduced heavy metal toxicity through co-precipitation, adsorption, and reduction.

Benefits of technology

It maintains high remediation capacity in oligotrophic environments, reduces heavy metal toxicity and migration, is low-cost, environmentally friendly and pollution-free, and is suitable for the remediation of heavy metal pollution in lead-zinc tailings ponds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005142385700000071
    Figure BDA0005142385700000071
  • Figure HDA0005142385710000011
    Figure HDA0005142385710000011
  • Figure HDA0005142385710000021
    Figure HDA0005142385710000021
Patent Text Reader

Abstract

The application discloses a microbial remediation agent for heavy metal remediation and a preparation method and application thereof, and is prepared by loading pseudomonas aeruginosa on a carrier; the carrier comprises the following components in parts by weight: 8-22 parts of chlorella vulgaris algae liquid, 1-3 parts of silicon fertilizer, and 1-3 parts of nano zero-valent iron; the silicon fertilizer is obtained by calcining a mixture of granite stone powder, marble powder and alkali activator at a mass ratio of 8-12:0-12:0.5-4; and the alkali activator is solid sodium hydroxide or potassium hydroxide. The microbial remediation agent has high activity, fast reproduction, is environment-friendly and pollution-free, and is low in cost; can change the form of heavy metals, converts the heavy metals from a high-toxicity form into a low-toxicity form, reduces the toxicity and migration of the heavy metals, and significantly reduces the pollution caused by the heavy metals.
Need to check novelty before this filing date? Find Prior Art

Description

A microbial remediation agent for heavy metal remediation, its preparation method and application Technical Field

[0001] This invention relates to the field of heavy metal pollution remediation technology, specifically to a microbial remediation agent for heavy metal remediation, its preparation method, and its application. Background Technology

[0002] Heavy metals are a typical global environmental pollutant. Due to their bioaccumulation, reluctance to degrade, and high toxicity, they pose a high potential environmental pollution risk and have long been a research hotspot for many scholars and a focus of public concern. Recent studies have shown that mining activities have become one of the most significant sources of heavy metal pollution in the environment.

[0003] Lead-zinc tailings refer to the waste generated during lead-zinc ore beneficiation, and are a type of traditional mining waste. Lead-zinc tailings mainly originate from beneficiation plants or tailings ponds. Tailings ponds are constructed by damming valleys or enclosing land to store tailings or other industrial waste discharged after ore beneficiation in metallic or non-metallic mines. The main components of lead-zinc tailings include silicate minerals, clay minerals, sulfide minerals, and oxide minerals. They also contain large amounts of toxic and harmful elements such as lead, zinc, arsenic, mercury, and cadmium. The large accumulation of lead-zinc tailings in tailings ponds causes significant heavy metal pollution, which poses a serious threat to the environment if left untreated.

[0004] There is currently no unified definition for the forms of heavy metals in soil. However, according to the definition of the International Union of Applied Chemistry (IUPAC), the meaning of "form" can be generally summarized into two types: (1) chemical species, which refers to the actual form in which an element exists in the environment as a certain ion or molecule; and (2) forms of occurrence, which refers to the actual form in which an element exists in the environment with certain characteristics (physical, chemical, or geological). The biotoxicity of heavy metals is not only related to their total amount, but also depends to a greater extent on their form distribution. After entering the soil, heavy metals of various forms undergo various reactions such as dissolution, precipitation, coagulation, and complexation adsorption to form different forms, and their migration and transformation characteristics, bioavailability (toxicity), and environmental effects are also different. Generally speaking, the exchangeable form and carbonate-bound form of heavy metals are the effective forms, which have high toxicity; the iron and manganese oxide-bound form, the organic matter-bound form, and the residue form are the stable forms, which have low toxicity.

[0005] To address heavy metal pollution in mine tailings ponds, traditional remediation methods primarily employ physical and chemical approaches. Physical methods, such as composting and soil mixing, can slow the spread of pollutants but cannot completely remove heavy metals. Chemical methods, including adsorption, ion exchange, and reduction precipitation, can remove heavy metals to some extent, but often require large amounts of chemical reagents and energy, and suffer from secondary pollution and high costs. In contrast to traditional remediation methods, microbial remediation has attracted significant attention in recent years and is considered a promising new remediation technology. Microbial remediation utilizes the metabolic activities of microorganisms to convert heavy metal ions into inactive or poorly soluble precipitates, thereby reducing their toxicity and mobility. It offers advantages such as ease of operation, low cost, and environmental friendliness. Currently, however, there is a lack of highly effective microbial remediation agents for heavy metal remediation in lead-zinc tailings. Summary of the Invention

[0006] The purpose of this invention is to address the above-mentioned problems by providing a microbial remediation agent for heavy metal remediation, its preparation method, and its application.

[0007] To achieve its objective, the present invention employs the following technical solution:

[0008] The first aspect of the present invention provides a microbial remediation agent for heavy metal remediation, which is prepared by loading Pseudomonas aeruginosa onto a carrier; the carrier comprises the following components in the following weight ratio: 8-22 parts of Chlorella pyrenoidosa algal solution, 1-3 parts of silicon fertilizer, and 1-3 parts of nano-zero valent iron.

[0009] The silicon fertilizer is prepared by mixing granite powder, marble powder, and alkali activator in a mass ratio of 8-12:0-12:0.5-4, calcining the mixture at 600-1000℃ to obtain particles of 60-200 mesh.

[0010] The alkaline activator is solid sodium hydroxide or potassium hydroxide.

[0011] Preferably, in the microbial remediation agent, the cell number concentration of the Chlorella proteoglycans solution is 10. 6 ~10 9 / mL;

[0012] The microbial remediation agent is prepared at a concentration of 1.0 × 10⁻⁶. 7 ~2.0×10 8 The CFU / mL Pseudomonas aeruginosa bacterial suspension was mixed with the carrier at a mass ratio of 1 to 3:1 and then freeze-dried to obtain a powder.

[0013] The silicon fertilizer is prepared into 80-150 mesh particles by mixing granite powder, marble powder, and alkali activator in a mass ratio of 8-12:2-8:1-3 (preferably 9-10:2-4:1.5-2.5) and calcining at 700-900℃ for 20-120 minutes (preferably 40-80 minutes).

