CD4 + T cell targeting cryptosporidium parvum epitope polypeptide and application thereof

Abstract

The invention relates to an epitope polypeptide of cryptosporidium parvum targeting CD4 + T cells and application of the epitope polypeptide. The amino acid sequence of the epitope polypeptide is shown as SEQ ID NO.1; the epitope polypeptide is a combined long epitope polypeptide of cryptosporidium parvum Gp40 / 15 protein, Gp900 protein and CSL protein; the epitope polypeptide can be applied to a vaccine for preventing or treating cryptosporidiosis parvum, and after a mouse is immunized by the vaccine, not only can CD8 + T cell immune response of the mouse be obviously stimulated, but also stronger CD4 + T cell response is induced to be generated, and the mouse can be induced to generate multifunctional T cells related to an immune protection effect; the levels of IFN-gamma, TNF-alpha and IL-2 generated by multifunctional T cells induced by a long polypeptide immune group have extremely significant differences (P is less than 0.01) compared with various negative controls, which indicates that the long polypeptide epitope vaccine has corresponding biological immunological activity and becomes a novel cryptosporidium parvum infection resistant T cell epitope vaccine or an immunodominance T cell epitope-based mRNA vaccine.

Description

Technical Field

[0001] The present invention belongs to the field of biopharmaceutical technology and specifically relates to a method for targeting CD4 + T cell epitope peptides of Cryptosporidium parvum and their application. Background Art

[0002] Cryptosporidium, belonging to the Class Sporozoa of the Phylum Apicomplexa, was first reported and named by Tyzzer in 1912. It is an important zoonotic intracellular parasitic protozoan. Among the 44 identified Cryptosporidium species, Cryptosporidium parvum is the Cryptosporidium with the widest host range, infecting primates, ruminants, equines, rodents, and more than 240 species of animals including humans (Ryan et al 2021). About 90% of human infections are caused by Cryptosporidium hominis and Cryptosporidium parvum. The disease caused by Cryptosporidium infection is called cryptosporidiosis. The disease is widely transmitted and can be transmitted through water, food, air, and close contact, etc., which has important public health significance. Cryptosporidium parvum is an intracellular parasite. The main effector cells of its specific immunity include CD8 + T cells (cytotoxic T lymphocytes, CTL) and CD4 + Th1 cells. Like other apicomplexan parasites, after Cryptosporidium parvum oocysts infect cells, its sporozoite rhoptry, micronemes, dense granules and other secretory organelles release a large amount of protein mixtures, which are involved in the specific adhesion of Cryptosporidium to host cells, the movement and sliding of sporozoites on the surface of host cells, and the formation of parasitic vesicles (PV).

[0003] There are many micronemes in the sporozoite, and they play an important role in the localization and adhesion of host cells. The proteins encoded by the microneme gene family include Gp40 / 15, Gp900, etc. Among them, Gp900 protein was first reported by Petersen. It is a mucin-like glycoprotein with a molecular weight greater than 900KDa and a transmembrane domain. GP900 protein is usually stored in micronemes. When Cryptosporidium parvum invades the host, it enters the secretory pathway and is secreted by the micronemes to the surface of the sporozoite membrane. Competitive inhibition experiments using monoclonal antibodies to Cryptosporidium parvum sporozoites showed that Gp900 bound to the surface and apical region of the sporozoite mediated the attachment and invasion of sporozoites. Gp40 / 15, also known as Gp60, was first reported by Strong and Cevallos. The gene encoding Gp40 / 15 protein is translated into a 60KDa glycoprotein precursor in the intracellular stage of the Cryptosporidium parvum life cycle. After secretion, the precursor protein is cleaved by proteases to form proteins with molecular weights of approximately 15KDa and 45KDa. Gp40 and Gp15 are located on the surface of Cryptosporidium parvum merozoites and sporozoites, respectively, and can form a complex Gp40 / 15 to play the corresponding adhesion and invasion functions. CSL protein is a conserved glycoprotein of the parasite with a molecular weight of approximately 1300KDa, located on the apical surface of sporozoites and merozoites of Cryptosporidium parvum, and participates in the adhesion of the parasite to host cells. The above proteins are all involved in the invasion of parasites into host cells and are the main target proteins that mediate the host's specific immune response against parasites. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention proposes a method targeting CD4 + T cell epitope peptides of Cryptosporidium parvum and their application.

