Application of miR-21 in preparation of reagent for promoting BMSCs differentiation and medicine for repairing peripheral nerve injury

Abstract

The invention provides application of miR-21 in preparation of a reagent for promoting BMSCs (bone marrow mesenchymal stem cells) differentiation and a medicine for repairing peripheral nerve injury, and belongs to the technical field of biomedicine.The research finds that overexpression of miR-21 in BMSCs can promote BMSCs to be differentiated into SCs-like cells, and miR-21 can improve the efficiency of BMSCs in vivo to be differentiated into the SCs-like cells. In addition, the invention also finds that the BMSCs overexpressing miR-21 can significantly promote PNI posterior process regeneration and myelin sheath formation, thereby improving sciatic nerve motor function recovery and target muscle atrophy; the compound can be applied to preparation of drugs for repairing peripheral nerve injury.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the application of miR-21 in the preparation of a reagent for promoting BMSCs differentiation and a drug for repairing peripheral nerve damage. Background Art

[0002] Peripheral nerve injury (PNI) is a common clinical disease. Severe injuries often lead to limb sensory loss and motor dysfunction, which imposes a huge burden on the society and economy. Repairing PNI with tissue-engineered nerve grafts constructed with seed cells and biological scaffold materials is currently a hot topic. Schwann cells (SCs) are the main glial cells in the peripheral nervous system and are essential factors for promoting nerve regeneration. They can provide guidance for the regeneration of nerve fibers after PNI. However, due to their limited sources, the application of SCs as seed cells for transplantation to repair nerve damage is greatly limited (Yao C, Wang Q, Wang Y, et al. Loc680254 regulates Schwann cell proliferation through Psrc1 and Ska1 as a microRNA sponge following sciatic nerve injury[J]. Glia, 2021, 69(10): 2391-2403. DOI: 10.1002 / glia.24045; Zhang X, Xiong Q, Lin W, et al. Schwann cells contribute to alveolar bone regeneration by promoting cell proliferation[J]. J Bone Miner Res, 2023, 38(1): 119-130. DOI: 10.1002 / jbmr.4735.). Therefore, finding seed cells with a wide range of sources and SCs characteristics is a difficult problem that needs to be solved in neural tissue engineering.Bone marrow mesenchymal stem cells (BMSCs) have attracted extensive attention from scholars at home and abroad due to their easy acquisition, easy in vitro culture and expansion, ability to secrete neurotrophic factors (NTFs), and multidirectional differentiation (Ghasemi M, Talebi A, Ghanbari A, et al. Bonemarrow stromal cell-conditioned medium regenerates injured sciatic nerve by increasing expression of MPZ and NGF and decreasing apoptosis[J]. Iran J Basic Med Sci, 2024, 27(5): 596-602. DOI: 10.22038 / IJBMS.2024.74267.16133.; Zong Q, Bundkirchen K, Neunaber C, et al. Are the properties of bone marrow-derived mesenchymal stem cells influenced by overweight and obesity?[J]. Int J Mol Sci, 2023, 24(5): 4831. DOI: 10.3390 / ijms24054831.). Studies have shown that BMSCs can partially differentiate into SCs-like cells in vivo, which promotes peripheral nerve regeneration and functional recovery to a certain extent. However, transplanted BMSCs have problems such as low differentiation rate and survival rate, which greatly limits the biological function of BMSCs similar to SCs, making it difficult to achieve ideal results in nerve regeneration and functional recovery (Zheng M, Duan J, He Z, et al. Overexpression of tropomyosin receptor kinase a improves the survival and Schwann-like cell differentiation of bone marrow stromal cells in nerve grafts for bridging ratsciatic nerve defects [J]. Cytotherapy, 2016, 18(10): 1256-69. DOI: 10.1016 / j.jcyt.2016.06.015.).MicroRNAs (miRNAs) are a class of single-stranded non-coding small RNA molecules that regulate post-transcriptional gene expression by inhibiting the translation of target mRNAs or promoting the degradation of transcripts. In mammals, miRNAs are involved in regulating a variety of biological responses such as stem cell differentiation, self-renewal, and division. However, it is still unclear whether miR-21 plays a role in the differentiation of BMSCs into SCs-like cells. Summary of the invention

[0003] In view of this, the purpose of the present invention is to provide the use of miR-21 in the preparation of agents for promoting BMSCs differentiation and drugs for repairing peripheral nerve damage. The present invention found that miR-21 significantly promotes peripheral nerve regeneration by increasing the differentiation rate of BMSCs into SCs-like cells in vivo.