[0014] The carrier comprises the following components in the following weight ratios: 10-20 parts of Chlorella proteoglycans algal solution, 1-3 parts of silicon fertilizer, and 1-3 parts of nano-zero-valent iron; or, the carrier comprises the following components in the following weight ratios: 10-15 parts of Chlorella proteoglycans algal solution, 1-2 parts of silicon fertilizer, and 1-2 parts of nano-zero-valent iron; preferably: 10-13 parts of Chlorella proteoglycans algal solution, 1-1.5 parts of silicon fertilizer, and 1-1.5 parts of nano-zero-valent iron; more preferably, 10 parts of Chlorella proteoglycans algal solution, 1 part of silicon fertilizer, and 1 part of nano-zero-valent iron.

[0015] The heavy metals include Pb, Zn, Cd, and Cr;

[0016] The *Pseudomonas aeruginosa* strain described is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31703.

[0017] A second aspect of the present invention provides a method for preparing the microbial remediation agent described in any of the above claims, comprising the following steps: taking Pseudomonas aeruginosa bacterial suspension and a carrier, mixing them evenly in a certain proportion, and thus obtaining the agent.

[0018] Specifically, the above preparation method includes the following steps:

[0019] (1) Preparation of Pseudomonas aeruginosa bacterial culture:

[0020] Pseudomonas aeruginosa was inoculated into the culture medium for expansion culture until OD200 was reached. 600 After centrifugation to a concentration of 0.5–1.2 (preferably 0.8–1.2), the bacterial cells are collected and then resuspended in PBS buffer, physiological saline, or sterile water to the set concentration.

[0021] (2) Preparation of carrier

[0022] Silicon fertilizer preparation: Granite powder, marble powder, and alkali activator are mixed in a certain mass ratio and calcined at 600-1000℃ for 20-120 minutes to prepare 60-200 mesh particles.

[0023] Preparation of Chlorella proteoglycans culture: Chlorella proteoglycans inoculum is inoculated into the culture medium and cultured until the lag phase to the stationary phase (preferably the logarithmic growth phase to the stationary phase). The algae are then collected by centrifugation and resuspended in sterile water, physiological saline, or PBS buffer to a cell count concentration of 102. 6 ~10 9 / mL;

[0024] The carrier was obtained by mixing Chlorella pyrenoidosa algal solution, silicon fertilizer, and nano-zero valent iron in a certain proportion;

[0025] (3) Preparation of microbial remediation agents

[0026] Take the prepared Pseudomonas aeruginosa bacterial suspension and the carrier, mix them evenly according to the ratio, and you will get the final product.

[0027] In step (3), the prepared Pseudomonas aeruginosa bacterial solution and carrier are taken, mixed evenly according to the ratio, and then centrifuged to collect the precipitate, thus obtaining the product;

[0028] Preferably, the precipitate is freeze-dried into powder to obtain the microbial remediation agent. The specific steps are as follows: take the prepared Pseudomonas aeruginosa bacterial solution and the carrier, mix them evenly according to the ratio, centrifuge at 4-10℃, discard the supernatant, collect the precipitate, add a freeze-drying protectant at 8-12 wt% of the weight of the precipitate, mix well, and freeze-dry using a vacuum freeze dryer to obtain the product; preferably, the freeze-drying protectant is trehalose.

[0029] A third aspect of the present invention provides the application of the microbial remediation agent described in any of the preceding claims in the remediation of heavy metal pollution in the environment, said environment including heavy metal contaminated soil, tailings, and tailings ponds.

[0030] In the above application technical solution, the heavy metals include Pb, Zn, Cd, and Cr; add 3-7 grams (preferably 4-6 grams) of microbial remediation agent to each 0.05 cubic meter of sample to be treated, apply the microbial remediation agent to the sample to be treated, mix evenly, and let stand for 3-7 days (preferably 4-6 days), maintaining the humidity of the sample at 60±10% during the remediation period.

[0031] Preferably, the microbial remediation agent is applied every 3 to 7 days (preferably 4 to 6 days), and after application, the mixture is left to stand. The microbial remediation agent is applied repeatedly until the toxic forms of heavy metals are reduced to below the target concentration.

[0032] Preferably, in the above application technical solution, the environment is a lead-zinc tailings pond, and the microbial remediation agent is sprayed on the lead-zinc tailings pond site, mixed evenly, and left to stand.

[0033] The beneficial effects of this invention are:

[0034] The microbial remediation agent provided by this invention fully utilizes industrial solid waste—waste and scraps from granite and marble processing—turning these materials into valuable resources. Granite has a high silicon content, and these industrial fertilizers can be used to prepare silicon fertilizer, which serves as a carrier for the *Pseudomonas aeruginosa* remediation agent. The active silicon in the remediation agent enhances the soil's adsorption capacity for heavy metals by forming co-precipitates with them, increasing the soil's cation exchange capacity (CEC) and organic matter (OM) content. Simultaneously, the active silicon has a high specific surface area, providing ample attachment sites for microorganisms, promoting their attachment and growth. Nano-zero-valent iron, through adsorption, reduction, precipitation, and co-precipitation, assists in the removal of various heavy metal ions. Nano-zero-valent iron also has a certain pH-regulating function, aiding in the colonization of microorganisms and algae in the tailings. The fermented algal liquid provides nutrients and additional carbon sources for microbial colonization, enhancing microbial activity and improving the remediation agent's environmental adaptability and stability, allowing it to maintain high remediation efficiency even in the high-pollution, low-nutrient, high-pressure environment of tailings.

[0035] The microbial remediation agent of this invention is highly active, reproduces rapidly, is environmentally friendly and pollution-free, and is low in cost. It can alter the form of heavy metals, transforming them from highly toxic forms to less toxic ones, thereby reducing their toxicity and mobility and significantly mitigating heavy metal pollution. This microbial remediation agent maintains good heavy metal remediation capabilities even under oligotrophic conditions, making it particularly suitable for heavy metal pollution control in lead-zinc tailings ponds in oligotrophic environments. It provides an efficient and feasible remediation agent and method for heavy metal pollution remediation in mine tailings ponds. Attached Figure Description

[0036] Figure 1 is a phylogenetic tree constructed from the 16S rRNA sequences of the screened strains.

[0037] Figure 2 shows the colony morphology of the screened Pseudomonas aeruginosa.

[0038] Figure 3 shows the growth curve of the screened Pseudomonas aeruginosa.

