CRISPR / Cas-based intracellular mycobacterium tuberculosis in-situ nucleic acid detection method and application

Abstract

The invention provides an intracellular mycobacterium tuberculosis in-situ nucleic acid detection method based on CRISPR / Cas and application, and the method comprises the following steps: S1, designing crRNA and a primer pair of a mycobacterium tuberculosis target gene sequence, and synthesizing a single-stranded DNA fluorescent probe; s2, preparing a standard solution containing a target gene sequence, and incubating with a CRISPR / Cas12a system; s3, extracting nucleic acids of different types of bacteria, uniformly mixing the nucleic acids of different types of bacteria with the CRISPR / Cas12a system, and incubating; s4, incubating an attenuated strain of mycobacterium tuberculosis and the DNA fluorescent probe, infecting macrophages, and incubating to obtain infected cells; s5, electrically transferring a CRISPR / Cas12a system into the infected cells in S4 by utilizing an electroporation technology, incubating, and detecting the intensity of a fluorescence signal; and S6, performing quantitative and positioning analysis on the detected fluorescence signal to complete detection, and directly introducing a CRISPR / Cas12a system into the macrophage by adopting an electroporation technology to realize intracellular in-situ detection, thereby avoiding the operation complexity of a nucleic acid extraction link and the loss of detection sensitivity in the prior art.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid detection technology, and in particular to a CRISPR / Cas-based in situ nucleic acid detection method and application of intracellular Mycobacterium tuberculosis. Background Art

[0002] Tuberculosis is generally caused by infection with Mycobacterium tuberculosis (Mtb) and is one of the major public health problems worldwide. In the early stage of infection or when the bacterial load is low, such as residual bacteria in the body after treatment, the clinical symptoms are usually not obvious, and the pathogen is in a latent state in macrophages. In this state, Mycobacterium tuberculosis has low metabolic activity, slow replication, low antigen expression level, and complex cell wall structure, which increases the difficulty of detection and the risk of missed diagnosis, which may lead to delayed treatment, worsening of the disease, development of drug resistance and the risk of disease transmission. Existing diagnostic methods include sputum smear examination, bacterial culture, nucleic acid amplification detection (such as PCR) and imaging examination. These methods have limitations such as insufficient sensitivity, long detection cycle and complex operation, especially in the diagnosis of latent tuberculosis infection and early stages of tuberculosis. In recent years, the CRISPR / Cas system has received widespread attention in nucleic acid detection due to its high sensitivity and specificity. Among them, CRISPR / Cas12a significantly amplifies the signal through its unique non-specific ssDNA cleavage activity, becoming an ideal tool for rapid and simple nucleic acid detection.

[0003] Current related technologies such as SHERLOCK, DETECTR and HOLMES systems mainly combine isothermal amplification technology to achieve efficient nucleic acid detection of extracellular samples. However, under low bacterial count conditions, it is difficult to extract nucleic acid due to the complex structure of the tuberculosis cell wall, and the test results have the risk of false negatives. In addition, the portable detection technology of CRISPR combined with lateral flow test strips is also limited to the analysis of extracellular liquid nucleic acid samples, and has not yet solved the problem of accurate in situ detection of intracellular Mtb nucleic acid. Existing technologies have defects in the detection of Mycobacterium tuberculosis, such as insufficient sensitivity, long detection cycle, limited specificity and complex operation. Although traditional methods such as sputum smears, PCR and bacterial culture have met clinical needs to a certain extent, they have low diagnostic efficiency for patients with low bacterial counts or latent infections. At the same time, the operation is complicated and relies on expensive equipment, making it difficult to promote to resource-poor areas. In addition, existing detection technologies are mostly targeted at in vitro samples, and cannot directly achieve accurate detection and dynamic monitoring of Mtb nucleic acids in host cells.

[0004] Therefore, the relevant technologies and application research on in situ nucleic acid detection methods for Mycobacterium tuberculosis still need to be further improved. Summary of the invention

[0005] In view of this, the present invention proposes an in situ nucleic acid detection method and application of intracellular Mycobacterium tuberculosis based on CRISPR / Cas, which solves the technical problems of insufficient sensitivity, long detection cycle, limited specificity and complex operation in the detection of Mycobacterium tuberculosis in the prior art.