[0004] The present invention provides the use of miR-21 in preparing a reagent for promoting BMSCs differentiation. Overexpression of miR-21 in BMSCs can promote the differentiation of BMSCs into SCs-like cells.

[0005] The present invention provides the use of a miR-21 agonist in preparing a reagent for promoting BMSCs differentiation. Transfection of the miR-21 agonist in BMSCs can promote the differentiation of BMSCs into SCs-like cells.

[0006] Preferably, the sequence of the miR-21 agonist is shown as SEQ ID NO.1.

[0007] Preferably, the differentiation is in vitro differentiation or in vivo differentiation.

[0008] The present invention provides application of miR-21 in preparing medicine for repairing peripheral nerve damage.

[0009] The present invention provides the use of a miR-21 agonist in preparing a medicine for repairing peripheral nerve damage.

[0010] The present invention provides the use of BMSCs overexpressing miR-21 in preparing a medicine for repairing peripheral nerve damage.

[0011] Preferably, BMSCs overexpressing miR-21 are applied to damaged peripheral nerves.

[0012] Preferably, the peripheral nerve comprises the sciatic nerve.

[0013] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides the use of miR-21 in the preparation of reagents for promoting BMSCs differentiation and drugs for repairing peripheral nerve damage. The present invention has found that miR-21 significantly promotes peripheral nerve regeneration by increasing the differentiation rate of BMSCs into SCs-like cells in vivo. The present invention adopts miR-21 agonist or blocker to transfect BMSCs in vitro, the expression of miR-21 in the agomir-21 group is significantly increased, and the expression of miR-21 in the antagomir-21 group is significantly decreased; in order to detect whether miR-21 affects the differentiation of BMSCs transplanted into the nerve injury area and the effect on PNI repair, the transfected BMSCs are transplanted into the 12mm sciatic nerve injury area of ​​rats, and 2 weeks after transplantation, the footprint experiment and the gastrocnemius wet weight ratio test results show that compared with the BMSCs group, the motor function of the affected hind limb and the gastrocnemius atrophy of the rats in the agomir-21 group are significantly improved, while the recovery effect of the antagomir-21 group is significantly reduced, indicating that BMSCs overexpressing miR-21 significantly promote the recovery of the motor function of the sciatic nerve, while the downregulation of miR-21 inhibits nerve regeneration.

[0014] The present invention found that miR-21 can improve the efficiency of transplanted BMSCs differentiation into SCs-like cells, significantly promote the reconstruction of peripheral nerve fiber structure and functional recovery, and provide a new idea for exploring the mechanism of peripheral nerve regeneration. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The morphology and identification of BMSCs were observed under an inverted microscope. BMSCs were cultured for 7 days in the primary generation (A1), 5 days in the second generation (A2), and 2 days in the third generation (A3). Immunofluorescence staining of CD29 (B1), CD90 (B2), and CD34 (B3) was performed after culturing the fourth generation BMSCs for 2 days. The blue color indicates the cell nucleus labeled with DAPI. Scale bars = 100 μm (A1-A3), 50 μm (B1-B3).

[0016] Figure 2 BMSCs transfection efficiency detection. Bright field observation (A1-A4) and fluorescence microscope observation (B1-B4) of each group of cells 24 hours after BMSCs transfection, blue shows DAPI-labeled cell nuclei; cell transfection efficiency statistics (C); qRT-PCR detection of the relative expression of miR-21 in each group (D); Scale bar = 100μm (A1-A4), 50μm (B1-B4), n = 3; a P<0.05vs BMSCs, b P<0.05vs agomir-NC, c P<0.05 vs antagomir-21, dP<0.05vs antagomir-NC.

