Application of EC in preparation of medicine for preventing or treating metabolic diseases

Abstract

The invention relates to the field of microorganisms, in particular to application of a microbial strain in preparation of a medicine for preventing or treating metabolic diseases, the microbial strain belongs to Enterococcus canini, and the metabolic diseases comprise diabetes, obesity, obesity-related diseases and metabolic syndromes. According to the present invention, with the application of the Enterococcus canintestini, the target spots GPR120 and MC4R for the treatment of obesity diabetes can be significantly activated; the weight, fasting blood glucose, area under a glucose tolerance curve and area under an insulin tolerance curve of obese mice can be reduced, the content of free fatty acid in plasma, total cholesterol in liver and low-density lipoprotein-cholesterol in liver can be reduced, and the content of glucagon-like peptide-1 in plasma and the content of high-density lipoprotein-cholesterol in liver can be increased.

Description

Technical Field

[0001] The present invention relates to the field of microbial drugs, and specifically to Enterococcus canintestini and its application in drugs for the treatment of metabolic diseases. Background Art

[0002] Obesity has become a chronic disease that is widespread and developing rapidly around the world. In recent years, due to the influence of genetic factors, changes in eating habits and lifestyles, obesity has become a major threat to global public health. Obesity has changed from a high-incidence disease in economically developed areas to a global chronic disease, and can lead to a variety of metabolic diseases, such as chronic liver disease, atherosclerosis, diabetes, coronary heart disease, fatty liver and hypertension. The occurrence of obesity is mostly due to an imbalance in energy intake and consumption, which leads to excessive fat accumulation. Therefore, the development of weight loss drugs has become a global research hotspot. However, the drugs currently on the market for lipid-lowering, such as statins for lowering cholesterol, fibrates for lowering triglycerides and niacin drugs, all have certain side effects. Therefore, it is of great significance to develop safe, non-toxic and side-effect-free products that can regulate abnormal lipid metabolism.

[0003] Probiotics were defined as "growth-promoting factors produced by microorganisms" in 1964, and developed into "a live microbial additive that has a positive effect on animals by affecting the balance of microbial populations in the intestines" in 1989. In 2001, the Food and Agriculture Organization of the United Nations and the World Health Organization (FAO / WHO) defined it as "live bacteria composed of a single or multiple microorganisms, which, when ingested at a certain dose, can promote human health by improving the balance of intestinal microecology." Taking probiotics can not only regulate intestinal flora, but also reduce the body's cholesterol content to a certain extent, playing a role in preventing and treating obesity. In recent years, probiotics have become a part of people's daily diet, and probiotic products added with fruits, vegetables, and specialty plants are the future development trend.

[0004] Enterococcus canintestini It was detected in fecal samples of healthy dogs in 2005 (Sabri M.Naser, et al. Enterococcus canintestini sp. nov., from faecal samples of healthy dogs. International Journal of Systematic and Evolutionary Microbiology (2005), 55, 2177–2182), is a Gram-positive bacterium, spherical, and can grow at 25-42 °C. Currently, NCBI only publishes the same model strain with different deposit numbers in different depositories but belonging to the same source. Enterococcus canintestini——CCM:7285, CCUG:37857, CCUG:51312, BCCM / LMG:13590, DSM:21207 (https: / / www.ncbi.nlm.nih.gov / Taxonomy / Browser / wwwtax.cgi).

[0005] Patent KR102065848B1 discloses a Enterococcus canintestini The invention can be used to prepare a pharmaceutical composition for preventing and treating influenza virus infection. Enterococcus canintestini It can produce lactic acid and has antagonistic ability to opportunistic and pathogenic microbial flora. Enterococcus canintestini Research on metabolism-related diseases. Summary of the invention

[0006] The purpose of the present invention is to solve the above-mentioned deficiencies in the prior art and provide Enterococcus canintestini and its application in drugs for preventing and treating metabolic diseases.

[0007] The present invention is achieved through the following technical solutions: The present invention relates to the use of microbial strains in preparing medicines for preventing or treating metabolic diseases. Enterococcus canintestini The metabolic diseases include diabetes, obesity and obesity-related diseases, and metabolic syndrome.

[0008] In this specification, the term "diabetes" includes all forms of diabetes, which are characterized by metabolic disorders and abnormally high blood sugar (hyperglycemia) due to insufficient insulin hormone levels, as described above. The term thus includes type 1 diabetes (T1D), type 2 diabetes (T2D), gestational diabetes (GDM) and impaired glucose tolerance (IGT). Type 1 diabetes is caused by autoimmune damage or idiopathic causes, and is characterized by absolute destruction of pancreatic islet function. It mostly occurs in children and adolescents and must be treated with insulin to achieve satisfactory therapeutic effects, otherwise it will be life-threatening. Type 2 diabetes is a multifactorial syndrome characterized by abnormal carbohydrate / fat metabolism, usually including high blood sugar, high blood pressure and abnormal cholesterol. Type 2 diabetes is caused by the inability of insulin to work effectively (low content of binding to receptors), so not only fasting blood sugar should be checked, but also blood sugar 2 hours after a meal, and pancreatic islet function tests should be done in particular. There are two types of diabetes during pregnancy. One is that the patient has been diagnosed with diabetes before pregnancy, which is called "diabetes complicated with pregnancy"; the other is that the patient has normal glucose metabolism or potential glucose tolerance before pregnancy, and the diabetes only appears or is diagnosed during pregnancy, which is also called "gestational diabetes mellitus (GDM)". More than 80% of pregnant women with diabetes have GDM. Impaired glucose tolerance (IGT) is a pre-diabetic state of impaired glucose metabolism associated with insulin resistance and increased risk of cardiovascular disease. According to the standards of the World Health Organization and the American Diabetes Association, glucose intolerance is defined as a two-hour glucose level of 140-199 mg / dL (7.8 to 11.0 mmol) in a 75 g oral glucose tolerance test. When the patient has an immediately elevated glucose level after 2 hours, but is lower than the standard for type 2 diabetes, he or she is considered to be in an IGT state. Fasting glucose can be normal or slightly elevated. IGT can precede type 2 diabetes by many years. IGT is also a risk factor for death.

[0009] It should be noted that the above pharmaceutical use for diabetes includes but is not limited to the treatment or prevention of type 1 diabetes (T1D), type 2 diabetes (T2D), gestational diabetes (GDM) and impaired glucose tolerance (IGT).