[0006] The technical solution of the present invention is achieved in this way:

[0007] The present invention provides a CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis, comprising the following steps:

[0008] S1. Design guide RNA (i.e., crRNA) and primer pairs of the target gene sequence of Mycobacterium tuberculosis, and synthesize single-stranded DNA fluorescent probes;

[0009] S2, prepare a standard solution containing the target gene sequence, dilute it, incubate it with the CRISPR / Cas12a system, and detect the fluorescence signal intensity;

[0010] S3, extracting nucleic acids from different types of bacteria, mixing the nucleic acids from different types of bacteria with the CRISPR / Cas12a system, incubating, and detecting the fluorescence signal intensity;

[0011] S4, incubating the attenuated strain of Mycobacterium tuberculosis with the DNA fluorescent probe to infect macrophages, incubating for 2-4 hours, washing, and obtaining infected cells;

[0012] S5. Using electroporation technology, the CRISPR / Cas12a system was electroporated into the infected cells described in S4 at different ratios, incubated, and the fluorescence signal intensity was detected;

[0013] S6. Quantitatively analyze and position the detected fluorescent signal to complete the detection.

[0014] On the basis of this technical solution, further preferably, when the sample to be tested has a low bacterial count, the method further comprises:

[0015] S7. Mix the CRISPR / Cas12a system with the RPA constant temperature amplification system and RPA buffer, and repeat S1-S6.

[0016] On the basis of this technical solution, it is further preferred that the target sequence in step S1 includes IS6110, IS1081, esxB, gryB, rpoB, katG, inhA, rpsL, gyrA, gyrB, eis or pncA.

[0017] The crRNA described in step S1 includes crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8 and crRNA9.

[0018] The nucleotide sequence of crRNA1 in step S1 is shown in SED IQ NO 1:

[0019] UAAUUUCUACUCUUGUAGAUAUCAGCUCGGUCUUGUAUAG(SED IQ NO 1).

[0020] On the basis of this technical solution, further preferably, the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is shown as SED IQ NO 2, and the nucleotide sequence of IS6110-R is shown as SEDIQ NO 3.

[0021] GGTCGGAAGCTCCTATGACAATGCACTAGCC(SED IQ NO 2).

[0022] TTGAGCGTAGTAGGCAGCCTCGAGTTCGAC (SED IQ NO 3).

[0023] The nucleotide sequence of crRNA2 in step S1 is shown in SED IQ NO 4:

[0024] 5'-AAUUUCUACUAAGUGUAGAUCGGGCACCGUAAACACCGUA-3'

[0025] (SED IQ NO 4).

[0026] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 5, and the nucleotide sequence of IS6110-R is as shown in SEDIQ NO 6:

[0027] GAGTTTGGTCATCAGCCGTT(SED IQ NO 5).

[0028] CATCGACCTACTACGACCACAT(SED IQ NO. 6).

[0029] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 7, and the nucleotide sequence of IS6110-R is as shown in SEDIQ NO 8:

[0030] ACAGGCCGAGTTTGGTCAT (SED IQ NO 7).

[0031] CGACCTACTACGACCACATCAA (SED IQ NO 8).

[0032] The nucleotide sequence of crRNA3 in step S1 is shown in SED IQ NO 9:

[0033] 5'-AAUUUCUACUAAGUGUAGUAUAUCAGCUCGGUCUUGUAUAG-3'

[0034] (SED IQ NO 9).

[0035] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 10, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 11:

[0036] CGTAGTAGGCAGCCTCGAGTT (SED IQ NO 10).

[0037] CGGATAGGGGATCTCAGTACAC(SED IQ NO 11).

[0038] The nucleotide sequence of crRNA4 in step S1 is shown in SED IQ NO 12:

[0039] 5'-AAUUUCUACUAAGUGUAGAUGUCAUCAGCCGUUCGACGGU-3'

[0040] (SED IQ NO 12).

[0041] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 13, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 14:

[0042] GTCGACACATAGGTGAGGTCTG (SED IQ NO 13).

[0043] CAAAGTGTGGCTAACCCTGAAC(SED IQ NO 14).

[0044] The nucleotide sequence of crRNA5 in step S1 is shown in SED IQ NO 15:

[0045] 5'-AAUUUCUACUAAGUGUAGAUAGGUCGAGUACGCCUUCUUG-3'

[0046] (SED IQ NO 15).