[0039] Figure 4 shows Pb under conditions with / without Pseudomonas aeruginosa. 2+ Comparison of removal effects.

[0040] Figure 5 shows the removal rates of Pseudomonas aeruginosa in low-concentration (A) and high-concentration (B) heavy metal culture media.

[0041] Figure 6 shows Pseudomonas aeruginosa and Pb. 2+ XPS spectrum of the product after reaction.

[0042] Figure 7 shows the removal rate of Pseudomonas aeruginosa under different carbon and nitrogen source conditions.

[0043] Figure 8 shows the material characterization (SEM, XPS) of the microbial remediation agent of the present invention.

[0044] Figure 9 shows the results of the conversion ability of the microbial remediation agent of the present invention to heavy metal forms. Detailed Implementation

[0045] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

[0046] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0047] Example 1: Removal of heavy metals by Pseudomonas aeruginosa QPBII-1

[0048] 1. Experimental Materials

[0049] 1.1 Sample Source

[0050] Lead-zinc tailings samples: Tailings samples were collected from the Fankou lead-zinc tailings remediation area in Guangdong Province, placed in sterile plastic self-sealing bags and brought back to the laboratory, where they were stored in a -20°C freezer.

[0051] 1.2 Culture medium

[0052] The screening medium contained the following components: Na2S2O3·5H2O (10 g / L); KNO3 (4 g / L); NaHCO3 (2 g / L); KH2PO4 (4 g / L); MgSO4·6H2O (1 g / L); CaCl2 (0.01 g / L); NH4Cl (1 g / L); peptone (10 g / L); yeast extract (5 g / L); NaCl (10 g / L).

[0053] The standard basal medium (LB) contains the following components: peptone (10 g / L); yeast extract (5 g / L); NaCl (10 g / L).

[0054] The liquid culture medium does not contain agar, while the solid culture medium is based on the liquid culture medium formula with agar added. The final concentration of agar in the culture medium is 15 g / L.

[0055] The culture medium was sterilized in a high-temperature, high-pressure autoclave at 121°C for 30 minutes before use.

[0056] 2 Experimental Methods

[0057] 2.1 Isolation, screening, and identification of target strains

[0058] 1. Isolation and screening of strains

[0059] Weigh 1g of tailings sample into a 15mL centrifuge tube. Add 9mL of sterilized PBS solution to a clean bench. Shake thoroughly at 160r / min for 30min, then let stand for 15min until complete separation to obtain the original tailings solution. Subsequently, serially dilute to a concentration of 10. -1 -10 -6 Tailings sample dilutions were prepared at multiples of 100 μL. 100 μL of each dilution was added to a solid screening medium and evenly distributed onto the medium using a spreader. Three replicates were prepared for each concentration gradient. The samples were then incubated at 37°C for 18 hours. After 18 hours, the samples were carefully observed. Once complete and independent colonies formed, they were promptly picked and cultured to determine the optimal tailings dilution concentration. Subsequently, single bacterial strains from different colonies were selected and cultured in a liquid enrichment medium, covered, and shaken at 37°C and 160 rpm.

[0060] Viscous, semi-transparent colonies were observed in the culture medium. Colonies were collected by dipping an inoculation loop into the liquid selection medium and streaked onto the solid selection medium to purify and isolate the bacteria. The bacteria were then cultured in a microbial incubator at 37°C for 18 hours.

[0061] Select individual colonies from the culture medium, pick them up with a pipette tip, and transfer them to fresh liquid selection medium. After several pipetting cycles, complete the purification. Depending on the colony's condition, pick 3-5 single colonies for further culture. Repeat this process three times to ensure that pure colonies are obtained.

[0062] 2. Strain identification

[0063] The strains were preliminarily identified based on Gram staining results, morphological characteristics, and physiological characteristics. Their 16S rRNA gene sequences were sequenced and compared with the NCBI database to confirm that the selected strains belonged to the genus *Pseudomonas*, and a phylogenetic tree was constructed.

[0064] Universal primers for 16S rDNA: 27F (5'-AGAGTTTGATCMTGGCTCAG-3', SEQ ID NO.2) and 1492R (5'-TACGGYTACCTTGTTAYGACTT-3', SEQ ID NO.3). Sequencing was performed by Guangdong Megagene Technology Co., Ltd.

[0065] 2.2 Verification of the removal effect of Pseudomonas aeruginosa on heavy metals

[0066] The selected Pseudomonas aeruginosa strains were cultured in liquid selection medium at 37°C until OD reached. 600 When the bacterial concentration is 1, the bacterial culture is collected for subsequent experiments. Two experimental groups are set up: a bacterial group and a sterile group.

[0067] Infected group: Take 1 mL of Pseudomonas aeruginosa bacterial suspension and inoculate it into 40 mL of Pb-containing solution. 2+ In LB liquid medium, Pb 2+ The initial concentration in LB liquid medium was 5 mg / L. The medium was placed in a constant temperature shaker at 37°C and cultured at 160 r / min. The heavy metal concentration in the samples was measured every 24 hours, and three parallel samples were set up for each concentration.

[0068] Sterile group: The experimental method is the same as that of the bacterial group, except that Pseudomonas aeruginosa bacterial solution is not added.

[0069] 2.3 Factors affecting bacterial strain removal rate

[0070] The selected Pseudomonas aeruginosa strains were cultured in liquid selection medium at 37°C until OD reached. 600 When the concentration is 1, the bacterial culture is used for subsequent experiments.

[0071] 1. Set up experimental groups with different heavy metal concentrations.

[0072] Take 1 mL of Pseudomonas aeruginosa bacterial suspension and inoculate it into 40 mL of solution containing 5 mg / L of different heavy metals (Pb). 2+ Zn 2+ Cd 2+ Cr 6+ The culture medium was placed in a constant temperature shaker at 37°C and cultured at 160 r / min. The initial concentration of heavy metals was determined after the culture medium and bacterial solution were mixed evenly. The concentration of heavy metals in the culture medium was measured every 24 hours, and three parallel samples were set up for each concentration.

[0073] Take 1 mL of Pseudomonas aeruginosa bacterial suspension and inoculate it into 40 mL of solution containing 50 mg / L of different heavy metals (Pb). 2+ Zn 2+ Cd 2+ Cr 6+ In LB medium, the medium was placed in a constant temperature shaker at 37°C and cultured at 160 r / min. The initial concentration of heavy metals was determined after the medium and bacterial solution were mixed evenly. The heavy metal concentration in the sample was measured every 24 hours, and three parallel samples were set up for each concentration.