[0010] In this specification, the term "obesity" is associated with the body mass index (BMI). The body mass index (BMI), calculated as the weight in kilograms divided by the square of the height in meters, is the most commonly accepted calculation method for overweight and / or obesity. A BMI of more than 25 is considered overweight. A BMI of 30 or more is defined as obesity, a BMI of 35 or more is considered severe comorbidity obesity, and a BMI of 40 or more is considered morbid obesity.

[0011] As mentioned above, the term "obesity" as used herein includes overweight, obesity, comorbid obesity and morbid obesity. Therefore, the term "obesity" as used herein can be defined as a subject with a BMI greater than or equal to 25. In some embodiments, suitably, the BMI of an obese subject can be greater than or equal to 30, suitably 35, suitably 40.

[0012] Although the compositions of the present invention are particularly suitable for patients who suffer from both diabetes and obesity, the compositions of the present invention are also suitable for patients who suffer from diabetes but are not obese, and are also suitable for obese patients who have risk factors for diabetes but are not yet in a diabetic state. It is expected that obese people (but not diabetic) may limit the metabolic consequences of their obesity, i.e., the development of diabetes or at least insulin resistance.

[0013] In addition, the present invention Enterococcus canintestini The microbial strains of the species can be used to treat metabolic syndrome in mammals. Metabolic syndrome is a general term for medical conditions that increase the risk of cardiovascular disease and diabetes. Metabolic syndrome is also known as metabolic syndrome X, syndrome X, insulin resistance syndrome, Reaven's syndrome or CHAOS syndrome (Australia).

[0014] There is currently no single accepted definition of the metabolic syndrome. The World Health Organization criteria (1999) require the presence of diabetes mellitus, glucose intolerance, fasting glucose intolerance, or insulin resistance, and two of the following: Blood pressure: ≥140 / 90 mmHg; Dyslipidemia: triglyceride (TG): ≥1.695mmol / L, high-density lipoprotein cholesterol (HDL-C) ≤0.9mmol / L (male), ≤1.0mmol / L (female); Central obesity: waist:hip ratio > 0.90 (males), > 0.85 (females), and / or body mass index > 30 kg / m 2 .

[0015] Microalbuminuria: Urinary albumin excretion rate ≥ 20 mg / min, or albumin: creatinine ratio ≥ 30 mg / g.

[0016] The European Insulin Resistance Study Group (1999) defines insulin resistance as a fasting insulin value greater than 25% of that in non-diabetic individuals, plus two or more of the following: Central obesity: waist circumference ≥94cm (male), ≥80cm (female); Dyslipidemia: TG ≥ 2.0 mmol / L, and / or HDL-C < 1.0 mg / dL, or being treated for dyslipidemia; Hypertension: blood pressure ≥140 / 90 mmHg, or taking antihypertensive drugs; Fasting blood glucose ≥6.1mmol / L.

[0017] The National Cholesterol Education Program (NCEP) Treatment Strategies for Adults III (2001) requires at least three of the following: Central obesity: waist circumference ≥102cm or 40 inches (male), ≥88cm or 36 inches (female); Dyslipidemia: TG ≥ 1.695mmol / L (150mg / dl); Dyslipidemia: HDL-C <40 mg / dL (male), <50 mg / dL (female); Blood pressure: ≥130 / 85 mmHg; Fasting blood glucose ≥6.1mmol / L (110mg / dl).

[0018] Preferably, the obesity-related disease includes at least one of the following diseases: cardiovascular disease, hyperlipidemia, insulin resistance syndrome and steatohepatitis.

[0019] According to the invention, it is possible to use Enterococcus canintestini Examples of cardiovascular diseases treated with microbial strains of the species include aneurysm, angina, atherosclerosis, cerebrovascular accident (stroke), cerebrovascular disease, congestive heart failure (CHF), coronary heart disease, myocardial infarction (heart attack), and peripheral vascular disease.

[0020] An aneurysm is a localized, blood-filled bulge (ballooning) in a blood vessel caused by a diseased or weakened blood vessel wall. Aneurysms most commonly occur in the arteries at the base of the brain (cerebral arterial circle) and in the aorta (the main artery leaving the heart, a so-called aortic aneurysm). As an aneurysm grows, the risk of rupture increases, which can lead to severe bleeding or other complications, including sudden death.

[0021] Angina pectoris (commonly called angina) is severe chest pain due to myocardial ischemia (lack of blood and thus oxygen supply), usually caused by blockage or spasm of the coronary arteries (blood vessels of the heart). Coronary heart disease (the main cause of angina) is caused by atherosclerosis of the heart's arteries.

[0022] Atherosclerosis is a condition in which the walls of arteries thicken due to the accumulation of fatty substances, such as cholesterol. It is a syndrome that affects the arterial blood vessels and is a chronic inflammatory response of the arterial walls, largely due to the accumulation of white blood cells called macrophages, and is promoted by low-density (especially small-particle) lipoproteins (plasma proteins that carry cholesterol and triglycerides) and the inability of functional high-density lipoproteins (HDL) to properly remove fat and cholesterol from macrophages. Atherosclerosis is often referred to as hardening of the arteries or "furring" and is usually caused by the formation of multiple plaques within the arteries.

[0023] A stroke is a rapid loss of brain function due to a disruption in the blood supply to the brain. This may be due to ischemia (lack of blood supply) caused by a blood clot or embolism, or due to bleeding. As a result, the affected area of ​​the brain cannot function, resulting in loss of movement of one or more limbs on one side of the body, loss of ability to understand or describe speech, or loss of vision on one side of the body and ultimately death.

[0024] Cerebrovascular disease is a group of brain dysfunctions associated with vascular diseases that supply the brain. Hypertension is the most important cause of damage to the endothelium of the inner membrane of the blood vessels in contact with the underlying collagen, where platelets accumulate in the underlying collagen and initiate a repair process that is not always complete and perfect. Persistent hypertension permanently changes the structure of the blood vessels, making them narrow, stiff, deformed, and uneven, making them more susceptible to blood pressure fluctuations. A decrease in blood pressure during sleep can lead to a significant decrease in blood flow in the narrowed blood vessels, leading to morning ischemic strokes, while a sudden increase in blood pressure can cause blood vessel ruptures, leading to intracranial hemorrhage during daytime excitement. Mainly elderly people, diabetics, smokers, or people with ischemic heart disease suffer from cerebrovascular disease. All diseases related to arterial dysfunction can be classified in diseases called large vessel diseases. This is an oversimplified study, which allows fat deposits or thrombi to block arteries. The results of cerebrovascular disease may include stroke, or even sometimes hemorrhagic stroke. In the process of cerebrovascular accidents, ischemia or other vascular dysfunctions may affect one.