[0005] The technical solution of the present invention is:

[0006] A CD4-targeted + The epitope polypeptide of Cryptosporidium parvum of T cells is a combined epitope polypeptide of Cryptosporidium parvum Gp40 / 15 protein, Gp900 protein and CSL protein.

[0007] Furthermore, the amino acid sequence of the epitope polypeptide is shown in SEQ ID NO.1.

[0008] The nucleic acid encoding the epitope polypeptide has a nucleotide sequence as shown in SEQ ID NO.2.

[0009] A recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant virus vector containing the nucleic acid.

[0010] The epitope polypeptide and the nucleic acid are used in preparing a vaccine for preventing or treating Cryptosporidiosis parvum.

[0011] The recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant virus vector are used in preparing a vaccine for preventing or treating Cryptosporidiosis.

[0012] A vaccine for Cryptosporidiosis parvum, wherein the active ingredient of the vaccine for Cryptosporidiosis parvum is at least one of the following substances:

[0013] A combined epitope polypeptide of Cryptosporidium parvum Gp40 / 15 protein, Gp900 protein and CSL protein, the amino acid sequence of which is shown in SEQ ID NO.1;

[0014] or a nucleic acid encoding the amino acid sequence of SEQ ID NO.1, whose nucleotide sequence is shown in SEQ ID NO.2;

[0015] Or the nucleic acid shown in SEQ ID NO.2;

[0016] Or the recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant virus vector.

[0017] Furthermore, the vaccine is a long polypeptide epitope vaccine.

[0018] The epitope polypeptide is used to prepare CD8 + T lymphocytes and CD4 + Application in T lymphocyte proliferation agent.

[0019] The nucleic acid or the recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant virus vector is used in the preparation of CD4 + Application in T lymphocyte proliferation agent.

[0020] Compared with the prior art, the present invention has at least the following advantages:

[0021] The present invention relates to a method for targeting CD4 + The invention provides a combination epitope polypeptide comprising the epitopes of Cryptosporidium parvum Gp40 / 15, Gp900 and CSL protein of Cryptosporidium parvum, which can induce strong peptide-specific CD4 T cell in vivo. + The results showed that the long polypeptide epitope vaccine could stimulate the spleen cells of C57BL / 6N mice to produce antigen-specific CD4 + T cell immune response, which induces CD4 +The levels of cytokines IFN-γ, TNF-α and IL-2 produced by T cells were significantly different from those of the negative control (P < 0.0001), indicating that the epitope peptide can effectively stimulate the body's response as a vaccine active substance and produce a specific immune response to the antigen. + The proportion of T cells and PE-labeled IFN-γ double-positive cells was 2.36%, while that of the negative control group was 0.034%; + The proportion of double positive cells of TNF-α marked by T cells and PerCp was 4.76%, while that of negative control group was 0.050%; + The proportion of T cells and IL-2 double positive cells labeled with PE-Cy7 was 4.94%, and the negative control group was 0.020%, both of which were significantly different. This shows that the polypeptide epitope vaccine prepared by the present invention can induce the production of antigen-specific multifunctional CD4 + T cells have great potential for development and application in the field of Cryptosporidium parvum-specific immunotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the specific embodiments of the present invention, the drawings required for use in the specific embodiments or the description of the prior art will be briefly introduced below.