[0074] 2. Set up experimental groups with additional carbon and nitrogen sources.

[0075] The experimental group with added carbon and nitrogen sources: physiological saline containing 5 mg / L heavy metals, 0.5 wt% glucose, and 0.5 wt% sodium nitrite. Two control groups were also set up:

[0076] Sample group without additional carbon source: that is, physiological saline without glucose, containing 5 mg / L heavy metals + 0.5 wt% sodium nitrite;

[0077] Sample group without additional nitrogen source: that is, physiological saline without sodium nitrite, containing 5 mg / L heavy metals + 0.5 wt% glucose.

[0078] Take 1 mL of Pseudomonas aeruginosa bacterial culture and inoculate it into 40 mL of physiological saline (three experimental groups were conducted, one with an additional carbon source and nitrogen source, one without an additional carbon source, and one without an additional nitrogen source). Then, place it in a constant temperature shaker at 30℃ and culture it at 160 r / min. Take a sample every 24 hours to determine the heavy metal concentration in the sample. Set up 3 parallel samples for each concentration.

[0079] 3. Methods for determining heavy metals

[0080] The collected samples were centrifuged at 4000 r / min for 5 min using a refrigerated centrifuge and filtered through a 0.45 μm filter membrane. The supernatant was used to determine the heavy metal concentration, and the heavy metal ions (Pb) were determined by atomic absorption spectrometry (F-AAS). 2+ Zn 2+ Cd 2+ Cr 6 + )concentration:

[0081] F-AAS instrument testing conditions: wavelength: 283.3 nm; slit width: 1.3 mm; lamp current: 7.5 mA; flame type: Air-C2H2; gas flow rate: 2 L / min; oxidizing gas flow rate: 15 L / min. Standard solutions with concentrations of 0, 1, 5, 10, 15, and 20 mg / L were measured, and standard curves were automatically generated by the flame atomic absorption spectrometer.

[0082] The formula for calculating the heavy metal removal rate is:

[0083]

[0084] In the formula:

[0085] C0 — Concentration of heavy metal ions before treatment;

[0086] C i —Concentration of heavy metal ions after treatment.

[0087] 3. Experimental Results and Analysis

[0088] 3.1 Identification of the target strain

[0089] A strain (number: QPBII-1) was isolated by screening using a selection medium. Single colonies were isolated by streaking on solid medium and incubated at 37℃ for 18 hours, forming 1-2 mm yellow-green colonies with neat, moist edges and a raised center. The colony morphology is shown in Figure 2. After Gram staining, microscopic examination revealed that the Pseudomonas was a Gram-negative bacterium with a rod-shaped structure.

[0090] The isolated strain was identified by 16S rRNA, and the gene sequence was determined as follows (SEQ ID NO.1):

[0091] GGGAGCTTGCTCCTGGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACGTCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCAGCTAACGCGATAAGTCGACC。

[0092] Gene sequences were aligned using CLUSTALW, and a phylogenetic tree was constructed using the neighbor-joining method, as shown in Figure 1. According to sequence comparison analysis, the 16S rRNA gene sequence of the isolated strain showed 99.80% similarity to *Pseudomonas aeruginosa* strain QK-1, 99.90% similarity to *Pseudomonas sp. H-59*, and 99.90% similarity to *Pseudomonas aeruginosa* strain PZ25. All sequences in the phylogenetic tree (Figure 1) showed similarity exceeding 90%. Analysis of the bacterial isolate based on phenotypic and genotypic characteristics identified the isolate as *Pseudomonas aeruginosa*, a Gram-negative, motile species with polar flagella. Its colonies are smooth, raised, with intact, glossy edges, and appear yellow-green in LB solid medium.

[0093] Based on the growth curve measurements, the logarithmic growth phase of this bacterium is 4–8 hours. The growth curve of *Pseudomonas aeruginosa* (Figure 3) is a standard S-shaped curve, exhibiting distinct lag phase, logarithmic phase, stationary phase, and death phase. The bacterial culture enters the stationary phase at 12 hours and reaches OD. 600 =1. To ensure the stability and activity of the bacterial culture, the bacterial culture at 12 hours will be used for subsequent experiments.

[0094] The preservation information for Pseudomonas aeruginosa QPBII-1 is as follows:

[0095] Strain QPBII-1 was deposited in August 2024 by the China General Microbiological Culture Collection Center (CGMCC). The address of the depository is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; deposit date: August 23, 2024; deposit number: CGMCC No. 31703; classification and name: Pseudomonas aeruginosa.

[0096] 3.2 Pseudomonas aeruginosa's effect on Pb 2+ It has a removal effect

[0097] The experimental results of the bacterial and sterile groups are shown in Figure 4: Under the same culture medium but without the addition of Pseudomonas aeruginosa, Pb 2+ The concentration of Pb hardly changed over time, while in the bacterial group... 2+ The concentration gradually decreased over time, reaching a low level around 100 hours. 2+ The concentration is close to 0, indicating that Pb 2+The lower concentration is due to the action of Pseudomonas aeruginosa, rather than a reaction between the culture medium and heavy metals.

[0098] 3.3 Removal rate of various heavy metals by Pseudomonas aeruginosa

[0099] The removal rates of various heavy metals by Pseudomonas aeruginosa are shown in Figure 5.

[0100] At low concentrations (Figure 5A), Pseudomonas aeruginosa QPBII-1 significantly improved the removal efficiency of heavy metals: in the experimental group with an initial concentration of 5 mg / L, Pb... 2+ Zn 2+ Cd 2+ Cr 6+ The removal rates reached a maximum of 98.21%, 82.86%, 74.88%, and 85.68%, respectively.

[0101] At high concentrations (Figure 5B), the removal capacity of *Pseudomonas aeruginosa* was significantly reduced. When the initial heavy metal concentration was 50 mg / L, the removal rate of heavy metals by the strain decreased to 22.82% (Pb). 2+ ), 45.38% (Zn 2+ ), 52.78% (Cd 2+ ), 31.45% (Cr) 6+ This demonstrates that although Pseudomonas aeruginosa can grow at high concentrations, its ability to remove heavy metals is inhibited to some extent.