[0017] Figure 3 Preparation and detection of sciatic nerve injury model. Schematic diagram of nerve injury model (A); DAPI-labeled nuclei at different injury sites (B1-B3), PI staining of sciatic nerve longitudinal sections (C1-C3), and merged images of DAPI-labeled nuclei and PI-positive cells (D1-D3); quantitative analysis of dead cells (E); scale bar = 20 μm, n = 3; # P<0.05vs freeze-thaw area.

[0018] Figure 4 To evaluate the neurological function and muscle atrophy 2 weeks after surgery, the hind foot prints of the affected side of the rats in each group (A); the statistical graphs of SFI and gastrocnemius muscle wet weight ratio (C) in each group; n = 6, a P<0.05vs BMSCs, b P<0.05 vs agomir-NC, c P<0.05 vs antagomir-21, d P<0.05vs antagomir-NC.

[0019] Figure 5 NF-200 and MBP immunofluorescence staining of the cross section of the sciatic nerve 2 weeks after surgery; NF200 (A1-A5) and MBP (B1-B5) immunofluorescence staining of each group, merged images of NF200, MBP positive cells and Hoechst33342-labeled BMSCs (C1-C5), magnified images of the boxed areas of each group (D1-D5); statistical graphs of IOD values ​​of NF-200 (E) and MBP (F); scale bar = 20 μm, n = 4; a P<0.05vs BMSCs, b P<0.05 vs agomir-NC, c P<0.05 vs antagomir-21, d P<0.05 vs antagomir-NC.

[0020] Figure 6The cross-section of the sciatic nerve was immunofluorescently stained for S100 and GFAP at 2 weeks after surgery. Immunofluorescent staining of S100 (A1-A5) and GFAP (E1-E5) in each group; BMSCs labeled with Hoechst33342 (B1-B5, F1-F5); Merged images of S100-positive cells and BMSCs labeled with Hoechst33342 (C1-C5); Merged images of GFAP-positive cells and BMSCs labeled with Hoechst33342 (G1-G5); Enlarged images of the boxed areas in each group (D1-D5, H1-H5); Statistical graph of S100 and GFAP positive rates (I); Scale bar = 20 μm, n = 4; a P<0.05vs BMSCs, b P<0.05 vs agomir-NC, c P<0.05 vs antagomir-21, d P<0.05vs antagomir-NC. DETAILED DESCRIPTION

[0021] The present invention provides the use of miR-21 in preparing a reagent for promoting BMSCs differentiation. The present invention finds that overexpression of miR-21 in BMSCs can promote BMSCs to differentiate into SCs-like cells.

[0022] The present invention provides the use of a miR-21 agonist in the preparation of a reagent for promoting BMSCs differentiation, transfecting the miR-21 agonist in BMSCs to achieve overexpression of miR-21, thereby promoting the differentiation of BMSCs into SCs-like cells. In the present invention, the sequence of the miR-21 agonist is preferably as shown in SEQ ID NO.1, specifically as follows:

[0023] sense(5'-3'): UAGCUUAUCAGACUGAUGUUGA(SEQ ID No.1), antisense(5'-3'):

[0024] (mA)*(mA)*(mC)(mA)(mU)(mC)(mA)(mG)(mU)(mC)(mU)(mG)(mA)(mU)(mA)(mA)(mG)(mC)(mU)*(mA)*(mU)*(mU)*(Chole)(SEQ ID No. 2).

[0025] In the present invention, the differentiation is in vitro differentiation or in vivo differentiation; the present invention particularly solves the problem of low differentiation rate and survival rate of currently transplanted BMSCs; by overexpressing miR-21 in BMSCs, the differentiation rate of transplanted BMSCs into SCs-like cells in vivo is increased.

[0026] The present invention also provides the use of miR-21 in preparing a medicine for repairing peripheral nerve damage.

[0027] The present invention provides the use of a miR-21 agonist in preparing a medicine for repairing peripheral nerve damage.

[0028] The present invention provides the use of BMSCs overexpressing miR-21 in the preparation of a drug for repairing peripheral nerve damage. In the present invention, BMSCs overexpressing miR-21 act on damaged peripheral nerves, and the peripheral nerves preferably include sciatic nerves. The present invention transplants BMSCs overexpressing miR-21 to the site of nerve damage, so that the density of regenerated nerve fibers increases, the expression of myelin marker proteins increases, and the rate of BMSCs differentiation into SCs-like cells significantly increases, thereby repairing peripheral nerve damage.