[0023] Figure 1 The immunization scheme and gating method for identifying specific T cell epitopes of epitope polypeptides in Example 2 of the present invention; A is the mouse immunization process; B is the gating scheme for flow cytometry data analysis;

[0024] Figure 2 After mice were immunized with the epitope polypeptide vaccine in Example 3 of the present invention, flow cytometry and intracellular cytokine staining techniques were used to detect CD4 + The level of IFN-γ secreted by T cells; A is CD4 + IFN-γ + T cell flow cytometry results; B is peptide vaccine immunization and CD4 + IFN-γ + Statistical analysis of T cells (P<0.001); C is the CD4 + IFN-γ + Statistical analysis of T cells (P < 0.001);

[0025] Figure 3 After mice were immunized with the epitope polypeptide vaccine in Example 3 of the present invention, flow cytometry and intracellular cytokine staining techniques were used to detect CD4 +The level of TNF-α secreted by T cells; A is CD4 + TNF-α + T cell flow cytometry results; B is peptide vaccine immunization and CD4 + TNF-α + Statistical analysis of T cells (P<0.001); C is the CD4 + TNF-α + Statistical analysis of T cells (P < 0.001);

[0026] Figure 4 After mice were immunized with the epitope polypeptide vaccine in Example 3 of the present invention, flow cytometry and intracellular cytokine staining techniques were used to detect CD4 + The level of IL-2 secreted by T cells; A is CD4 + IL-2 + T cell flow cytometry results; B is peptide vaccine immunization and CD4 + IL-2 + Statistical analysis of T cells (P<0.001); C is the CD4 + IL-2 + Statistical analysis of T cells (P < 0.001);

[0027] Figure 5 The results of identifying peptide-specific multifunctional T cells using flow cytometry and intracellular cytokine staining techniques after mice were immunized with the epitope peptide vaccine in Example 3 of the present invention; A is CD4 + Flow cytometry results of multifunctional T cells; B is CD4 + TNF-α + IFN-γ + Statistical analysis results of multifunctional T cells; C is CD4 + IL-2 + IFN-γ + Statistical analysis results of polyfunctional T cells. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. Technicians in this field can make some non-essential improvements and adjustments to the present invention based on the above application content.

[0029] The present invention provides a general and / or specific description of the materials and test methods used in the experiment. The test methods or test methods involved are all conventional methods unless otherwise specified; the reagents or instruments used are all conventional products available on the market, prepared or used in a conventional manner, unless the manufacturer is specified.

[0030] Sources:

[0031] C57BL / 6 mice were purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.

[0032] Cryptosporidium parvum and Cryptosporidium tayze: donated by Professor Zhang Longxian's team from Henan Agricultural University.

[0033] The amino acid sequence of the epitope polypeptide of the present invention (SEQ ID NO.1):

[0034] SANTNFLLVESLSNYNSMSVFAIFAAL

[0035] The nucleotide sequence of the epitope polypeptide of the present invention (SEQ ID NO.2):

[0036] agtgcaaacaccaacttcttgttggtagaatctctgagtaattataatagtatgtccgtttttgcaatctttgcagcctta

[0037] Example 1 Passaging and Storage of Cryptosporidium parvum and Cryptosporidium tyzeri Oocysts

[0038] After Cryptosporidium parvum infected C57BL / 6 wild-type mice, the amount of oocysts produced was low. In order to increase the excretion of oocysts, IFN-γ gene deletion (IFN-γ - / - )C57BL / 6 mice were used for passage of oocysts, IFN-γ - / - C57BL / 6 mice were inoculated with 2×10 7 After the number of oocysts was detected, the feces of mice were collected and the pattern of oocyst excretion was observed; Cryptosporidium tyzeri can be naturally infected. 4-6 week-old C57BL / 6 female mice (SPF grade) were selected and inoculated with 2×10 7Cryptosporidium oocysts. The excretion of oocysts was detected from the third day of oral infection. After the excretion of oocysts was confirmed, the feces of mice were collected every day, crushed and stirred with water, filtered with a filter (pore size of 0.45 mm and 0.2 mm), and the filtrate was centrifuged at 3500r / min for 10min, and the supernatant was discarded; the oocyst band was separated by saturated sucrose centrifugation; the enriched oocyst fluid was removed by cesium chloride, centrifuged at 12 000r / min for 8min, and the middle oocyst band was aspirated; the oocyst fluid was filtered with 50μm, 30μm, and 20μm filter membranes, and the filtrate was collected and enriched with Cryptosporidium oocysts, and stored at 4℃ for later use.