[0047] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 16, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 17.

[0048] ACCGGATCGATGTGTACTGAG(SED IQ NO 16).

[0049] GACCTCACCTATGTGTCGACCT(SED IQ NO 17).

[0050] The nucleotide sequence of crRNA6 in step S1 is shown in SED IQ NO 18:

[0051] 5'-AAUUUCUACUAAGUGUAGAUGGUCGAGUACGCCUUCUUGU-3'

[0052] (SED IQ NO 18).

[0053] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 19, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 20:

[0054] ACCGGATCGATGTGTACTGAG(SED IQ NO 19).

[0055] GACCTCACCTATGTGTCGACCT(SED IQ NO 20).

[0056] The nucleotide sequence of crRNA7 in step S1 is shown in SED IQ NO 21:

[0057] 5'-AAUUUCUACUAAGUGUAGAUACGAUGGCCACCUCCAUGGU-3'

[0058] (SED IQ NO 21).

[0059] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 22, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 23:

[0060] TGTACTGAGATCCCCTATCCGT (SED IQ NO 22).

[0061] GACCTCACCTATGTGTCGACCT(SED IQ NO 23).

[0062] The nucleotide sequence of crRNA8 in step S1 is shown in SED IQ NO 24:

[0063] 5'-AAUUUCUACUAAGUGUAGAUCCUACGUGGCCUUUGUCACC-3'

[0064] (SED IQ NO 24).

[0065] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 25, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 26:

[0066] GGTGGATAACGTCTTTCAGGTC (SED IQ NO 25).

[0067] CTGTGGGGTAGCAGACCTCACC(SED IQ NO 26).

[0068] The nucleotide sequence of crRNA9 in step S1 is shown in SED IQ NO 27:

[0069] 5'-AAUUUCUACUAAGUGUAGAUGGGUUAGCCACACUUUGCGG-3'

[0070] (SED IQ NO 27).

[0071] On the basis of this technical solution, it is further preferred that the primer pair in step S1 includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is as shown in SED IQ NO 28, and the nucleotide sequence of IS6110-R is as shown in SED IQ NO 29:

[0072] GTCGACACATAGGTGAGGTCTG (SED IQ NO 28).

[0073] GAACTCAAGGAGCACATCAGC (SED IQ NO 29).

[0074] On the basis of this technical solution, it is further preferred that, for the single-stranded DNA fluorescent probe, one of the 5' end and the 3' end of the single-stranded DNA probe is labeled with a first signal molecule, and the other of the 5' end and the 3' end of the single-stranded DNA probe is labeled with a second signal molecule;

[0075] Optionally, the first signal molecule and the second signal molecule are independently selected from FAM, FITC, BHQ, Biotin or Digoxin, and the first signal molecule is different from the second signal molecule.

[0076] On the basis of this technical solution, further preferably, the sequence of the single-stranded DNA fluorescent probe is as shown in SED IQNO 30.

[0077] FAM-TTTTTTTTTTTT-BHQ (SED IQ NO 30).

[0078] On the basis of this technical solution, it is further preferred that the CRISPR / Cas12a system includes Cas12a protein, crRNA and single-stranded DNA fluorescent probe, wherein 100nM Cas12a protein, 100nM crRNA and 1500nM single-stranded DNA fluorescent probe are incubated at 37°C for 20-40min.

[0079] On the basis of this technical solution, it is further preferred that the different types of bacteria in step S3 are H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli or Staphylococcus aureus.

[0080] On the basis of this technical solution, further preferably, step S3 specifically includes the following steps:

[0081] S3. The acid-washed glass beads method was used to extract nucleic acids from different types of bacteria, including H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli, and Staphylococcus aureus. The CRISPR / Cas12a system was then mixed with nucleic acids from different types of bacteria and incubated at 37°C. The fluorescence signal was monitored in real time using an enzyme reader.

[0082] On the basis of this technical solution, further preferably, step S4 specifically includes the following steps:

[0083] S4, incubating the attenuated Mycobacterium tuberculosis strain with the DNA fluorescently labeled probe at 37° C. for 2 h, washing and centrifuging to remove unbound probes, infecting macrophages, incubating at 37° C. for 4 h, washing with PBS to remove uninfected bacteria, and then treating with trypsin to obtain infected cells;

[0084] Wherein, the volume ratio of the macrophage cell culture fluid to the CRISPR / Cas12a system is 1:(1-100).