[0025] Heart failure is a general term for a physiological state in which cardiac output is insufficient for the body's needs. This can occur in the setting of low cardiac output (often referred to as "congestive heart failure"). Common causes of heart failure include myocardial infarction and other forms of ischemic heart disease, hypertension, valvular heart disease, and cardiomyopathy.

[0026] Coronary heart disease (or coronary artery heart disease) is the inability of the coronary artery circulation to supply adequate circulation to the heart muscle and surrounding tissues. It is often equated with atherosclerotic coronary artery heart disease, but coronary artery disease can be attributed to other causes, such as coronary vasospasm. Stenosis may be caused by spasm.

[0027] Myocardial infarction (commonly called a heart attack) occurs when the blood supply to part of the heart is blocked, causing certain heart cells to die. This is most often attributed to blockage (occlusion) of a coronary artery following the rupture of a vulnerable atherosclerotic plaque (an unstable accumulation of lipids (such as cholesterol) and white blood cells (especially macrophages) in the artery wall). The resulting ischemia (restricted blood supply) and lack of oxygen, if left untreated long enough, can lead to myocardial damage and / or necrosis (infarction).

[0028] Peripheral vascular disease (PVD), also known as peripheral arterial disease (PAD) or peripheral arterial occlusive disease (PAOD), includes all diseases caused by occlusion of the large arteries in the arms and legs. PVD can be attributed to atherosclerosis, inflammatory processes leading to stenosis, embolism, or thrombosis, which results in acute or chronic ischemia (lack of blood supply), usually in the legs.

[0029] It is contemplated within the scope of the present invention that the embodiments of the present invention may be combined, such that any combination of features described herein is also included within the scope of the present invention. In particular, it is contemplated within the scope of the present invention that any therapeutic effect of the bacteria may be simultaneously embodied.

[0030] Preferably, the functional bacterial agent or drug is used for at least one of the following purposes: Prevent or treat diabetes caused by obesity; prevent or treat type II diabetes; reduce the body weight of mammals; reduce the liver weight of mammals; reduce the adipose tissue weight of mammals; reduce fasting blood glucose in mammals; improve impaired oral glucose tolerance in mammals; improve abnormal fasting insulin content in mammals; reduce the area under the insulin tolerance curve; reduce the HOMA-IR index in mammals; improve the level of at least one of the following indicators in the blood of mammals: total cholesterol, triglycerides, high-density lipoprotein-cholesterol, low-density lipoprotein-cholesterol, free fatty acids; improve the level of at least one of the following indicators in the liver of mammals: total cholesterol, triglycerides, high-density lipoprotein-cholesterol, low-density lipoprotein-cholesterol, free fatty acids; increase the content of glucagon-like peptide-1.

[0031] Preferably, the functional bacterial agent or medicine further comprises a pharmaceutically acceptable excipient.

[0032] There are many ways to classify excipients in preparations, which can be classified according to source, function and use, route of administration, etc. According to the source, they can be divided into natural products, semi-synthetic products and fully synthetic products. According to the function and use of excipients in preparations, there are 65 types of classifications, namely pH adjusters, chelating agents, inclusion agents, coating agents, protective agents, moisturizers, disintegrants, surfactants, virus inactivators, supplements, precipitants, film-forming materials, flavoring agents, freeze-drying excipients, carbon dioxide adsorbents, foaming agents, fragrances, preservatives, excipients, desiccant, curing agents, buffers, sustained-release materials, adhesives, flavoring agents, antioxidants, antioxidant enhancers, anti-adhesive agents, air replacement agents , condensing agent, ointment base material, gel material, polishing agent, propellant, solvent, softener, emulsifier, ointment base, soft capsule material, lubricant, wetting agent, penetration enhancer, osmotic pressure regulator, suppository base, sweetener, filler, pill core, stabilizer, adsorbent, absorbent, diluent, defoaming agent, flocculant, ethanol modifier, hard paste base, ink, thickener, solubilizer, plasticizer, adhesive, Chinese medicine preparation auxiliary materials, filter aid, solubilizer, suspending agent, colorant.

[0033] The pharmaceutically acceptable auxiliary materials include at least one of adjuvants, stabilizers or protective agents, antibacterial agents, excipients, solubilizers, flavoring agents, diluents, and buffers.

[0034] Adjuvant: a substance mixed with one or more components that is combined with a vaccine antigen to enhance [such as strengthen, accelerate, prolong and / or possibly direct] its specific immune response and the clinical effect of the vaccine. Stabilizer or protective agent: a substance used to stabilize or protect the active ingredients of biological products to prevent them from degradation or loss of activity. Antibacterial agent: a substance used to inhibit the growth of microorganisms and prevent microbial contamination. Excipient: a substance used to shape the drug and act as a scaffold in freeze-dried products. Co-solvent: a substance used to increase the solubility of the drug. Flavoring agent: a substance used to improve the taste of oral drugs. Diluent, buffer: a solvent used to dissolve, dilute the product, and adjust the pH of the product, such as water for injection, sodium chloride injection, phosphate buffered saline (PBS), etc.

[0035] Exemplary excipients include, but are not limited to, butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (monohydrogen), calcium stearate, cross-linked carboxymethylcellulose, cross-linked polyvinyl pyrrolidone, citric acid, cross-linked povidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.

[0036] The drug can be prepared in the form of an injection preparation or an oral preparation. The injection preparation includes liquid injection, injection powder, and injection tablet according to the physical state; and includes intradermal injection, subcutaneous injection, intramuscular injection, intravenous injection, and spinal cavity injection according to the injection part; preferably, the solvent of the injection preparation includes water for injection or physiological saline.