[0029] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0030] Example 1

[0031] Test materials

[0032] Five SPF SD rats, weighing 70-90 g, of either sex, were used for the culture of BMSCs. 50 SPF female SD rats, weighing 180-200 g, were used to construct the sciatic nerve injury model. All experimental animals were purchased from the Experimental Animal Center of Ningxia Medical University.

[0033] DMEM / F12 (purchased from Hyclone);

[0034] AmpFront South American serum (purchased from Ausells Biotechnology (Shanghai) Co., Ltd.);

[0035] rabbit anti-rat CD90, CD29, and CD34 antibodies (purchased from Wuhan Boster Bioengineering Co., Ltd.);

[0036] Rabbit anti-rat S100 and rat anti-mouse MBP antibodies (purchased from Abcamplc, UK);

[0037] rabbit anti-rat GFAP and NF-200 antibodies (purchased from Wuhan Sanying Biotechnology Co., Ltd.);

[0038] Hochest33342 fluorescent dye (purchased from Sigma);

[0039] Alexa fluor488, 647 labeled goat anti-rabbit antibody, Alexa fluor488 goat anti-rat antibody (purchased from Abcamplc);

[0040] The sequences of miR-21agomir, agomir-NC, miR-21antagomir-21, and antagomir-NC were commissioned to be synthesized by Shanghai Sangon Biotechnology Co., Ltd.;

[0041] CO2 constant temperature incubator (purchased from Yishike Enterprise Development Co., Ltd.);

[0042] Fluorescence microscope (CKX41, purchased from Olympus, Japan);

[0043] Image analysis system (image J, 1.53q).

[0044] Statistical methods

[0045] GraphPad Prism10 software was used for statistical analysis. The measured data were expressed as mean ± standard deviation (X ± s). One-way analysis of variance was used for comparison among the groups. The test level was P < 0.05, which was considered statistically significant.

[0046] Test methods and results

[0047] Culture and identification of BMSCs

[0048] SPF SD rats weighing 60-80g were taken. After inhalation of isoflurane anesthesia, the femur and tibia were separated, and the epiphysis was removed. The bone marrow was flushed into the culture bottle using DMEM / F12 medium containing 10% FBS, and placed in a constant temperature incubator at 37°C and 5% CO2 for culture. The third generation BMSCs with good growth status were taken for climbing. After the cell density reached 70%-80%, they were fixed with PBS solution containing 4% paraformaldehyde for 15min, blocked with 10% goat serum for 1h, and rabbit anti-rat CD29, CD90, CD34 antibodies (1:100) were added at 4°C overnight. The next day, Alexa488-labeled goat anti-rabbit antibody (1:200) was added and incubated at room temperature for 2h, followed by sealing with anti-fluorescence quenching sealing agent containing DAPI and observation under a fluorescence microscope. Five fields of view were randomly selected from each slide, and the cells were counted using an image analysis system. The BMSCs positive cell rate = the number of cells labeled with Alexa488 / the total number of cells labeled with DAPI × 100%.

[0049] The results are as follows Figure 1 As shown in the figure, some BMSCs adhered to the wall when they were first inoculated. On the 7th day of culture, the cells were fusiform or spindle-shaped and fused into sheets with a density of 80% to 90% ( Figure 1A1 in the figure). After 5 days of culture in the second generation, the cells gradually became purified, and most of them were long spindle-shaped with strong refractive index ( Figure 1 A2 in the figure). At 2 days after the third generation of culture, BMSCs were distributed like a school of fish and grew in a whirlpool shape ( Figure 1 A3 in the figure). Fluorescence staining results showed that the ratios of CD29 and CD90 positive cells were 98.72% and 97.75% respectively, and the cells did not express the hematopoietic stem cell marker protein CD34 ( Figure 1 B1~B3 in it).