[0085] On the basis of this technical solution, further preferably, the step S5 specifically includes the following steps:

[0086] S5. Using electroporation technology, the CRISPR / Cas12a system was electroporated into infected macrophages at different ratios, incubated at 37°C, and the fluorescence signal intensity was monitored using a microplate reader at different time points;

[0087] Wherein, the volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system is 1:(1-10).

[0088] On the basis of this technical solution, it is further preferred that the volumes of the CRISPR / Cas12a system, RPA constant temperature amplification system and RPA buffer described in step S7 are (2-8):(40-50):(1-4).

[0089] In a second aspect, the present invention also provides an application of the CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis described in the first aspect in real-time in situ imaging.

[0090] The CRISPR / Cas-based in situ nucleic acid detection method and application of intracellular Mycobacterium tuberculosis of the present invention have the following beneficial effects compared with the prior art:

[0091] The present invention provides a method for detecting intracellular Mtb nucleic acid based on CRISPR / Cas12a. By designing crRNA targeting specific genes IS6110 or IS1081, combined with efficient intracellular introduction strategy and fluorescent signal output, it is possible to detect intracellular Mtb nucleic acid in situ with high sensitivity and specificity, thus providing an innovative technical solution for early diagnosis of tuberculosis, dynamic monitoring of latent infection and precise treatment.

[0092] In addition, the present invention also introduces Cas12a protein, crRNA and reporter probe (such as FAM-labeled single-stranded DNA probe) into Mtb-infected macrophages through electroporation technology to ensure that the CRISPR / Cas12a system functions in the cells, and combines electroporation technology with the CRISPR / Cas12a system for intracellular in situ nucleic acid detection. Compared with the existing technology based on in vitro detection, it has opened up a new way to detect Mycobacterium tuberculosis.

[0093] Electroporation technology is used to directly introduce the CRISPR / Cas12a system into macrophages or clinical samples (such as alveolar lavage fluid) to achieve intracellular in situ detection, avoiding the operational complexity and loss of detection sensitivity in the nucleic acid extraction process in the existing technology.

[0094] During the intracellular detection process, Cas12a binds to crRNA to recognize the target nucleic acid, triggering its nonspecific cleavage activity, degrading the surrounding reporter probes and releasing fluorescent signals. The intensity of the fluorescent signal is proportional to the target nucleic acid content, reflecting the activity and bacterial count of Mtb in the cell.

[0095] The detection method provided by the present invention is not only suitable for laboratory research, but also can be used for the diagnosis of latent tuberculosis infection and dynamic efficacy evaluation, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0097] Figure 1 This is the specificity test result of the CRISPR-Cas12a system described in the present invention;

[0098] Figure 2 The electroporation technology described in the present invention successfully introduced the CRISPR / Cas12a system into the macrophages infected with bacteria by flow cytometry analysis results;

[0099] Figure 3After the H37Ra bacteria of the present invention infect macrophages, the fluorescence signals inside the macrophages are observed using a confocal microscope. DETAILED DESCRIPTION

[0100] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0101] The present invention provides an innovative in situ nucleic acid detection method using the CRISPR / Cas12a system, which recognizes intracellular Mycobacterium tuberculosis-specific genes (such as IS6110 or IS1081) through precisely designed crRNA, combined with multiple signal output methods such as real-time fluorescence or laser scanning confocal microscopy, to achieve rapid diagnosis and dynamic monitoring of latent infection, thereby providing technical support for the early diagnosis, precise treatment and anti-tuberculosis drug screening of latent tuberculosis or tuberculosis.

[0102] Example 1

[0103] A CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis comprises the following steps:

[0104] S1. Design guide RNA (i.e., crRNA) and primer pairs of the target gene sequence of Mycobacterium tuberculosis, and synthesize single-stranded DNA fluorescent probes;

[0105] Specifically, the target sequence includes IS6110 and IS1081, and the nucleotide sequence of the crRNA is shown in SED IQ NO1:

[0106] UAAUUUCUACUCUUGUAGAUAUCAGCUCGGUCUUGUAUAG(SED IQ NO 1).