[0102] By comparing the highest removal rates of eight experimental groups with different heavy metals, the strain showed a better removal rate at lower heavy metal concentrations. As the heavy metal concentration increased, the bacteria's tolerance to heavy metals decreased, growth was inhibited, and the ability to remove metals remained at a low level. This indicates that Pseudomonas aeruginosa has a higher removal rate at low concentrations. As the initial heavy metal concentration increased, the effect of the strain on heavy metals weakened, possibly because high concentrations of heavy metals inhibited the strain's ability to degrade heavy metals.

[0103] Pseudomonas aeruginosa QPBII-1 with an initial concentration of 5 mg / L Pb 2+ XPS characterization of the post-reaction sediments revealed a Pb 4f peak at 136.73 eV (Fig. 6a), confirming the presence of Pb(0). Simultaneously, an O1s peak was observed at 530.53 eV (Fig. 6b), indicating that O exists as a metal oxide, thus confirming the presence of PbO. Considering the rapid oxidation of lead surfaces upon exposure to air, forming a PbO layer to protect Pb(0) from further oxidation, this demonstrates the possibility of Pb(0) oxidation in air. It also indicates that the strain utilizes mechanisms such as surface group adsorption and electron transfer to remove Pb from the aqueous solution. 2+It is reduced to Pb(0), and then oxidized in air to become PbO.

[0104] Reducing the concentration of free heavy metals in water bodies means decreasing the bioavailability of heavy metals in the environment. This is because ionic heavy metals are more easily absorbed directly by aquatic organisms, entering their bodies and increasing the risk of heavy metal exposure throughout the ecosystem. The effects of *Pseudomonas aeruginosa* QPBII-1 on metal ions may include: QPBII-1 captures and fixes ionic heavy metals in water through adsorption on its cell surface; simultaneously, it uses specific enzymes to biotransform heavy metal ions into insoluble metal sulfides, phosphates, or carbonates. These transformation products precipitate due to their extremely low solubility, further reducing the concentration of free heavy metals; QPBII-1 may also reduce the toxicity and migration capacity of heavy metals through bioreduction, such as reducing Pb(II) to Pb(O). These processes work synergistically to effectively reduce the migration and bioavailability of heavy metals in water bodies, thereby significantly reducing their toxic effects.

[0105] 3.4 Removal rate of bacterial strains under different carbon and nitrogen source conditions

[0106] The results, as shown in Figure 7, demonstrate that the removal rate of heavy metals by the target bacterium decreased under conditions without additional carbon and nitrogen sources, but it still maintained a relatively good removal function, with removal rates of all four heavy metals exceeding 40%. This ability may stem from the metabolic adaptability of the strain; they may compensate for insufficient external nutrients by utilizing internally stored nutrients or through other metabolic pathways, thereby maintaining their biological activity and heavy metal removal function.

[0107] This discovery further confirms the adaptability and functionality of the target single bacterium in maintaining its heavy metal removal function under oligotrophic conditions, indicating that its preparation as a microbial remediation agent has creative application value in environmental remediation and pollution control.

[0108] Example 2: Microbial Remediation Agent of the Present Invention

[0109] I. Preparation method of microbial remediation agent

[0110] A laboratory-prepared silicon fertilizer material with an average pore size of 3.408 nm and modified nano-zero-valent iron were used as carriers for the microbial remediation agent. The nutrient environment of the microbial remediation agent was improved by combining fermented Chlorella vulgaris broth. Subsequently, Pseudomonas aeruginosa inoculum was loaded onto the carrier to obtain the microbial remediation agent of this invention. The specific material ratios and preparation process are as follows:

[0111] 1. Nano-zero valent iron (nZVI) was synthesized in our laboratory:

[0112] Ferric chloride (FeSO4·7H2O) was selected as the precursor, and sodium borohydride (NaBH4) as the reducing agent. 2.00 g of FeSO4·7H2O was dissolved in 100 mL of ethanol-water solution (30% v / v) to obtain a ferrous ion solution; 1.08 g of NaBH4 was dissolved in 50 mL of ethanol-water solution (30% v / v) to obtain a sodium borohydride solution. The prepared ferrous ion solution and sodium borohydride solution were mixed, and ball milling was performed under conditions controlling the pH value at approximately 2-3. During the reaction, a large amount of black, fluffy solid appeared. After the reaction, the mixture was washed three times alternately with deoxygenated water and anhydrous ethanol, and then dried in a glove box under a nitrogen atmosphere to obtain pure nano-zero valent iron powder, which was stored in a dry environment at 4℃, avoiding light exposure. Before the experiment, the nZVI powder was ultrasonically treated for 30 minutes to ensure uniform dispersion. Nano-zero valent iron can also be purchased commercially available.

[0113] 2. The silicon fertilizer material was synthesized in our laboratory:

[0114] Granite and marble powders were dried at 70℃ for 12 hours, then pulverized through a ball mill to pass through a 200-mesh sieve to obtain granite powder (WG) and marble powder (MD) for later use. Using an "alkali activation-calcination" process, WG, MD, and an alkali activator (solid NaOH) were mixed at a mass ratio of 10:3:2, placed in a ceramic crucible, and calcined in a programmable temperature-controlled muffle furnace: the temperature was increased to 800℃ at a rate of 10℃ / min, and calcined for 1 hour. After cooling, the mixture was ground through a 100-mesh sieve to obtain silicon fertilizer.

[0115] 3. Preparation of Chlorella proteoglycans solution:

[0116] The algal solution was prepared by expanding a laboratory-cultured algal strain, namely *Chlorella pyrenoidosa*, which is a strain that our research team has been storing and holding in our laboratory for a long time. Alternatively, commercially available *Chlorella pyrenoidosa* can be purchased directly for use in this invention.

[0117] Chlorella proteoglycans were inoculated into BG11 medium at a rate of 5% and incubated at 25°C and 1500 lux / m³. 2 Fermentation was carried out under light conditions for 15 days. After fermentation, the fermentation broth was collected, the pH was adjusted to 6.8±0.2, and centrifuged and sterilized. After centrifugation, the supernatant was discarded, and the algal cells were collected, washed with sterile water, and resuspended in an appropriate amount of sterile water to prepare a solution with a concentration of 10%. 7 ~10 8 Algal solution with cells / mL.