[0050] Cell transfection and grouping

[0051] BMSCs in good cell condition at the 4th generation were taken and transfected when the cell density reached 70%. The green fluorescent labeled miR-21agomir, agomir-NC, miR-21antagomir-21, and antagomir-NC were mixed with the transfection reagent INVIDNARNA (purchased from Shanghai Noning Biotechnology Co., Ltd., catalog number: IV1216075) at a ratio of 1:1, and allowed to stand for 15 minutes. Then, they were mixed with DMEM / F12 without penicillin and streptomycin to make the sequence concentration of each group 50nM. After standing in the incubator for 24 hours, the cell nucleus was labeled with Hoechst33342, and each group of cells was observed under an inverted microscope. The total RNA of each group of cells was extracted using RNeasyMini Kit, and miRNA 1 st Strand cDNA Synthesis Kit (purchased from Nanjing Novozyme Biotechnology Co., Ltd., catalog number: MR101-02) was used to reverse transcribe RNA into cDNA. Amplification was performed according to the kit under the following conditions: initial denaturation at 95°C for 60 s, denaturation at 95°C for 10 s, annealing at 60°C for 30 s, for a total of 40 cycles. U6 was used as an internal reference. -ΔΔC Methods The relative expression level of the target gene was calculated. Primers for miR-21, forward: 5'-GCGCGTAGCTTATCAGACTGA-3' (SEQ ID No. 7), reverse: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACT CAACA-3' (SEQ ID No. 8).

[0052] agomir-21 (agonist) gene sequence

[0053] sense(5'-3'):

[0054] UAGCUUAUCAGACUGAUGUUGA(SEQ ID No.1)

[0055] antisense(5'-3'):

[0056] (mA)*(mA)*(mC)(mA)(mU)(mC)(mA)(mG)(mU)(mC)(mU)(mG)(mA)(mU)(mA)(mA)(mG)(mC)(mU)*(mA)*(mU)*(mU)*(Chole)(SEQ ID No. 2)

[0057] agomir-NC (agonist control) gene sequence

[0058] sense(5'-3'):

[0059] UUGUACUACACAAAAGUACUG(SEQ ID No.3)

[0060] antisense(5'-3'):

[0061] (mG)*(mU)*(mA)(mC)(mU)(mU)(mU)(mU)(mG)(mU)(mG)(mU)(mA)(mG)(mU)(mA)(mC)(mA)*(mA)*(mU)*(mU)*(Chole)(SEQ ID No.4)

[0062] Antagomir-21 (inhibitor) gene sequence

[0063] sense(5'-3'):

[0064] (mU)*(mC)*(mA)(mA)(mC)(mA)(mU)(mC)(mA)(mG)(mU)(mC)(mU)(mG)(mA)(mU)(mA)(mA)(mG)*(mC)*(mU)*(mA)*(Chole)(SEQ ID No. 5)

[0065] antisense empty unsequence

[0066] Antagomir-NC (inhibitor control) gene sequence

[0067] sense(5'-3'):

[0068] (mC)*(mA)*(mG)(mU)(mA)(mC)(mU)(mU)(mU)(mU)(mG)(mU)(mG)(mU)(mA)(mG)(mU)(mA)*(mC)*(mA)*(mA)*(Chole)(SEQ ID No. 6)

[0069] antisense empty unsequence

[0070] Among them: m represents methoxy modification, * represents thiophosphate modification, and chole represents cholesterol.

[0071] The results are as follows Figure 2 As shown, the bright field observation of each group of cells is as follows Figure 2 As shown in A1 to A4 in FIG. , fluorescence microscopy observation is as follows Figure 2 As shown in B1 to B4; 24 hours after transfection, the cells in each group were in good condition, with a density of 80% to 90% ( Figure 2 A1~A4 in the figure). The results of fluorescence microscopy showed that the transfection efficiency of each group of cells was more than 80% ( Figure 2 B1~B4 and C in the figure). qRT-PCR results showed that compared with the BMSCs group and agomir-NC group, the expression of miR-21 in the agomir-21 group was significantly increased, with statistically significant differences (P<0.05). Compared with the BMSCs group and antagomir-NC group, the expression of miR-21 in the antagomir-21 group was significantly decreased (P<0.05, Figure 2 D).