[0037] Formulations for oral use include tablets containing the active ingredient mixed with non-toxic pharmaceutically acceptable excipients. These excipients can be, for example, inert diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starch including potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate or sodium phosphate); granulating agents and disintegrants (e.g., cellulose derivatives including microcrystalline cellulose, starch including potato starch, cross-linked carboxymethyl cellulose sodium, alginates or alginic acid); binders (e.g., sucrose, glucose, sorbitol, gum arabic, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethyl cellulose, methylcellulose, hydroxypropyl methylcellulose, ethylcellulose, polyvinyl pyrrolidone or polyethylene glycol); and lubricants, glidants and anti-adherents (e.g., magnesium stearate, zinc stearate, stearic acid, silicon dioxide, hydrogenated vegetable oil or talc). Preparations for oral use may also be in the form of chewable tablets, or in the form of hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin), or in the form of soft gelatin capsules in which the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin or olive oil). Powders, granules and pills can be prepared using the ingredients mentioned above under tablets or capsules in a conventional manner using, for example, a mixer, fluidized bed equipment or spray drying equipment.

[0038] Other pharmaceutically acceptable excipients for oral formulations include, but are not limited to, colorants, flavoring agents, plasticizers, humectants, and buffers. Formulations for oral use may also be in the form of chewable tablets, or in the form of hard gelatin capsules, wherein the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, or kaolin), or in the form of soft gelatin capsules, wherein the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin, or olive oil). Powders, granules, and pills may be prepared in a conventional manner using, for example, a mixer, fluidized bed apparatus, or spray drying apparatus using the ingredients mentioned above under tablets or capsules.

[0039] In some embodiments, administration comprises administering an agent described herein intramuscularly, intravenously (e.g., in the form of a sterile solution and in a solvent system suitable for intravenous use), intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, transperitoneally, subcutaneously, subconjunctivally, intracapsularly, transmucosally, intrapericardially, intraumbilically, intraocularly, orally (e.g., as a tablet, capsule, caplet, caplet-shaped tablet, or syrup), topically (e.g., in the form of a cream, gel, lotion, or ointment), topically, by inhalation, by injection, or by infusion (e.g., continuous infusion in the form of a cream or lipid composition, local perfusion, catheterization, lavage directly bathing target cells).

[0040] Preferably, the functional bacterial agent or drug also includes other Enterococcus canintestini Drugs that act synergistically can be prepared as compound preparations, or multiple single drugs can be used in combination.

[0041] Preferably, the microbial strain has a 16s rRNA sequence that is at least 95%, 96%, 97%, 98%, 98.65%, 99%, 99.5%, 99.79%, 99.9% or 100% identical to SEQ ID NO:1.

[0042] Preferably, the microbial strain is LMG 13590 (or the same strain in other depository institutions: CCUG 37857T or CCM 7285 or CCUG 51312 or DSM 21207 or JCM 19616) or a progeny strain or a subclone strain or a culture supernatant thereof; Or deposited under the accession number CCTCC NO: M 20231465 Enterococcus canintestini ibiome010 strain or its progeny strain or subclone strain or its culture supernatant, the Enterococcus canintestiniThe ibiome010 strain is deposited in the China Type Culture Collection, located at China Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit date is August 14, 2023.

[0043] The present invention also protects the deposited product with the deposit number CCTCC NO: M 20231465 Enterococcus canintestini ibiome010 strain or its progeny strain or subclone strain or its culture supernatant.

[0044] Preferably, the strain is capable of activating GPR120 and / or MC4R.

[0045] The present invention also protects a medicine, comprising the above-mentioned strain (or its culture supernatant) and pharmaceutically acceptable excipients, wherein the excipients include at least one of an adjuvant, a stabilizer or a protective agent, an antibacterial agent, an excipient, a solubilizing agent, a flavoring agent, a diluent, and a buffer.

[0046] The present invention also protects a pharmaceutical composition comprising the above-mentioned strain (or its culture supernatant) and a combined drug, wherein the combined drug is other Enterococcus canintestini Drugs that work synergistically.

[0047] Preferably, the combination drug is an active ingredient of other glucose-lowering and lipid-lowering drugs, such as a GLP-1 receptor agonist or a GLP-1 mimetic, a GIP receptor agonist, a dipeptidyl peptidase-4 inhibitor, metformin, etc., specifically selected from exenatide, liraglutide, semaglutide, oral formulations of semaglutide, benaglutide, lixisenatide and exenatide weekly preparations, etc.

[0048] The above-mentioned pharmaceutical composition includes both preparing the strain and other drugs into a compound preparation and directly using the strain and other drugs in combination.

[0049] The dosage form of the composition of the present invention is granules, capsules, tablets, powders, oral liquids, suspensions, or emulsions.

[0050] The effective dose of the present invention is, Enterococcus canintestini The total number of live bacteria in the live bacterial preparation made as the main active ingredient of the drug is 10 6 -10 14 CFU.

[0051] The medication cycle is based on the ability to achieve the desired effect, including but not limited to 1-3 times a day, 3-7 days a week, etc., and is also related to the effective concentration of the specific preparation.

[0052] The present invention also protects the above Enterococcus canintestini ibiome010 fermentation agent, functional bacterial agent or nutrient composition.

[0053] Fermentation agents or functional bacterial agents, including the aforementioned Enterococcus canintestini The bacterial liquid prepared by ibiome010, or the powder or granule obtained by further treatment; the fermentation agent may further contain one or more non-antagonistic microbial agents, selected from one or more of Christensen bacteria, Parabacteroides, Akkermansia muciniphila, and Bacteroides thetaiotaomicron to prepare a composite bacterial agent.

[0054] Effective bacterial concentration, viable bacteria count is 10 6 -10 14 CFU.

[0055] Fermentation agents or functional bacterial agents can also be used as functional foods and nutritional products.

[0056] Nutritional composition comprising the above Enterococcus canintestini ibiome010 and food, nutritional products, supplements, probiotics or commensal bacteria.

[0057] The food, including the above Enterococcus canintestini ibiome010 and auxiliary substances that realize food functions may be presented in forms including but not limited to "dietary supplements" and "fermented foods".

[0058] The dietary supplement comprises the aforementioned Enterococcus canintestini The bacterial liquid prepared by ibiome010 or the powder obtained by further treatment is further processed by adding cellulose, vitamins, minerals and other nutrients.

[0059] The fermented food includes dairy products, bean products or fruit and vegetable products, etc. The dairy products are milk, sour cream or cheese, etc. The bean products are soy milk, fermented black beans or bean paste, etc. The fruit and vegetable products are cucumber, carrot, beet, celery or cabbage products, etc.