[0118] 4. Preparation of the carrier:

[0119] The previously prepared Chlorella proteoglycans algal solution was mixed with silicon fertilizer and nano-zero-valent iron in a specific ratio to serve as a carrier for the microbial remediation agent. Five carriers were prepared in this embodiment: the mass ratios of Chlorella proteoglycans algal solution, silicon fertilizer, and nano-zero-valent iron were 10:1:1, 15:1:1, 20:1:1, 10:0:1, and 10:1:0, respectively. Considering cost-effectiveness, the material cost of nano-zero-valent iron and silicon fertilizer is much higher than that of Chlorella proteoglycans algal solution by weight; therefore, an experimental group with a carrier ratio of 0:1:1 was not included.

[0120] 5. Preparation of microbial remediation agents:

[0121] The isolated Pseudomonas aeruginosa strain QPBII-1 was cultured on the screening medium described in Example 1, and cultured at 37°C in a shaker at 160 rpm until OD was reached. 600 =1. After centrifuging the cultured bacterial agent at 4000 rpm for 5 min, retain the sediment and resuspend it in PBS buffer or physiological saline (PBS buffer was used in this example) to a final concentration of 1.6 × 10⁻⁶. 8 CFU / mL was used to obtain a liquid bacterial agent.

[0122] Liquid bacterial agent and carrier were mixed at a mass ratio of 1:1 and stirred at 30℃ and 200 rpm for 3 minutes. Then, the mixture was centrifuged at 4℃ and 4000 rpm for 4 minutes using a refrigerated centrifuge, and the supernatant was discarded. 10 wt% trehalose was added to the precipitate as a freeze-drying protectant, and the mixture was thoroughly mixed. The mixture was then freeze-dried using a vacuum freeze dryer. After drying, the product was packaged to obtain the microbial remediation agent. The freeze-drying method using a vacuum freeze dryer was as follows: the material thoroughly mixed with the freeze-drying protectant was placed in sterile centrifuge tubes or sterile plastic-sealed bags and pre-frozen in the cold trap of a vacuum freeze dryer at -40℃ or below for 2 hours. The pre-frozen sample was then placed in the drying chamber of the freeze dryer and freeze-dried at -90℃ and a vacuum degree <20 Pa until the material reached constant weight.

[0123] Five different microbial remediation agents were prepared (i.e., the proportions of each component of the carrier were different).

[0124] II. Application of Microbial Remediation Agents in Tailings

[0125] A sample of lead-zinc tailings from Fankou, Guangdong Province, was spread evenly within the experimental area to a thickness of approximately 5 cm. The prepared microbial remediation agent was then evenly sprayed onto the tailings surface using a handheld dry powder spray gun, at a rate of approximately 5 g / m³. 2After spraying, the mixture was thoroughly mixed using a sterilized stainless steel spatula. The experimental area was then placed indoors, maintaining a temperature of 20±5℃ and a relative humidity of 60±10% for the tailings samples. During the experiment, the tailings samples were sprayed with water mist every 24 hours to maintain constant humidity. Simultaneously, only *Pseudomonas aeruginosa* QPBII-1 was suspended in PBS to a concentration of 1.6 × 10⁻⁶. 8 A control of CFU / mL liquid bacterial agent without carrier, and an untreated control without any remedy.

[0126] Five days after the application of the remediation agent, samples were taken from the tailings, and the content and speciation of heavy metals in the samples were analyzed using atomic absorption spectrometry (AAS) and the Tessier five-step extraction method. The experiment continued until two consecutive sampling analyses showed that the speciation of heavy metals tended to stabilize.

[0127] The Tessier five-step extraction method is as follows:

[0128] Exchangeable state (F1): Weigh approximately 1.0000 g of sample into a 50 mL polyethylene centrifuge tube, accurately add 8 mL of 1 mol / L MgCl2 (acidified with HNO3, pH 7.0), shake well, and place in a constant temperature shaker for 1 hour (shaking rate 250 rpm to ensure the mixture in the centrifuge tube remains suspended). Maintain the temperature at 22±5℃ (the same applies below), remove the tube, centrifuge at 4000 rpm for 4 minutes, filter the supernatant through a 0.45 μm filter, transfer it to a polyethylene vial, add 1 mL of concentrated nitric acid, and store at 4℃. Add approximately 8 mL of ultrapure water to the residue, shake manually to resuspend the residue, centrifuge at 4000 rpm for 20 minutes, and discard the supernatant.

[0129] Carbonate-bound state (F2): Add 8 mL of 1 mol / L NaAc (HAc acidified, pH 5.0) to the previous residue, shake well, place in a constant temperature (22±5℃) shaker and shake for 5 hours, centrifuge at 4000 rpm for 4 minutes, and follow the same steps as before.

[0130] Iron-manganese oxide bound state (F3): Add 20 mL of 25% HAc solution (0.04 mol / L NH2OH·HCl) to the residue from the previous step, and adjust the pH to 2.0. Incubate in a constant temperature water bath at (96±3)℃ for 6 hours, cool, and centrifuge at 4000 rpm for 4 minutes. Other steps are the same as before.

[0131] Organic matter bound state (F4): Add 3 mL of 0.02 mol / L HNO3 solution and 5 mL of 30% H2O2 solution to the residue from step 3, and adjust the pH to 2.0. Nitrify at (85±2)℃ for 2 hours with intermittent stirring; add 3 mL of 30% H2O2 solution and continue nitrification for 3 hours with intermittent stirring; add 5 mL of 3.2 mol / L NH4Ac in 20% HNO3 solution, dilute to 20 mL, and incubate at (22±5)℃ with shaking for 30 minutes. Centrifuge at 4000 rpm for 4 minutes, and repeat the other steps as before.

[0132] Residual state (F5): Take out the previous stage residue, dry it at 105℃ and digest it. Refer to the total determination method for the determination procedure to extract the heavy metals in the residual state.

[0133] After each step is completed, the supernatant should be separated by centrifugation and stored. The concentration of heavy metals in this form should be determined by atomic absorption spectrometry (F-AAS). The F-AAS instrument test conditions are the same as in Example 1.