[0039] Example 2 Animal immunization process and isolation of spleen cells

[0040] 2.1 Preparation of epitope polypeptides of the present invention

[0041] The amino acid sequence of the epitope polypeptide of the present invention is shown in SEQ ID NO. 1, and the epitope polypeptide is synthesized by Shanghai Qiangyao Biotechnology Co., Ltd. and purified by high performance liquid chromatography (HPLC) with a purity of more than 90%. The epitope polypeptide is freeze-dried and stored in a -80°C refrigerator, and is dissolved in DMSO (dimethyl sulfoxide) to a final concentration of 10 mg / ml when used.

[0042] 2.2 Animal Immunization Process

[0043] Dissolve 5 mg of epitope peptide with 500 μL DSMO to a final concentration of 10 mg / mL. Take 70 μL of the dissolved epitope peptide and dilute it 10 times with PBS buffer to 700 μL, add an equal amount of immune adjuvant, and emulsify it with a handheld high-speed emulsifier until the liquid is cheese-like and there is no obvious liquid flow when the centrifuge tube is inverted.

[0044] Female C57BL / 6 mice aged 6-8 weeks were selected and divided into epitope peptide immunization group, oocyst gavage group, Freund's adjuvant control group (mice immunized with Freund's adjuvant and PBS) and The control group (normal mice not immunized or gavaged with oocysts) was divided into 6-10 mice per group, wherein the group gavaged with oocysts was not subjected to epitope polypeptide immunization; the epitope polypeptide immunization group was immunized with polypeptide by subcutaneous injection in the back of the neck, and each mouse was immunized with 50 μg of epitope polypeptide. The immunization process of mice in the present invention is as follows: Figure 1 As shown in A: Each immunization interval is 10-14 days, of which the first immunization uses Freund's complete immune adjuvant, the second and third immunizations use Freund's incomplete adjuvant, and 7 days after the last immunization, 2×10 6The Cryptosporidium tyzeri oocysts prepared in Example 1 were collected from mice every day, and the mouse oocyst excretion was detected and recorded under a microscope. Meanwhile, 5 mice were taken from each group, and spleen cells (SP) were isolated for intracellular cytokine staining analysis.

[0045] 2.3 Isolation of mouse spleen cells

[0046] (1) The four groups of mice in 2.2 were killed by cervical dislocation and placed in 75% alcohol for later use (transferred into the cell compartment);

[0047] (2) Spleen separation: Use forceps to slowly peel off the spleen and remove excess connective tissue;

[0048] (3) Add the separated spleen to 1640 medium, chop it with scissors, place it in a 40 μM cell sieve, and grind the spleen with a syringe tip;

[0049] (4) Pipette the ground spleen cells and culture medium into a 15 mL centrifuge tube and centrifuge at 1500 r / min (350-400 g) at 4°C for 5 min. Discard the supernatant and flick the remaining liquid 4-5 times with your index finger to suspend the cells.

[0050] (5) Add cell lysis buffer, lyse at room temperature for 12 min, and then centrifuge at 1500 rpm for 5 min to remove red blood cells;

[0051] (6) Wash the cells 1-2 times with 1640 medium to further remove red blood cells and connective tissue;

[0052] (7) After centrifugation, carefully transfer the supernatant to a new 15 mL centrifuge tube, wash twice with serum-free culture medium, and aspirate the supernatant for the final wash. Add 1640 culture medium containing 10% FBS to dissolve the cells, and take 10 μL of cells for cell counting.