[0060] The probiotics are live microorganisms which, when provided in adequate amounts, confer a beneficial effect on the health of the host organism.

[0061] Symbiotics are foods that contain a mixture of prebiotics and probiotics. They typically contain prebiotic components that promote growth and / or metabolic activity, and generally have similar effects on, for example, but not limited to, Enterococcus canintestini Probiotic effect of ibiome010 in combination with fructo-oligosaccharides or galacto-oligosaccharides. Beneficial Effects of the Invention

[0062] Compared with the prior art, the present invention has the following technical effects.

[0063] The present invention Enterococcus canintestiniIt can significantly activate GPR120 and MC4R, the targets for treating obesity and diabetes, reduce the body weight, fasting blood sugar, area under the glucose tolerance curve, and area under the insulin tolerance curve of obese mice, reduce plasma free fatty acids, liver total cholesterol, and liver low-density lipoprotein-cholesterol levels, and increase plasma glucagon-like peptide-1 and liver high-density lipoprotein-cholesterol levels. It has broad application prospects in the development of drugs for metabolic diseases. Biological Deposit

[0064] Enterococcus canintestini ibiome010, deposited in China Type Culture Collection, the deposit address is: China Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province; the deposit date is: August 14, 2023; the deposit number is: CCTCC NO: M 20231465. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 The isolated samples obtained in Example 2 are shown. E. canintestini Microscopic morphology of .

[0066] Figure 2 The isolated samples obtained in Example 2 are shown. E. canintestini Macroscopic morphology diagram.

[0067] Figures 3 - 4 The separated E. canintestini The results of the strain activating GPR120 and MC4R in the cell level experiment of Example 3.

[0068] Figures 5 - 13 The DIO mouse treatment experiment in Example 4 is shown respectively. E. canintestini Effects on body weight, fasting blood glucose, glucose tolerance (OGTT), insulin tolerance (ITT), free fatty acids, liver low-density lipoprotein-cholesterol, liver high-density lipoprotein-cholesterol, liver triglycerides, and plasma GLP-1 in DIO mice.

[0069] Figures 14 - 21 The DIO mouse prevention experiment in Example 5 is shown respectively. E. canintestini Effects on body weight, fasting blood glucose, glucose tolerance (OGTT), insulin tolerance (ITT), insulin, mesenteric fat weight, liver weight, and alanine aminotransferase of mice.

[0070] Figures 22 - 25 The DIO mouse prevention experiment in Example 6 is shown respectively. E. canintestini Effects of model strain LMG13590 on body weight, glucose tolerance (OGTT), insulin tolerance (ITT), and high-density lipoprotein-cholesterol in mice. Implementation

[0071] For a better understanding of the present invention, the present invention is further described below in conjunction with the examples and accompanying drawings. The following examples are only intended to illustrate the present invention but are not intended to limit it. In addition, unless otherwise specified, methods without specific conditions or steps are conventional methods, and the reagents and materials used can be obtained from commercial sources. Example 1 Isolation and preliminary identification of strains

[0072] Healthy volunteers who had not used antibiotics within one year were recruited. After signing the informed consent, the volunteers collected 2 to 5 grams of fresh feces and put them into a sample collection tube containing glycerol. After shaking and homogenization, the processed fecal samples were placed in an ice box and sent to the applicant's laboratory for strain isolation within 24 hours.

[0073] ① Pretreatment of fecal samples: Take 1 mL of the mixture from the sample collection tube containing glycerol and feces and add it to 9 mL of 1× sterile PBS solution. Vortex the mixture and then take 100 µL of the mixture and dilute it step by step to 10 -9 , used for flat plate coating.

[0074] ② Take 100 μL of the diluted sample and spread it on GAM medium (Solabo, LA4450). After the surface of the plate is dry, invert it and place it on a microaerobic workbench for culture (temperature: 37°C, O2: 5%, CO2: 5%, mixed gas: 90%). Incubate it for 24 to 36 hours. After a single clone colony grows, streak it multiple times to purify it. Perform 16s rRNA sequencing on the purified strain to determine the taxonomic status of the strain.

[0075] ③16s rRNA sequencing: 16s rRNA PCR amplification was performed on the strain to be identified. The amplification system was: 2 Taq MasterMix (Novozyme; P112-01) 12.5 μL, primer 1 (27F: AGAGTTTGATCCTGGCTCAG) 1 μL, primer 2 (1492R: TACGGCTACCTTGTTACGACTT) 1 μL, liquid culture bacterial solution 1 μL, ddH2O 9.5 μL; amplification conditions: 95℃ 3min; 95℃ 15 s, 58℃ 15 s, 72℃ 30 s, 35 cycles; 72℃ 5 min. The amplified product was sent to Qingke Biotechnology Co., Ltd. for sequencing, and the strain 16s rRNA gene sequence returned by sequencing was submitted to NCBI Basic Local Alignment Search Tool for strain 16s rRNA gene analysis. In the comparison results, the species corresponding to the strain with the highest similarity was taken as the species of the corresponding strain.

[0076] Among the isolated strains, the 16s rRNA gene sequence shown in SEQ ID NO.1 was measured, and the comparison results showed that the strain with the highest similarity was Enterococcus canintestini strain LMG 13590, with a similarity of 99.79%. Enterococcus canintestini ibiome010, deposited in China Type Culture Collection, the deposit address is: China Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province; the deposit date is: August 14, 2023; the deposit number is: CCTCC NO: M 20231465.

[0077] Example 2 Enterococcus canintestini Strain characteristics The screened samples from Example 1 E. canintestini Conduct further identification.

[0078] Bacteria characteristics: E. canintestini The morphology of the strain after staining under a 40x optical microscope is as follows Figure 1 As shown, under a microscope, after anaerobically cultured at 37°C in GAM medium for 24 h, Gram staining was positive, and the bacteria were spherical with an average diameter of about 0.7 μm.

[0079] Colony characteristics: E. canintestini The growth status of the strain on the plate is as follows Figure 2 As shown, after anaerobically cultured at 37°C in GAM medium for 24 h, the colonies were round, moist, opaque, light yellow, and had neat edges.

[0080] Growth characteristics: The isolated strain can grow under both aerobic and anaerobic conditions, but grows faster under anaerobic conditions. The optimal growth temperature is 37℃.