[0107] Specifically, the primer pair includes IS6110-F and IS6110-R, wherein the nucleotide sequence of IS6110-F is shown in SED IQ NO 2, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 3:

[0108] GGTCGGAAGCTCCTATGACAATGCACTAGCC(SED IQ NO 2).

[0109] TTGAGCGTAGTAGGCAGCCTCGAGTTCGAC (SED IQ NO 3).

[0110] Specifically, the single-stranded DNA fluorescent probe, one of the 5' end and the 3' end of the single-stranded DNA probe is labeled with a first signal molecule, and the other of the 5' end and the 3' end of the single-stranded DNA probe is labeled with a second signal molecule;

[0111] Optionally, the first signal molecule and the second signal molecule are independently selected from FAM, FITC, BHQ, Biotin or Digoxin, and the first signal molecule is different from the second signal molecule.

[0112] More specifically, the sequence of the single-stranded DNA fluorescent probe is shown in SED IQ NO 30:

[0113] FAM-TTTTTTTTTTTT-BHQ (SED IQ NO 30).

[0114] S2, prepare a standard solution containing the target gene sequence, dilute it, incubate it with the CRISPR / Cas12a system, and detect the fluorescence signal intensity;

[0115] Specifically, a standard solution containing IS6110 DNA sequence (10 10 After 10-fold serial dilution, the 100 nM Cas12a (100 nM crRNA) was incubated with the CRISPR / Cas12a system (100 nM Cas12a, 100 nM crRNA, 1500 nM single-stranded DNA fluorescent probe) at 37 °C. The fluorescence signal intensity was monitored by an enzyme reader to determine the minimum detection limit of the system.

[0116] S3, extracting nucleic acids from different types of bacteria, mixing the nucleic acids from different types of bacteria with the CRISPR / Cas12a system, incubating, and detecting the fluorescence signal intensity;

[0117] Specifically, the acid-washed glass bead method was used at 95°C for 20 min to extract nucleic acids from different types of bacteria including H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli and Staphylococcus aureus. Then, 30 μL of the CRISPR / Cas12a system was mixed with 5 μL of nucleic acids from different types of bacteria and incubated at 37°C. The fluorescence signal was monitored in real time using an enzyme reader.

[0118] S4, incubating the attenuated strain of Mycobacterium tuberculosis with the DNA fluorescent probe to infect macrophages, incubating for 2-4 hours, washing, and obtaining infected cells;

[0119] The attenuated Mycobacterium tuberculosis strain and the DNA fluorescently labeled probe were co-incubated at 37°C for 2 hours, washed and centrifuged to remove unbound probes, infected macrophages, co-incubated at 37°C for 4 hours, washed with PBS to remove uninfected bacteria, and then treated with trypsin to obtain infected cells;

[0120] Wherein, the volume ratio of the macrophage cell culture fluid to the CRISPR / Cas12a system is 1:(1-100).

[0121] S5. Using electroporation technology, the CRISPR / Cas12a system was electroporated into infected macrophages at different ratios, incubated at 37°C, and the fluorescence signal intensity was monitored using a microplate reader at different time points;

[0122] Wherein, the volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system is 1:(1-10).

[0123] S6. Quantitatively analyze and position the detected fluorescent signal to complete the detection.

[0124] Example 2

[0125] A CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis comprises the following steps:

[0126] S1. Design specific molecular elements: design crRNA targeting the IS6110 gene sequence of Mycobacterium tuberculosis, and the nucleotide sequence of the crRNA is shown in SED IQ NO 1; design the primer pair required for IS6110 gene amplification: IS6110-F and IS6110-R, the nucleotide sequence of IS6110-F is shown in SED IQ NO 2, and the nucleotide sequence of IS6110-R is shown in SED IQNO 3, and then synthesize a single-stranded DNA fluorescent probe (FAM-TTTTTTTTTTTT-BHQ) as a detection reporter molecule.

[0127] S2. In vitro detection sensitivity verification: The standard solution containing IS6110 DNA sequence (10 10 After 10-fold serial dilution, the cultured cells were incubated with the CRISPR / Cas12a system (100 nM Cas12a, 100 nM crRNA, 1500 nM single-stranded DNA fluorescent probe) at 37 °C, and the fluorescence signal intensity was monitored by an enzyme reader to determine the minimum detection limit of the system.