[0053] Example 3 Intracellular cytokine staining method to identify polypeptide-specific T cell responses

[0054] 3.1 Intracellular cytokine staining method

[0055] (1) Collect and process cells

[0056] Sample wells per 1mL (10 7The corresponding epitope polypeptide was added to the cells (cells / mL) to a final concentration of 10 μg / mL, and the second signal molecule CD28 antibody for T cell activation was added at the same time; 2 μL of cell stimulator (Cell Activation Cocktail) was added to the positive control; no polypeptide was added to the negative control, only CD28 antibody was added, and the cells were cultured in a 5% CO2 incubator at 37°C for 2 hours. Blocker BFA (1 ul / mL) was added to the sample wells and CD28 negative control wells respectively. BFA was already included in the positive control cell stimulator and was not added repeatedly. The cell culture plate was placed in a 5% CO2 incubator and continued to be cultured for 6 hours.

[0057] (2) Cell death and viability staining

[0058] The cell suspension was collected by centrifugation at 1500 r / min for 5 min, and the cells were washed with HBSS; the cells were resuspended in 1 mL HBSS and 1 μL FVS 510 dye was added, and the cells were stained at room temperature in the dark for 15 min. After centrifugation at 1500 r / min for 5 min, the supernatant was discarded and the cells were washed twice by FACS.

[0059] (3) Surface molecular staining

[0060] Take 100 μL FACS, add 1 μL FITC-labeled anti-mouse CD8 monoclonal antibody, 1 μL APC-labeled anti-mouse CD3 monoclonal antibody, 1 μL APC-Cy7-labeled anti-mouse CD4 monoclonal antibody, stain at 4°C in the dark for 30 minutes, add 1900 μL PBS, centrifuge at 1500 r / min for 5 minutes, add 2 mL FACS to resuspend the cells, and wash the cells twice.

[0061] (4) Fixation and membrane disruption

[0062] Add 250 μL of fixative precooled at 4°C, fix the cells for 20 min at room temperature in the dark; add permeabilization wash buffer, 1 mL / tube, react at room temperature in the dark for 20 min; centrifuge at 1500 r / min, 4°C for 5 min, and discard the supernatant.

[0063] (5) Intracellular cytokine staining

[0064] Add 100 μL of membrane permeabilization agent to resuspend the cells, add 1 μL of antibodies PE-IFN-γ, PerCP-TNF-α, and PE / Cyanine7-IL-2 respectively, and incubate for 30 min; add membrane permeabilization solution to 1 mL, centrifuge at 1500 r / min for 5 min, and discard the supernatant; add 1 mL / tube of FACS washing solution to wash the cells once, centrifuge at 1000 r / min for 5 min, and discard the supernatant; resuspend the cells with 500 μL FACS buffer for flow cytometry detection.

[0065] 3.2 Flow cytometry gating scheme

[0066] One week after the last immunization, each mouse was intragastrically administered with 1×10 6 oocysts. Mouse spleen cells were isolated 2-3 days after infection. Fixable Viability Stain 510 was used to stain the cells for live or dead cells. FITC anti-mouseCD8a, APC anti-mouse CD3, and APC-CyTM7 Rat Anti-mouse CD4 were then used to stain surface molecules. Finally, the cells were fixed and permeabilized, and intracellular cytokines were stained with PE-IFN-γ, PE-Cyanine7-IL-2, and PerCP / Cyanine5.5 TNF-α antibodies. CD8 + T and CD4 + The level of IFN-γ, TNF-α and IL-2 secreted by T cells was used to evaluate the level of peptide-specific T cell response. The FCM gate scheme was lymphocytes, monocytes, live CD3 + T cells, CD4 + T cells and CD8 + T cells, double positive T cells that secrete IFN-γ, TNF-α and IL-2 cytokines in CD4 and CD8 cells, and cells that secrete more than two cytokines IFN-γ at the same time + TNF-α + IFN-γ + IL-2 + Multifunctional T cells ( Figure 1 B).