[0081] Example 3 Enterococcus canintestini Screening for activation of GPR120 and MC4R at the cellular level in vitro GPR120 is a receptor for long-chain unsaturated fats, which is expressed in multiple tissues of the human body, especially in the adipose tissues of the colon. It can regulate the secretion of gastrointestinal peptide hormones, thereby affecting appetite, regulating the development and differentiation of fat cells and other physiological functions. GPR120 is closely related to metabolic diseases such as obesity, diabetes, insulin resistance and fatty liver.

[0082] MC4R is mainly expressed in hypothalamic neurons and is the terminal gene in the leptin-mediated appetite regulation pathway. α-MSH derived from proopiomelanocortin binds to its receptor MC4R in the hypothalamus, thereby producing a physiological effect of suppressing appetite. MC4R can regulate food intake and energy expenditure by acting on central proopiomelanocortin (POMC) neurons, sympathetic preganglionic neurons, and interacting with corresponding agonists, thereby improving obesity. Recent studies have shown that activating MC4R in L cells in the intestine of peripheral tissues can promote the secretion of GLP-1 and PYY, and can also regulate the body's energy metabolism.

[0083] In summary, GPR120 and MC4R are important targets for the treatment of metabolic diseases such as obesity and diabetes, and can be used to screen strains that can treat metabolic diseases.

[0084] (1) Experimental materials: E. canintestini Preparation of bacterial culture supernatant: Take 100 μL of glycerol culture medium (stored in glycerol) E. canintestini Bacteria) were added to 2 mL of GAM medium (prepared as in Example 1), cultured in a 37°C incubator for 48 h, the culture was centrifuged at 12000 rpm, 4°C for 10 min, and the supernatant was used for cell screening.

[0085] Positive drug: GPR120 positive drug: GSK-137647A (manufacturer: Selleck); MC4R positive drug: Setmelanotide (manufacturer: Selleck, product number: RM-493).

[0086] GAM medium control: GAM medium without cultured bacteria Blank control: HTLA cells transfected with GPCR-tango plasmid were not treated with any treatment.

[0087] (2) Experimental methods: A. HEK293 cell lines stably expressing β-arrestintev and tTA-luciferase (manufacturer: HTLA; gift from Institute of Immunology, University of Science and Technology of China) were cultured in DMEM medium (manufacturer: Gibco; catalog number: C11995500BT) containing 10% fetal bovine serum (manufacturer: Viva cell; catalog number: C04001-500) and 1% penicillin / streptomycin (manufacturer: Viva cell; catalog number: C3420-0100); B. Preparation of transfection mixture: 200 ng / well GPCR-tango plasmid (gift from Institute of Immunology, University of Science and Technology of China) was mixed with 400 ng polyethylenimine (manufacturer: Yisheng Biotechnology; catalog number: 40816ES03) (dissolved in 20 μL of opti-MEM) in 20 μL of opti-MEM (manufacturer: Gibco; catalog number: 31985070) and incubated at room temperature for 20 minutes; C. After the cells in step A have reached approximately 90% confluence, add the transfection mixture in step B to the cells; D. After 16-24 hours of transfection, collect the cells by centrifugation, discard the supernatant, resuspend them in 180 μL of DMEM medium (manufacturer: Gibco; catalog number: C11995500BT) containing 1% penicillin / streptomycin and 10 mM HEPES (manufacturer: Pronocell; catalog number: PB180325), and then add 20 μL of i) E. canintestini bacterial culture supernatant, or ii) positive drug, or iii) DMEM medium blank control; E. Step D E. canintestini After stimulating with bacterial culture supernatant (or positive drug or blank control) for 16-24 hours, centrifuge at 1500 g for 6 min, discard the supernatant, and add 50 μL of Bright-Glo solution (manufacturer: Promega; catalog number: E2610) diluted 20 times with PBS containing 20 mM HEPES to each well; F. After incubation at room temperature for 20 minutes, fluorescence quantification was performed.

[0088] (3) Experimental results: The strain activation rate was calculated as the ratio of the fluorescence quantitative value of the strain to the fluorescence quantitative value of the culture medium. Figure 3 and Figure 4 As shown, E. canintestini It has strong activation ability on both GPR120 and MC4R, and E. canintestini The activation rate is higher than that of positive drugs.

[0089] Example 4 Enterococcus canintestini Improve obesity and related symptoms induced by high-fat diet (1) Experimental methods C57BL / 6J mice (purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were fed a high-fat diet for 20 weeks and screened according to body weight. The average weight of the selected mice was 45 g. The selected mice were randomly divided into a control group and an experimental group, with 10 mice in each group. The mice in each group continued to be fed a high-fat diet while being administered until the end of the experiment.

[0090] The control group was gavaged with 0.4 mL 0.9% saline / animal / day; Experimental group intragastrically E. canintestini ibiome010, according to the number of live bacteria in each batch of freeze-dried bacterial powder, calculate the number of live bacteria per gavage. 9 The number of grams of bacterial powder required for CFU / mouse was resuspended in 0.4 mL of 0.9% saline and administered once a day.

[0091] The following experiments were conducted respectively: a. Monitor body weight weekly; b. Fasting blood glucose was tested in the 4th week of administration (fasting for 6 hours); c. Oral glucose tolerance (OGTT) test at the 13th week of administration: mice were fasted for 6 hours and blood was collected from the tail tip (0 h) to measure blood glucose, and 2 g / kg glucose solution was gavaged intragastrically. Then, blood was collected from the tail tip at 30 min, 60 min, and 120 min to measure blood glucose. The blood glucose change curve over time was plotted, and the area under the curve was calculated. d. Insulin tolerance test (ITT) at the 14th week of administration: mice were fasted for 4 hours, blood was collected from the tail tip (0 h) to measure blood glucose, and 0.75 IU / kg insulin solution was injected subcutaneously. Then, blood was collected from the tail tip at 30 min, 60 min, and 120 min to measure blood glucose. The blood glucose change curve over time was plotted, and the area under the curve was calculated; e. After 15 weeks of administration, the mice were fasted for 12 h, their eyeballs were removed and blood was collected into heparin tubes, centrifuged at 4000 rpm at room temperature for 10 min, and the supernatant plasma was transferred to a new centrifuge tube and stored at -80°C for later use. Glucagon-like peptide-1 (Huamei Biotechnology; CSB-E08118m) and free fatty acids (Nanjing Jiancheng; A042-2-1) in the blood were detected using a kit. f. After 15 weeks of administration, 100 mg of liver was collected and added to 900 μL PBS, homogenized, and centrifuged at 4000 rpm at room temperature for 10 min. The supernatant was transferred to a new centrifuge tube and stored at -80°C for later use. The low-density lipoprotein cholesterol (Nanjing Jiancheng; A111-1-1), high-density lipoprotein cholesterol (Nanjing Jiancheng; A111-1-1), and triglycerides (Nanjing Jiancheng; A111-1-1) in the liver were detected using a kit.