[0128] S3. Verification of the specificity of the CRISPR / Cas12a system: The acid-washed glass bead method (95°C, 20 min) was used to extract nucleic acids from different types of bacteria (H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli, and Staphylococcus aureus). The CRISPR / Cas12a system (30 μL) was then mixed with nucleic acids from different types of bacteria (5 μL) and incubated at 37°C. The fluorescence signal was monitored in real time using an enzyme reader.

[0129] S4. Establishment of the infected cell model: The attenuated Mycobacterium tuberculosis strain H37Ra was incubated with the fluorescently labeled probe TPAPy-Tre at 37°C for 2 h, and the unbound probe was removed by washing and centrifugation. The H37Ra bacteria were infected with macrophages (RAW264.7 cells) at different ratios (1:1, 2:1, 10:1, 50:1, 100:1) and incubated at 37°C for 4 h. The uninfected bacteria were removed by washing with PBS, and the infected cells were harvested by trypsin treatment.

[0130] S5. Electroporation and fluorescence detection of CRISPR / Cas12a system: Using electroporation technology (exponential wave mode or square wave mode), the CRISPR / Cas12a system (100nM Cas12a, 100nM crRNA, 1500nM single-stranded DNA fluorescent probe) was electroporated into infected macrophages at different ratios (the ratio of system to cell culture medium was 1:10, 1:5, and 1:1), incubated at 37°C, and the fluorescence signal intensity was monitored using a microplate reader at different time points (0.5h, 1h, 2h, 4h, and 8h).

[0131] S6. Quantification and localization of fluorescence signals: The proportion of macrophages carrying FAM fluorescence signals was detected by flow cytometry, and the location of FAM fluorescence signals and TPAPy-Tre fluorescence-labeled tuberculosis bacteria in macrophages was directly observed using a laser confocal microscope to confirm the effectiveness of intracellular detection.

[0132] S7. Combine with constant temperature amplification system to improve sensitivity: In order to further reduce the detection limit, optimize the CRISPR / Cas12a system and combine it with constant temperature amplification (such as recombinant polymerase amplification, RPA) to form a one-step detection scheme. Mix the CRISPR / Cas12a system (2.5μL), RPA constant temperature amplification system (21.5μL) and RPA buffer (1.5μL), repeat the above detection steps, and verify its ability to detect low bacterial count samples.

[0133] In a preferred embodiment, the target sequence includes IS6110, IS1081, esxB, gryB, rpoB, katG, inhA, rpsL, gyrA, gyrB, eis or pncA

[0134] In a preferred embodiment, the volumes of the CRISPR / Cas12a system, RPA constant temperature amplification system and RPA buffer described in step S7 are (2-8):(40-50):(1-4).

[0135] In a preferred embodiment, the crRNA in step S1 includes crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8 and crRNA9; the primer pair in step S1 includes IS6110-F and IS6110-R.

[0136] Wherein, the nucleotide sequence of crRNA2 is shown in SED IQ NO 4, the nucleotide sequence of IS6110-F is shown in SED IQ NO 5, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 6; the nucleotide sequence of IS6110-F is shown in SED IQ NO 7, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 8;

[0137] The nucleotide sequence of crRNA3 is shown in SED IQ NO 9, the nucleotide sequence of IS6110-F is shown in SED IQ NO 10, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 11;

[0138] The nucleotide sequence of crRNA4 is shown in SED IQ NO 12, the nucleotide sequence of IS6110-F is shown in SED IQ NO 13, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 14;

[0139] The nucleotide sequence of crRNA5 is shown in SED IQ NO 15, the nucleotide sequence of IS6110-F is shown in SED IQ NO 16, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 17;

[0140] The nucleotide sequence of crRNA6 is shown in SED IQ NO 18, the nucleotide sequence of IS6110-F is shown in SED IQ NO 19, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 20;

[0141] The nucleotide sequence of crRNA7 is shown in SED IQ NO 21, the nucleotide sequence of IS6110-F is shown in SED IQ NO 22, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 23;

[0142] The nucleotide sequence of crRNA8 is shown in SED IQ NO 24, the nucleotide sequence of IS6110-F is shown in SED IQ NO 25, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 26;

[0143] The nucleotide sequence of the crRNA9 is shown in SED IQ NO 27, the nucleotide sequence of IS6110-F is shown in SED IQ NO 28, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 29.