[0067] 3.3CD4 + IFN-γ + Analysis of the proportion of double-positive T cells

[0068] In general, intracellular pathogens induce a strong Th1-type cellular immune response, in which IFN-γ plays a leading role in both the initiation of cellular immune responses and the effector phase of antiparasitic immune responses. + Th1 cells play an important role in the process of resisting parasitic infection. Therefore, this study analyzed the CD4 + IFN-γ + The proportion of double-positive T cells. Figure 2 As shown, Figure 2 A is CD4 + IFN-γ + The results of flow cytometry of T cells. Figure 2 B is CD4 + IFN-γ +Statistical analysis of T cells shows that the long epitope polypeptide of the present invention can induce mice to produce polypeptide-specific CD4 + T cell immune response, and There was a very significant difference compared with the negative control group (P<0.001). Figure 2 C is an epitope peptide specific pairing experiment, that is, the spleen cells of the immunized mice were separated and then stimulated with peptides in vitro. They were divided into an in vitro peptide stimulation group (peptide and CD28 antibody were added) and a CD28 negative control group (no peptide was added, only CD28 antibody was added). As can be seen from the figure, compared with the negative control without peptide, the addition of peptide during the in vitro culture process increased the CD4 + IFN-γ + The proportion of T cells was significantly different (P<0.001). This indicates that the long epitope peptide P3 can induce CD4 + T cells produce peptide-specific cytokine IFN-γ + .

[0069] 3.4CD4 + TNF-α + Analysis of the proportion of double-positive T cells

[0070] Studies have shown that TNF-α is a cytokine that can mediate viral, intracellular bacterial and parasitic infections. In addition, T cells that co-produce IFN-γ and TNF-α can enhance the killing effect on Cryptosporidium parvum. Therefore, based on the analysis of IFN-γ, the CD4 + TNF-α + The proportion of double-positive T cells was analyzed. Figure 3 As shown, Figure 3 A is CD4 + TNF-α + The results of flow cytometry of T cells. Figure 3 B is CD4 + TNF-α + Statistical analysis of T cells, as shown in the figure, Compared with the negative control group, the epitope polypeptide P3 of the present invention induced a stronger in vivo CD4 + TNF-α + T cell immune response, and There was a very significant difference compared with the negative control (P<0.001); Figure 3 C is the CD4 expression of spleen cells in the P3 immunization group under the conditions of in vitro stimulation with and without peptides. + TNF-α + Statistical analysis of T cells (P<0.001); It can be seen from the figure that in the peptide-specific pairing experiment, the epitope peptide immunization group can induce the production of peptide-specific TNF-α+ CD4 + T cells, compared with the CD28 control without peptide, there was a significant difference (P<0.001). This shows that epitope peptide immunization can induce CD4 + T cells produce the peptide-specific cytokine TNF-α.

[0071] 3.5CD4 + IL-2 + Analysis of the proportion of double-positive T cells

[0072] IL-2 is also known as lymphocyte stimulating factor, which can promote the proliferation of T cells. Based on this, the experiment analyzed the production level of IL-2 cytokine after peptide immunization. The results are as follows Figure 4 As shown, Figure 4 A is CD4 + IL-2 + The results of flow cytometry of T cells. Figure 4 B is CD4 + IL-2 + Statistical analysis of T cells shows that the CD4 + IL-2 + The proportion of double positive T cells and Compared with the negative control group, there was a very significant difference (P<0.001); Figure 4 C is the CD4 expression of spleen cells in epitope peptide immunization group under the conditions of in vitro peptide stimulation and without peptide stimulation. + IL-2 + Statistical analysis of T cells (P<0.001) shows that the addition of peptides to spleen cells in vitro can induce peptide-specific T cell responses, which is significantly different from the CD28 negative control group without peptides. This shows that in the peptide-specific pairing experiment, epitope peptide P3 can induce CD4 + T cells produce the peptide-specific cytokine IL-2.