[0072] Construction of rat sciatic nerve injury model

[0073] After anesthetizing 180-200g rats, place them in the prone position, and make a longitudinal incision from the buttocks to the posterior femoral area to expose the sciatic nerve. Use mosquito forceps (1mm wide) to squeeze both ends of the nerve. The proximal injury is located 5mm distal to the inferior foramen of the piriformis muscle, and the distal injury is located 6mm proximal to the injury. Use a cotton swab dipped in liquid nitrogen to gently tap the 6mm long area in the middle of the squeezed injury at both ends, and then thaw naturally at room temperature. Repeat freezing and thawing 5 times. During this process, the mosquito forceps at the injury site are always kept closed. The mosquito forceps are closed for 5 minutes, and a 12mm nerve injury area ( Figure 3 (A). The tip of the forceps was wrapped with a polyvinyl chloride tube (1 mm thick) to prevent damage to the normal areas at both ends. After repeated freezing and thawing, the epineurium at the injury site was marked with a 10-0 suture.

[0074] Quantitative analysis of cell death in sciatic nerve

[0075] After repeated freezing and thawing, the epineurium of the proximal and distal areas of the crushed nerve and the repeated freezing and thawing areas was immediately removed, and the nerve was immersed in propidium iodide (PI) solution (1:100) for 5 minutes and fixed with 4% paraformaldehyde overnight. After the nerve tissue was immersed in sucrose solution for dehydration, longitudinal sections were prepared and observed under a fluorescence microscope. Three sections were randomly selected from each nerve segment in each group, and two high-power fields (400×) were randomly selected from each section. The image analysis system was used to count cells, and the sciatic nerve death cell rate = PI-stained cells / DAPI-labeled total cells × 100%.

[0076] PI fluorescence staining of the sciatic nerve revealed that almost all cells in the repeated freezing and thawing area showed red fluorescence, while normal nerves proximal and distal to the nerve injury area showed no red fluorescence ( Figure 3 The statistical results showed that compared with the repeated freezing and thawing area, the normal nerves adjacent to the nerve injury area had almost no dead cells, and this was statistically significant (P<0.05, Figure 3 E).

[0077] Cell transplantation

[0078] The 50 rats with the rat sciatic nerve injury model constructed above were divided into five groups: BMSCs transplantation group (BMSCs group), agomir-21 transplantation group (agomir-21 group), agomir-NC transplantation group (agomir-NC group), antagomir-21 transplantation group (antagomir-21 group) and antagomir-NC group (antagomir-NC group). Cells from each group in the experiment were labeled with Hoechst33342 and prepared into a density of 6×10 5 A single cell suspension was prepared by inserting a micro-syringe from the distal end of the injury and injecting 10 μl of the cell suspension at both ends of the acellular nerve region (injection point Figure 3 The incision was rinsed with gentamicin and then sutured layer by layer.

[0079] Sciatic functional index (SFI) measurement

[0080] 2 weeks after surgery, the hind feet of each group of rats were dipped in appropriate amount of ink and made to walk on white paper to leave footprints. The footprint length (NPL), middle toe distance (NITS) and toe width (NTS) of the healthy side of each rat, and the footprint length (EPL), middle toe distance (EITS) and toe width (ETS) of the affected side were measured. SFI was calculated according to Bain's formula = -38.3 (EPL-NPL) / NPL+109.5 (ETS-NTS) / NTS+13.3 (EITS-NITS) / NITS-8.8. The closer the SFI value is to 0, the better the recovery of neurological function, and -100 indicates complete loss of neurological function.

[0081] Gastrocnemius muscle wet weight ratio determination

[0082] 2 weeks after surgery, the rats were anesthetized, and the affected and healthy gastrocnemius muscles of each group were completely separated and weighed immediately using an electronic balance accurate to 1 / 10,000, and the muscle wet weight ratio was calculated. The formula was: gastrocnemius wet weight ratio = affected side gastrocnemius wet weight / healthy side gastrocnemius wet weight × 100%.

[0083] result:

[0084] At 2 weeks after surgery, behavioral results showed that the SFI value of the agomir-21 group was significantly higher than that of the BMSCs group and the agomir-NC group, while the SFI value of the antagomir-21 group was significantly lower than that of the BMSCs group and the antagomir-NC group (P<0.05, Figure 4 A and B in Figure 1). Compared with the BMSCs group and agomir-NC group, the wet weight ratio of gastrocnemius muscle in the agomir-21 group was significantly increased (P<0.05); compared with the BMSCs group, the wet weight ratio of gastrocnemius muscle in the antagomir-21 group was significantly decreased (P<0.05, Figure 4 C).