[0134] III. Results and Analysis

[0135] 1. Material characterization of microbial remediation agents

[0136] The microbial remediation agent prepared by means of Chlorella proteoglycans liquid, silicon fertilizer and nano-zero-valent iron in a mass ratio of 10:1:1 was characterized (Figure 8). The SEM image showed that a large number of bacteria were attached to the nano-zero-valent iron on the surface of the material. At the same time, the XPS image showed a peak at 706 eV, which further proved the presence of nano-zero-valent iron in the microbial remediation agent. This shows that the nano-zero-valent iron and other materials in the microbial remediation agent suffered less loss during the preparation process and the carrier can still maintain its original function after preparation.

[0137] The active silicon in the remediation agent can enhance the soil's adsorption capacity for heavy metals by forming co-precipitates with them, increasing the soil's cation exchange capacity (CEC) and organic matter (OM) content. Simultaneously, the high specific surface area of ​​active silicon provides ample attachment sites for microorganisms, promoting their attachment and growth. Nano-zero-valent iron, through adsorption, reduction, precipitation, and co-precipitation, assists in the removal of various heavy metal ions. Furthermore, nano-zero-valent iron has a certain pH-regulating function, aiding in the colonization of microorganisms and algae in the tailings. The fermented algal liquid provides nutrients and additional carbon sources for microbial colonization, enhancing microbial activity and improving the remediation agent's environmental adaptability and stability, enabling it to maintain high remediation efficiency even in the high-pollution, low-nutrient, high-pressure environment of tailings.

[0138] 2. Comparison of repair effects

[0139] This study investigated the effects of microbial remediation agents with different carrier composition ratios on heavy metals in tailings samples by comparing heavy metal speciation data before and after remediation. In untreated tailings samples, the distribution of heavy metal speciation for Pb, Zn, Cd, and Cr showed that these four heavy metals mainly existed in residual form, accounting for 43%, 34%, 51%, and 44% of their total content, respectively. The second most common form was bound iron and manganese oxides, accounting for 20%, 24%, 19%, and 20%, respectively. Although these metals were primarily present in residual form, the proportion of residual form did not exceed 50%, indicating that the heavy metals in the tailings samples were still in a state where they could be absorbed and utilized by plants and organisms, posing a significant risk of migration and transformation that could pollute the surrounding ecosystem. Therefore, converting heavy metals into more stable forms and further increasing the proportion of organically bound and residual forms is particularly necessary.

[0140] Five days after applying the microbial remediation agent, the results (Figure 9) showed that, compared with the control group without any remediation agent, the experimental group with the remediation agent exhibited a significant transformation trend in different forms of heavy metals. Only the carrier-free group of *Pseudomonas aeruginosa* showed a certain ability to transform heavy metal forms, increasing the organic bound form (F4) of heavy metals Pb, Zn, and Cd by 1%, 2%, and 3% of the total, respectively, and the residual form (F5) by 7%, 9%, 5%, and 6%, respectively. Correspondingly, the proportions of exchangeable (F1) and carbonate-bound (F2) forms of heavy metals (Pb, Zn, Cd, Cr) decreased significantly, with the proportion of exchangeable forms decreasing more significantly, decreasing to 5%, 7%, 7%, and 5% for the four heavy metals, respectively. The change in the iron-manganese oxide bound form of heavy metals was not significant, possibly because the microorganism had a relatively small impact on this form of heavy metal. Overall, treatment with Pseudomonas aeruginosa can promote the transformation of these heavy metal elements from forms that are more easily absorbed and utilized by plants to forms that are difficult for plants to absorb and utilize.

[0141] In the treatment group containing carriers, the heavy metal conversion efficiency of microbial remediation agents for heavy metals Pb, Zn, Cd, and Cr was higher than that of heavy metal remediation agents without carriers, regardless of the carrier used. The effect of increasing the proportion of residual state (F5) and decreasing the proportion of exchangeable state (F1) and carbonate-bound state (F2) was more significant.

[0142] In contrast, different carrier ratios produced different effects on the distribution of heavy metal speciation. When using three carriers simultaneously, for the heavy metal Pb, the speciation conversion effect was better with a carrier ratio of 20:1:1 than with a ratio of 10:1:1; for the heavy metals Zn, Cd, and Cr, the remediation agent with a ratio of 10:1:1 had the best final effect. In the microbial remediation agent prepared with a mass ratio of *Chlorella protozoa* algal solution, silicon fertilizer, and nano-zero-valent iron of 10:1:1, the percentage of Pb in F1 decreased from 6% to 2%, Zn from 7% to 4%, Cd from 10% to 2%, and Cr from 7% to 2%. Conversely, in F5, the percentages of Pb, Zn, Cd, and Cr increased to 50%, 44%, 64%, and 55%, respectively. The reason for this phenomenon may be that lead (Pb) tends to bind with organic matter in the algal solution, while zinc (Zn), cadmium (Cd), and chromium (Cr) may be more easily adsorbed or precipitated by silicon fertilizer or reduced by nano-zero-valent iron. For the heavy metal Zn, the proportion of iron-manganese oxide bound state (F3) increased after adding a relatively low proportion of algal solution. This change may be due to the enhanced adsorption capacity of Zn in the iron-manganese oxide bound state (F3) by the addition of algal solution, nano-zero-valent iron, and silicon fertilizer. Similarly, the experimental groups adding only algal solution and silicon fertilizer or only algal solution and nano-zero-valent iron also showed a certain heavy metal conversion effect. However, compared with the total proportion of stable states (F3, F4, F5), it is proven that the remediation effect of adding all three carriers simultaneously is better. In the tailings remediated by the microbial remediation agent with the addition of the three carriers, the exchangeable states of the four metals were all less than or equal to 5%. Overall, the treatment with a carrier ratio of 10:1:1 had the most positive impact on the speciation distribution of Pb, Zn, Cd, and Cr, because it promoted the formation of more stable forms, thereby reducing the environmental risk of heavy metals in tailings. Based on the experimental results and cost accounting, the optimal ratio of the three carrier materials was finally determined to be 10:1:1.

[0143] The above results indicate that the application of microbial remediation agents promotes the transformation of heavy metals from highly bioavailable forms to less bioavailable forms. This phenomenon may be due to the microorganisms in the remediation agents altering the chemical forms of heavy metals in the soil through their metabolic activities. *Pseudomonas aeruginosa* may lower soil pH by secreting organic acids and chelating agents, promoting the precipitation and fixation of heavy metals. Furthermore, *P. aeruginosa* metabolites may form insoluble complexes with heavy metals, thereby reducing their bioavailability. Simultaneously, *P. aeruginosa*-induced carbonate precipitation (MICP) may also promote heavy metal fixation; carbonates combine with heavy metal ions to form insoluble carbonates, further reducing heavy metal bioavailability. These biochemical processes work together to transform heavy metals from exchangeable to residual forms, thus reducing the environmental risk associated with heavy metals.