[0092] (2) Experimental results: ① Body weight changes during medication like Figure 5 Compared with the control group, the E. canintestini The body weight decreased significantly from the second week, and the weight gain of mice could be significantly inhibited.

[0093] ② Effects of drug administration on blood glucose in mice like Figures 6 - 8 As shown, oral gavage E. canintestiniIt can significantly reduce the fasting blood sugar, the area under the glucose tolerance curve, and the area under the insulin tolerance curve of mice, indicating that E. canintestini Can improve glucose tolerance and insulin resistance.

[0094] ③ Effects of drug administration on lipid metabolism in mice like Figure 9 Compared with the control group, the E. canintestini It can significantly reduce the free fatty acid level in mice, indicating E. canintestini Can improve lipid metabolism levels.

[0095] ④ Effects of drug administration on non-alcoholic fatty liver disease in mice like Figures 10 - 12 Compared with the control group, the E. canintestini It can significantly reduce the level of low-density lipoprotein-cholesterol in the liver of mice, significantly increase the level of high-density lipoprotein-cholesterol in the liver of mice, and significantly reduce the level of triglycerides in the liver of mice, indicating that E. canintestini It can improve the symptoms of non-alcoholic fatty liver disease in mice.

[0096] ⑤Effects of drug administration on gastrointestinal hormone levels in mouse plasma like Figure 13 Compared with the control group, the E. canintestini It can significantly increase the content of GLP-1 in mice, indicating E. canintestini It can improve the secretion of gastrointestinal hormones in mice.

[0097] Example 5 Enterococcus canintestini Preventing obesity and related symptoms in mice (1) Experimental methods: 30 C57BL / 6J mice (purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were screened according to their weight. The average weight of the selected mice was 26g. The selected mice were randomly divided into a control group, an experimental group, and a positive drug group. Each group of mice was fed a high-fat diet at the same time as the drug administration until the end of the experiment.

[0098] The control group was gavaged with 0.2 mL 0.9% saline / animal / day; Experimental group intragastrically E. canintestini ibiome010, according to the number of live bacteria in each batch of freeze-dried bacterial powder, calculate the number of live bacteria per gavage. 8 The number of grams of bacterial powder required for CFU / each was resuspended in 0.2 mL of 0.9% saline once a day; The positive drug group was subcutaneously injected with semaglutide (Novo Nordisk). Each mouse was given 12.8 μg / kg of semaglutide according to body weight, diluted with normal saline, and each mouse was subcutaneously injected with 0.1 mL once a week.

[0099] The following experiments were conducted respectively: a. Monitor body weight weekly; b. Fasting blood glucose was tested in the 4th week of administration (fasting for 6 hours); c. Oral glucose tolerance (OGTT) test at the 13th week of administration: mice were fasted for 6 hours and blood was collected from the tail tip (0 h) to measure blood glucose, and 2 g / kg glucose solution was gavaged intragastrically. Then, blood was collected from the tail tip at 30 min, 60 min, and 120 min to measure blood glucose. The blood glucose change curve over time was plotted, and the area under the curve was calculated. d. Insulin tolerance test (ITT) at the 14th week of administration: mice were fasted for 4 hours, blood was collected from the tail tip (0 h) to measure blood glucose, and 0.75 IU / kg insulin solution was injected subcutaneously. Then, blood was collected from the tail tip at 30 min, 60 min, and 120 min to measure blood glucose. The blood glucose change curve over time was plotted, and the area under the curve was calculated; e. After 15 weeks of administration, the mice were fasted for 12 h, their eyeballs were removed and blood was collected into heparin tubes, centrifuged at 4000 rpm at room temperature for 10 min, and the supernatant plasma was transferred to a new centrifuge tube and stored at -80°C for later use. The blood insulin (Huamei Bio; CSB-E05071m) and alanine aminotransferase (Solabo; BC1555) were detected using a kit. f. After 15 weeks of administration, the mice were fasted for 12 h, and the adipose tissue (mesenteric fat) and liver of the mice were obtained and weighed respectively.

[0100] (2) Experimental results: ① Body weight changes during medication like Figure 14 Compared with the control group, the E. canintestini From the 6th week onwards, the relative body weight percentage decreased significantly, and the weight gain of mice was significantly inhibited.

[0101] ② Effects of drug administration on blood glucose in mice like Figures 15 - 18 As shown, oral gavage E. canintestini It can significantly reduce the fasting blood sugar of mice (and the effect is equivalent to that of positive drugs), significantly reduce the area under the glucose tolerance curve, significantly reduce the area under the insulin tolerance curve, and significantly reduce the plasma insulin content (and the effect is equivalent to that of positive drugs), indicating that E. canintestini Can improve glucose tolerance and insulin resistance.

[0102] ③ Effects of drug administration on lipid metabolism in mice like Figure 19 Compared with the control group, the E. canintestini It can significantly reduce the weight of mesenteric fat in mice, indicating E. canintestini Can improve lipid metabolism levels.

[0103] ④ Effects of drug administration on non-alcoholic fatty liver disease in mice like Figures 20 - 21 Compared with the control group, the E. canintestini It can significantly reduce the liver weight of mice and the plasma alanine aminotransferase content of mice, indicating that E. canintestini It can improve the symptoms of non-alcoholic fatty liver disease in mice.

[0104] Example 6 Enterococcus canintestini Both strains can prevent obesity and related symptoms in mice To explore Enterococcus canintestini Can all strains improve obesity / diabetes-related symptoms? The inventor purchased Enterococcus canintestin The experiments were carried out using model strains.

[0105] (1) Experimental methods: 30 C57BL / 6J mice (purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.) were screened according to their weight. The average weight of the selected mice was 26g. The selected mice were randomly divided into a control group, an experimental group, and a positive drug group. Each group of mice was fed a high-fat diet at the same time as the drug administration until the end of the experiment.