[0073] 3.6 Analysis of the proportion of multifunctional T cells in mice immunized with long peptides

[0074] Studies have shown that there is a correlation between multifunctional Th1 cells that produce multiple cytokines (IFN-γ, IL-2, and TNF-α) and the degree of vaccine-mediated protection. Multifunctional T cells refer to protective T cells that can produce multiple cytokines to mediate immune responses, including CD4 + and CD8 +T cells, which have a "Th1-type cytokine profile". They are characterized by the co-production of cytokines IFN-γ, TNF-α and IL-2. In order to further verify the T cell immune response in the peptide-immunized mice, intracellular cytokine staining technology was used to analyze the CD4 + and CD8 + The ability of cells to secrete multiple cytokines was identified in order to evaluate the effects of peptide immunization on cell-specific immune responses and their immune protection effects from multiple aspects. This study analyzed the proportion of multifunctional T cells in mice immunized with epitope peptides. Figure 5 As shown, Figure 5 A is CD4 + Flow cytometry results of multifunctional T cells. Figure 5 B is the statistical analysis of multifunctional T cells, showing that the epitope peptide immune group CD4 + TNF-α in T cells + IFN-γ + The cell ratio was significantly different from that of the negative control group (P<0.01). Figure 5 C is CD4 + IL-2 + IFN-γ + The statistical analysis results of multifunctional T cells showed a significant difference compared with the negative control (P<0.01). The above results indicate that the P3 long polypeptide epitope stimulated mice to produce CD4 + T cells are mainly protective T cells. (Note: The peptide immunization group here refers to the use of peptide P3 immunization, and after three immunizations, 1*10 6 The negative control group was immunized with Freund's adjuvant + PBS, and after three immunizations, 1*10 6 Cryptosporidium oocysts in mice)

[0075] The Cryptosporidium parvum long polypeptide epitope vaccine of the present invention can not only stimulate mice to produce CD8 + T cell-based specific response, and produced stronger CD4 + The specific immune response based mainly on T cells can be developed into a new type of T cell epitope vaccine against Cryptosporidium parvum infection or an mRNA vaccine based on immunodominant T cell epitopes, and has great development and application potential in the field of Cryptosporidium parvum specific immunotherapy.

[0076] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some or all of the technical features thereof may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present invention, and should all be included in the scope of the claims and specification of the present invention.

Claims

1. A method targeting CD4 + The epitope polypeptide of Cryptosporidium parvum of T cells is characterized in that The epitope polypeptide is a long epitope polypeptide composed of a combination of Cryptosporidium parvum Gp40 / 15 protein, Gp900 protein and CSL protein.

2. The epitope polypeptide according to claim 1, characterized in that The amino acid sequence of the epitope polypeptide is shown in SEQ ID NO.

1.

3. A nucleic acid encoding the epitope polypeptide according to claim 1, characterized in that The nucleotide sequence of the nucleic acid is shown as SEQ ID NO.

2.

4. A recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant viral vector containing the nucleic acid of claim 3.

5. Use of the epitope polypeptide according to claim 1 and the nucleic acid according to claim 3 in the preparation of a vaccine for preventing or treating Cryptosporidiosis parvum.

6. Use of the recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant viral vector according to claim 4 in the preparation of a vaccine for preventing or treating Cryptosporidiosis.

7. A vaccine for Cryptosporidiosis parvum, characterized in that: The active ingredient of the vaccine for Cryptosporidiosis parvum is at least one of the following substances: A combined epitope polypeptide of Cryptosporidium parvum Gp40 / 15 protein, Gp900 protein and CSL protein, the amino acid sequence of which is shown in SEQ ID NO.1; or a nucleic acid encoding the amino acid sequence of SEQ ID NO.1, whose nucleotide sequence is shown in SEQ ID NO.2; Or the nucleic acid shown in SEQ ID NO.2; Or the recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant viral vector according to claim 4.

8. The vaccine according to claim 7, characterized in that The vaccine is a long polypeptide epitope vaccine.

9. The epitope polypeptide according to claim 1 is used in the preparation of CD8 + T lymphocytes and CD4 + Application in T lymphocyte proliferation agent.

10. The nucleic acid of claim 3 or the recombinant expression vector, expression cassette, transgenic cell line, recombinant bacteria or recombinant viral vector of claim 4 in the preparation of CD4 + Application in T lymphocyte proliferation agent.

Images