[0144] In a preferred embodiment, the CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis is used in real-time in situ imaging.

[0145] CRISPR-Cas12a system specificity test;

[0146] The specificity of the CRISPR / Cas12a system was tested. The nucleic acids of different types of bacteria (attenuated Mycobacterium tuberculosis strain (H37Ra), Bacillus Calmette-Guérin (BCG), Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli, and Staphylococcus aureus) were extracted by the acid-washed glass bead method (95°C, 20 minutes). The CRISPR / Cas12a system (30 μL) was mixed with nucleic acids of different types of bacteria (5 μL) and incubated at 37°C. The fluorescence signal was monitored in real time using an enzyme reader.

[0147] like Figure 1 It can be seen that the results show that the CRISPR / Cas12a system can specifically recognize the nucleic acids of the attenuated strain of Mycobacterium tuberculosis (H37Ra) and Bacillus Calmette-Guérin (BCG), while the fluorescence signals of other bacterial samples are maintained at the background level.

[0148] The experimental process includes grouping as follows: first, the experimental group infected macrophages with attenuated Mycobacterium tuberculosis strain (H37Ra), with a multiplicity of infection of 10:1. Then the CRISPR / Cas12a system was introduced into the macrophages infected with bacteria by electroporation, with a volume ratio of CRISPR / Cas12a system to macrophages of 1:1, and electroporation parameters of (exponential wave mode 250V, 950μF). Finally, centrifugation, PBS washing, and centrifugation again to obtain macrophages as flow cytometry experimental subjects, and the control group selected normally cultured macrophages as flow cytometry experimental subjects.

[0149] Figure 2 The results were analyzed by flow cytometry;

[0150] It can be seen that in the experimental group, the CRISPR / Cas12a system was successfully introduced into the macrophages infected with bacteria by electroporation technology. After 2 hours of incubation at 37°C, the samples were analyzed by flow cytometry. The analysis results showed that compared with the negative control group, 97.3% of the cells in the experimental group showed detectable signals, and the fluorescence intensity was about 4 times higher than that of the control group.

[0151] Figure 3 The H37Ra bacteria infected macrophages, and the fluorescence signals inside macrophages were observed using a confocal microscope;

[0152] Through confocal laser microscopy, Mycobacterium tuberculosis (H37Ra bacteria, red fluorescent marker) in the control group lurked inside the macrophages (the cell nucleus was stained with DAPI and was blue). In this state, the FITC signal channel of the confocal microscope failed to detect any signal. In contrast, in the experimental group, the CRISPR / Cas12a system was successfully introduced into macrophages infected with bacteria using electroporation technology. After incubation at 37°C for 2 hours, the FITC signal channel of the confocal microscope successfully captured the fluorescent signal (green). These experimental results confirm that the CRISPR / Cas12a system can achieve real-time in situ imaging of intracellular bacterial nucleic acids.

[0153] In summary, the present invention provides a CRISPR / Cas-based in situ nucleic acid detection method and application of intracellular Mycobacterium tuberculosis, which uses electroporation technology to introduce the entire system into macrophages infected with Mycobacterium tuberculosis or positive tuberculosis clinical samples in one step for in situ detection of Mycobacterium tuberculosis nucleic acid. It not only surpasses the existing technology in sensitivity, specificity and ease of operation, but also achieves multi-dimensional optimization of Mycobacterium tuberculosis detection through a series of technical integration, greatly expanding the application prospects of CRISPR technology in the diagnosis of infectious diseases.

[0154] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis, characterized in that: The steps include: S1. Design crRNA and primer pairs of the target gene sequence of Mycobacterium tuberculosis and synthesize single-stranded DNA fluorescent probes; S2, prepare a standard solution containing the target gene sequence, dilute it, incubate it with the CRISPR / Cas12a system, and detect the fluorescence signal intensity; S3, extracting nucleic acids from different types of bacteria, mixing the nucleic acids from different types of bacteria with the CRISPR / Cas12a system, incubating, and detecting the fluorescence signal intensity; S4, incubating the attenuated strain of Mycobacterium tuberculosis with the DNA fluorescent probe to infect macrophages, incubating for 2-4 hours, washing, and obtaining infected cells; S5. Using electroporation technology, the CRISPR / Cas12a system was electroporated into the infected cells described in S4 at different ratios, incubated, and the fluorescence signal intensity was detected; S6. Quantitatively analyze and position the detected fluorescent signal to complete the detection.