[0106] The control group was gavaged with 0.2 mL 0.9% saline / animal / day; The experimental group was gavaged with LMG 13590 (purchased from BCCM / LMG, Ghent University, Laboratory for Microbiology, KL Ledeganckstraat 35, B-9000 Gent), 10 8 CFU / each, once a day; The positive drug group was subcutaneously injected with semaglutide (Novo Nordisk). Each mouse was given 12.8 μg / kg of semaglutide according to body weight, diluted with normal saline, and each mouse was subcutaneously injected with 0.1 mL once a week.

[0107] The following experiments were conducted respectively: a. Monitor body weight weekly; b. Oral glucose tolerance (OGTT) test at the 13th week of administration: mice were fasted for 6 hours and blood was collected from the tail tip (0 h) to measure blood glucose, and 2 g / kg glucose solution was gavaged intragastrically. Then, blood was collected from the tail tip at 30 min, 60 min, and 120 min to measure blood glucose. The blood glucose change curve over time was plotted, and the area under the curve was calculated. c. Insulin tolerance test (ITT) at the 14th week of administration: mice were fasted for 4 hours and blood was collected from the tail tip (0 h) to measure blood glucose and injected subcutaneously with 0.75 IU / kg insulin solution. Blood glucose was then collected from the tail tip at 30 min, 60 min, and 120 min to measure blood glucose. The blood glucose change curve over time was plotted and the area under the curve was calculated. d. After 15 weeks of administration, the mice were fasted for 12 h, their eyeballs were removed and blood was collected into heparin tubes, which were centrifuged at 4000 rpm at room temperature for 10 min. The supernatant plasma was transferred to a new centrifuge tube and stored at -80°C for later use. High-density lipoprotein cholesterol in the blood was detected using a kit (Nanjing Jiancheng; A111-1-1).

[0108] (2) Experimental results: ① Body weight changes during medication like Figure 22 As shown, compared with the control group, the body weight of mice gavaged with LMG 13590 at 13 weeks decreased significantly, indicating that LMG 13590 can significantly inhibit the increase in mouse body weight.

[0109] ② Effects of drug administration on blood glucose in mice like Figures 23 - 24 As shown, intragastric administration of LMG 13590 can significantly reduce the area under the glucose tolerance curve and the area under the insulin tolerance curve, indicating that LMG 13590 can improve glucose tolerance and insulin resistance.

[0110] ③ Effects of drug administration on lipid metabolism in mice like Figure 25 As shown, compared with the control group, oral administration of LMG 13590 could significantly increase the high-density lipoprotein cholesterol in mice, indicating that LMG 13590 can improve lipid metabolism levels.

[0111] In summary, the improvement effect on metabolic diseases is Enterococcus canintestini Common properties of bacterial strains.

[0112] The above-described embodiments are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of a microbial strain in the preparation of a medicament for preventing or treating a metabolic disease, characterized in that: The microbial strain belongs to Enterococcus canintestini The metabolic diseases are diabetes, obesity and obesity-related diseases, and metabolic syndrome; the obesity-related diseases include at least one of the following diseases: cardiovascular disease, hyperlipidemia, insulin resistance syndrome, and fatty liver disease.

2. The use according to claim 1, characterized in that The drug is used for at least one of the following purposes: Prevent or treat obesity-induced diabetes; Prevent or treat type 2 diabetes; Reducing the weight of mammals; Reducing liver weight in mammals; Reducing adipose tissue weight in mammals; Lowering fasting blood sugar in mammals; Improve impaired oral glucose tolerance in mammals; Improve abnormal fasting insulin levels in mammals; Reduced area under the insulin tolerance curve; Reduce mammalian HOMA-IR index; Improving the level of at least one of the following indicators in the blood of a mammal: total cholesterol, triglycerides, high-density lipoprotein-cholesterol, low-density lipoprotein-cholesterol, and free fatty acids; Improving the level of at least one of the following indicators in the liver of a mammal: total cholesterol, triglycerides, high-density lipoprotein-cholesterol, low-density lipoprotein-cholesterol, free fatty acids; Increased glucagon-like peptide-1 levels.

3. The use according to claim 1 or 2, characterized in that: The medicine also includes other Enterococcus canintestini Drugs that work synergistically.

4. The use according to claim 1, characterized in that: The microbial strain has a 16s rRNA sequence that is at least 95%, 96%, 97%, 98%, 98.65%, 99%, 99.5%, 99.79%, 99.9% or 100% identical to SEQ ID NO:

1.

5. The use according to claim 1, characterized in that: The microbial strain is LMG 13590 or its progeny strain or subclone strain or its culture supernatant; Or deposited under the accession number CCTCC NO: M 20231465 Enterococcus canintestini ibiome010 strain or its progeny strain or subclone strain or its culture supernatant, the Enterococcus canintestini The ibiome010 strain is deposited in the China Type Culture Collection, located at China Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit date is August 14, 2023.

6. Deposited with CCTCC NO: M 20231465 Enterococcus canintestini ibiome010 strain or its progeny strain or subclone strain or its culture supernatant, the Enterococcus canintestini The ibiome010 strain is deposited in the China Type Culture Collection, located at China Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit date is August 14, 2023.

7. The strain or the culture supernatant thereof according to claim 6, characterized in that: The strain is capable of activating GPR120 and / or MC4R.

8. A medicine, characterized in that: The invention comprises the strain according to claim 6 or 7 or the culture supernatant thereof, and pharmaceutically acceptable excipients, wherein the excipients include at least one of an adjuvant, a stabilizer or a protective agent, an antibacterial agent, an excipient, a solubilizing agent, a flavoring agent, a diluent, and a buffer.

9. A pharmaceutical composition, characterized in that: Comprising the strain according to claim 6 or 7 or its culture supernatant, and a combined drug, wherein the combined drug is other Enterococcus canintestini Drugs that work synergistically; Preferably, the combined drug is an active ingredient of other glucose-lowering and lipid-lowering drugs, such as GLP-1 receptor agonists, GLP-1 analog drugs, biguanide drugs, etc.

10. A starter, functional bacterial agent or nutritional composition comprising the strain according to claim 6 or 7 or its culture supernatant; preferably, the nutritional composition is a food, a nutrient, a supplement, a probiotic or a symbiotic bacteria.

Images