[0144] Meanwhile, tailings ponds are oligotrophic environments. Without the addition of other modifiers (such as additional carbon or nitrogen sources), the microbial remediation agent of this invention still has the effect of changing the form of heavy metals, further demonstrating that the microbial remediation agent of this invention has good application value in the treatment and bioremediation of heavy metals in tailings ponds.

Claims

1. A strain of Pseudomonas aeruginosa QPBII-1 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31703.

2. The application of Pseudomonas aeruginosa as described in claim 1 in the remediation of heavy metal pollution in the environment, wherein the environment includes heavy metal contaminated soil, tailings, and tailings ponds; and wherein the heavy metals include Pb, Zn, Cd, and Cr.

3. A microbial remediation agent for heavy metal remediation, characterized in that: This product is prepared by loading the *Pseudomonas aeruginosa* strain described in claim 1 onto a carrier. The carrier comprises the following components in the following weight ratios: 10-20 parts of *Chlorella pyrenoidosa* algal solution, 1-3 parts of silicon fertilizer, and 1-3 parts of nano-zero-valent iron. The silicon fertilizer is prepared by mixing granite powder, marble powder, and an alkali activator in a mass ratio of 8-12:0-12:0.5-4, followed by calcination at 600-1000℃ to obtain particles of 60-200 mesh. The alkali activator is solid sodium hydroxide or potassium hydroxide. The microbial remediation agent is prepared by dissolving a 1.0 × 10⁻⁶ ppm solution. 7 ~2.0×10 8 The *Pseudomonas aeruginosa* bacterial suspension with a concentration of CFU / mL was mixed with a carrier at a mass ratio of 1-3:1 and then freeze-dried to obtain a powder.

4. The microbial remediation agent according to claim 3, characterized in that: The cell number concentration of the Chlorella proteoglycans solution was 10. 6 ~10 9 / mL; the silicon fertilizer is prepared into 80-150 mesh particles by mixing granite powder, marble powder and alkali activator in a mass ratio of 8~12 : 2~8 : 1~3 and calcining at 700~900℃ for 20~120 minutes.

5. The microbial remediation agent according to claim 3, characterized in that: The carrier comprises the following components in the following weight ratios: 10-15 parts of Chlorella pyrenoidosa liquid, 1-2 parts of silicon fertilizer, and 1-2 parts of nano-zero valent iron; the heavy metals include Pb, Zn, Cd, and Cr.

6. The method for preparing the microbial remediation agent according to any one of claims 3 to 5, characterized in that, The process includes the following steps: Take Pseudomonas aeruginosa bacterial suspension and carrier, mix them evenly according to the ratio, and you will get the product.

7. The preparation method according to claim 6, characterized in that, The steps include: (1) Preparation of Pseudomonas aeruginosa bacterial culture: The Pseudomonas aeruginosa bacterial strain is inoculated into the culture medium for expansion culture until the OD reaches 10000. 600 =0.5~1.2 After centrifugation, collect the bacterial cells and suspend the bacterial cells in PBS buffer, physiological saline or sterile water to the set concentration; (2) Preparation of carrier silicon fertilizer: take granite powder, marble powder and alkali activator according to the mass ratio, calcine at 600~1000℃ for 20~120 minutes to prepare 60~200 mesh particles, and obtain; Preparation of Chlorella pyrenoidosa algal solution: take Chlorella pyrenoidosa algal seed and inoculate it into the culture medium for expansion culture until the growth retardation period to the stationary period, then centrifuge to collect the algal cells, and resuspend the algal cells in sterile water, physiological saline or PBS buffer solution to the cell number concentration of 10. 6 ~10 9 / mL; Mix the protein-core Chlorella algal liquid, silicon fertilizer, and nano zero-valent iron in proportion to obtain a carrier; (3) Prepare microbial repair agent Take the prepared Pseudomonas aeruginosa bacterial liquid and carrier, mix them in proportion, and then centrifuge to collect the precipitate to obtain the agent.

8. The preparation method according to claim 7, characterized in that: The precipitate is freeze-dried into powder to obtain the microbial remediation agent. The specific steps are as follows: take the prepared Pseudomonas aeruginosa bacterial solution and carrier, mix them evenly according to the ratio, centrifuge at 4~10℃, discard the supernatant, collect the precipitate, add 8~12wt% of the weight of the precipitate as freeze-drying protectant, mix well, and freeze-dry using a vacuum freeze dryer to obtain the agent.

9. The preparation method according to claim 8, characterized in that: The freeze-drying protectant is trehalose.

10. The application of the microbial remediation agent according to any one of claims 3 to 5 in the remediation of heavy metal pollution in the environment, wherein the environment includes heavy metal contaminated soil, tailings, and tailings ponds, and the heavy metals include Pb, Zn, Cd, and Cr.

11. The application according to claim 10, characterized in that: Add 3-7 grams of microbial remediation agent to every 0.05 cubic meters of sample to be treated. Apply the microbial remediation agent to the sample to be treated, mix it evenly, and let it stand for 3-7 days. During the remediation period, keep the humidity of the sample at 60±10%.

12. The application according to claim 11, characterized in that: Apply the microbial remediation agent every 3 to 7 days. After applying the microbial remediation agent, let it stand. Repeat the application of the microbial remediation agent until the toxic heavy metals are reduced to below the target concentration.

13. The application according to claim 11 or 12, characterized in that: The environment is a lead-zinc tailings pond. The microbial remediation agent is sprayed onto the lead-zinc tailings pond site, mixed, and left to stand.

Citation Information

Patent Citations

  • Preparation method and application method of heavy metal ion biological adsorbent

    CN104148029A

  • Modified nano zero-valent iron and application thereof in remediation of heavy metal contaminated soil

    CN111229812A

  • Silicon-based curing agent, repairing agent and repairing method for repairing vanadium / cadmium pollution of soil

    CN115351064A

  • Preparation method and application of algae-loaded nano zero-valent iron composite material

    CN118047470A