2. The CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to claim 1, characterized in that: When the sample to be tested has a low bacterial count, the method further comprises: S7. Mix the CRISPR / Cas12a system with the RPA isothermal amplification system and RPA buffer, and repeat steps S1-S6.

3. The CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to claim 1, characterized in that: The target sequence in step S1 includes IS6110, IS1081, esxB, gryB, rpoB, katG, inhA, rpsL, gyrA, gyrB, eis or pncA.

4. The CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to claim 3, characterized in that: The crRNA in step S1 includes crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8 and crRNA9; the primer pair in step S1 includes IS6110-F and IS6110-R, Wherein, the nucleotide sequence of crRNA1 is shown in SED IQ NO 1, the nucleotide sequence of IS6110-F is shown in SED IQ NO 2, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 3; The nucleotide sequence of crRNA2 is shown in SED IQ NO 4, the nucleotide sequence of IS6110-F is shown in SED IQ NO 5, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 6; the nucleotide sequence of IS6110-F is shown in SED IQ NO 7, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 8; The nucleotide sequence of crRNA3 is shown in SED IQ NO 9, the nucleotide sequence of IS6110-F is shown in SED IQ NO 10, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 11; The nucleotide sequence of crRNA4 is shown in SED IQ NO 12, the nucleotide sequence of IS6110-F is shown in SED IQ NO 13, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 14; The nucleotide sequence of crRNA5 is shown in SED IQ NO 15, the nucleotide sequence of IS6110-F is shown in SED IQ NO 16, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 17; The nucleotide sequence of crRNA6 is shown in SED IQ NO 18, the nucleotide sequence of IS6110-F is shown in SED IQ NO 19, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 20; The nucleotide sequence of crRNA7 is shown in SED IQ NO 21, the nucleotide sequence of IS6110-F is shown in SED IQ NO 22, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 23; The nucleotide sequence of crRNA8 is shown in SED IQ NO 24, the nucleotide sequence of IS6110-F is shown in SED IQ NO 25, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 26; The nucleotide sequence of the crRNA9 is shown in SED IQ NO 27, the nucleotide sequence of IS6110-F is shown in SED IQ NO 28, and the nucleotide sequence of IS6110-R is shown in SED IQ NO 29.

5. The CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to claim 1, characterized in that: The CRISPR / Cas12a system includes Cas12a protein, crRNA and single-stranded DNA fluorescent probe, wherein 100nM Cas12a protein, 100nM crRNA and 1500nM single-stranded DNA fluorescent probe are incubated at 37°C for 20-40min.

6. The CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to claim 1, characterized in that: The different types of bacteria in step S3 are H37Ra, BCG, Mycobacterium smegmatis, Mycobacterium abscessus, Mycobacterium avium, Mycobacterium kansasii, Escherichia coli or Staphylococcus aureus.

7. The CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to claim 1, characterized in that: Step S4 specifically includes the following steps: S4, incubating the attenuated Mycobacterium tuberculosis strain with the DNA fluorescently labeled probe at 37° C. for 2 h, washing and centrifuging to remove unbound probes, infecting macrophages, incubating at 37° C. for 4 h, washing with PBS to remove uninfected bacteria, and then treating with trypsin to obtain infected cells; Wherein, the volume ratio of the macrophage cell culture fluid to the CRISPR / Cas12a system is 1:(1-100).

8. The CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to claim 1, characterized in that: The step S5 specifically comprises the following steps: S5. Using electroporation technology, the CRISPR / Cas12a system was electroporated into infected macrophages at different ratios, incubated at 37°C, and the fluorescence signal intensity was monitored using a microplate reader at different time points; Wherein, the volume ratio of the macrophage cell culture medium to the CRISPR / Cas12a system is 1:(1-10).

9. The CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to claim 2, characterized in that: The volumes of the CRISPR / Cas12a system, the RPA constant temperature amplification system and the RPA buffer are (2-8):(40-50):(1-4).

10. Use of the CRISPR / Cas-based in situ nucleic acid detection method for intracellular Mycobacterium tuberculosis according to any one of claims 1 to 9 in real-time in situ imaging.

Images