[0085] Immunofluorescence staining

[0086] Two weeks after surgery, the middle sciatic nerves of rats in each group were made into paraffin sections with a thickness of 5 μm. After dewaxing, they were immersed in EDTA solution for heat repair for 15 minutes, blocked with 10% goat serum at room temperature for 1 hour, and the primary antibodies NF-200 (1:200), MBP (1:200), S100 (1:100), and GFAP (1:100) were added at 4°C overnight. The next day, Alexa488-labeled goat anti-rabbit antibody or goat anti-rat antibody (1:200) was added and incubated at room temperature for 2 hours, and then sealed with sealing agent. Three sections of the middle nerves of each group were randomly selected, and two high-power fields (400×) were randomly selected for each section. The integral optical density (IOD) value of the positive expression of immune reaction in the regenerated nerve was determined by image analysis system.

[0087] Expression of NF-200 and MBP in regenerating nerves

[0088] 2 weeks after surgery, immunofluorescence staining showed that compared with the BMSCs group, a large number of NF-200 and MBP positive expressions were observed in the agomir-21 group, while the antagomir-21 group showed a significant decrease in NF-200 and MBP positive expressions compared with the other groups ( Figure 5The statistical results of NF200 and MBP integrated optical density (IOD) values ​​showed that compared with the BMSCs group and agomir-NC group, the IOD values ​​of NF-200 and MBP positive expression in the agomir-21 group were significantly increased (P<0.05); compared with the BMSCs group and antagomir-NC group, the IOD values ​​of NF-200 and MBP positive expression in the antagomir-21 group were significantly decreased (P<0.05); while there was no statistical difference between the BMSCs group and the agomir-NC group and the antagomir-NC group (P>0.05, Figure 5 E and F in ).

[0089] Expression of GFAP and S100 in regenerated nerves

[0090] 2 weeks after surgery, immunofluorescence staining results showed that a large amount of S100 and GFAP positive expression was observed in the agomir-21 group, while the positive expression of protein in the antagomir-21 group was significantly reduced compared with the other groups ( Figure 6 The statistical results of cell differentiation rate showed that compared with the BMSCs group and agomir-NC group, the S100 and GFAP positive cell rates in the agomir-21 group were significantly increased (P<0.05); compared with the BMSCs group and antagomir-NC group, the S100 and GFAP positive cell rates in the antagomir-21 group were significantly decreased (P<0.05); while there was no statistical difference between the BMSCs group and the agomir-NC group and the antagomir-NC group (P>0.05, Figure 6 I in.

[0091] From the above examples, it can be seen that the present invention found that miR-21 can improve the efficiency of BMSCs differentiation into SCs-like cells in vivo, significantly promote the reconstruction of peripheral nerve fiber structure and functional recovery, and provide a new idea for exploring the mechanism of peripheral nerve regeneration.

[0092] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. The use of miR-21 in the preparation of a reagent for promoting BMSCs differentiation, characterized in that: Overexpression of miR-21 in BMSCs can promote the differentiation of BMSCs into SCs-like cells.

2. The use of miR-21 agonist in the preparation of a reagent for promoting BMSCs differentiation, characterized in that: Transfection of miR-21 agonist into BMSCs can promote the differentiation of BMSCs into SCs-like cells.

3. The use according to claim 2, characterized in that: The sequence of the miR-21 agonist is shown in SEQ ID NO.

1.

4. The use according to any one of claims 1 to 3, characterized in that: The differentiation is in vitro differentiation or in vivo differentiation.

5. Application of miR-21 in the preparation of drugs for repairing peripheral nerve damage.

6. Application of miR-21 agonists in the preparation of drugs for repairing peripheral nerve damage.

7. Application of BMSCs overexpressing miR-21 in the preparation of drugs for repairing peripheral nerve damage.

8. The use according to claim 7, characterized in that: BMSCs overexpressing miR-21 were applied to injured peripheral nerves.

9. The use according to claim 8, characterized in that: The peripheral nerves include the sciatic nerve.

Images