Preparation method and application of an amide - type plasmalogen compound

Abstract

The present invention relates to the technical field of plasmalogens, and discloses a preparation method and application of an amide plasmalogen compound, which comprises the following steps: (1) reacting compound 1 and compound 2 in HEPES buffer to obtain compound 3; (2) reacting compound 3 with phospholipase D in an ethyl acetate phase and an aqueous phase with the assistance of Ca<supgt;2+< / supgt; ions to obtain compound 4; (3) expressing and purifying the CarF protein derived from myxobacteria; (4) reacting compound 4 and the CarF protein in Tris-HCl buffer with the assistance of NADH and catalase to obtain compound 5. By using the purified recombinant myxobacterial CarF protein and the substrate for the reaction of chemically synthesized CarF protein, the present invention finally synthesizes an amide plasmalogen, which can show an effect similar to that of natural plasmalogens.

Description

Technical Field

[0001] The present invention relates to the technical field of plasmalogens, and particularly to a preparation method and application of an amide plasmalogen compound. Background Art

[0002] Plasmalogens are a special class of phospholipid representatives, accounting for about 10% of the total cellular phospholipids. They are glycerophospholipids containing vinyl ether bonds, such as plasmenylethanolamine, plasmenylcholine, plasmenylserine, etc. The main characteristics are that they contain a vinyl ether bond at the sn-1 position, and in mammals, they are usually linked to fatty alcohols of c16:0; 18:0 or 18:1, and mostly n-3 and n-6 polyunsaturated fatty acids at sn-2. Most plasmalogens are concentrated in the "lipid raft" structure of biological membranes, participating in cell fusion, ion transport, and cholesterol transport, being rich in organs such as the brain and heart, and at the same time, they can also act as important antioxidants on the plasma membrane to avoid damage to nerve cells.

[0003] Currently, the results of many studies have shown that the decrease in plasmalogen content is related to many diseases, such as Alzheimer's disease, Parkinson's disease, Zellweger syndrome, etc. Among them, Alzheimer's disease (AD) is a progressive neurodegenerative disease and the most common dementia. There is a positive correlation between the severity of Alzheimer's disease and the reduction of plasmalogens. Many animal experiments and clinical trials have also confirmed that plasmalogens can improve the learning ability and memory of patients with mild cognitive impairment, mild Alzheimer's disease, and mouse models.

[0004] Plasmalogens are obtained by chemical synthesis or extraction from animal tissues. For example, the invention patent with the publication number CN110621683B discloses cyclic plasmenylethanolamine and its chemical synthesis method. However, due to the need for a large amount of chemical substances and the generation of potential hazardous waste during the chemical synthesis process, the application of the chemical synthesis method is limited. Plasmalogens can also be prepared from marine animals or animal tissues, and so far, most still rely on extracting lipids from organisms rich in plasma hormones, but the plasmalogen content in these natural materials is very low, only accounting for less than 10% of the phospholipids in the cell membranes of the tissues used, thereby limiting their wide application. Summary of the Invention

[0005] In order to solve the above technical problems, the present invention provides a preparation method and application of an amide plasmalogen compound. By using purified recombinant myxobacterial CarF protein and chemically synthesizing the substrate (compound 4) for the CarF protein reaction, alkylphosphatidylethanolamine with a fatty acid chain is used to generate the corresponding plasmenylethanolamine, and finally an amide plasmalogen is synthesized, which can show an effect similar to that of natural plasmalogens.

[0006] The object of the present invention is achieved by the following technical solutions:

[0007] In a first aspect, the present invention provides a method for preparing an amide-containing plasmalogen compound, comprising the following steps:

[0008] (1) Reacting compound 1 and compound 2 in HEPES buffer to obtain compound 3;

[0009] (2) Reacting compound 3 with phospholipase D in an ethyl acetate phase and an aqueous phase with the assistance of Ca 2+ ions to obtain compound 4;

[0010] (3) Expression and purification of the CarF protein derived from myxobacteria;

[0011] (4) Reacting compound 4 and the CarF protein in Tris-HCl buffer with the assistance of NADH and catalase to obtain compound 5;

[0012] The structural formulas of compounds 1-5 are as follows:

[0013] .

[0014] Among them, compound 1 is Dodecanoyl-AMP;

[0015] Compound 2 is 1-O-hexadecyl-2-(β-Ala)-sn-glycero-3-phosphocholine, C 27 H 8 N 2 O 7 P,[M+H] + ;

[0016] Compound 3 is 1-O-hexadecyl-2-[β-Ala-(dodecanoyl)]-sn-glycero-3-phosphocholine, C 39 H 79 N 2 O 8 PNa,[M+Na] + ;

[0017] Compound 4 is 1-O-hexadecyl-2-[β-Ala-(dodecanoyl)]-sn-glycero-3-phosphoethanolamine, C 36 H 73 N 2 O 8 PNa,[M+Na] + ;

[0018] Compound 5 is 1-(1-hexadecenyl)-2-[β-Ala-(dodecanoyl)]-sn-glycero-3-phosphoethanolamine, C 36 H 71 N 2 O 8 PNa, [M+Na] + 。

[0019] Preferably, the preparation method of Compound 1 comprises the following steps: dissolving 5'-AMP in a mixed solution of sodium hydroxide, pyridine and water to obtain a 5'-AMP solution; then adding a tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution, stirring and reacting, and performing extraction and post-treatment after the reaction to obtain Compound 1.

[0020] Preferably, the volume ratio of pyridine to water is 1:1; the concentration of sodium hydroxide in the mixed solution is 0.4 - 0.6 mM; the concentration of 5'-AMP in the 5'-AMP solution is 17 - 19 mg / mL; the concentration of dodecanoic anhydride in the tetrahydrofuran solution containing dodecanoic anhydride is 30 - 50 mg / mL; the volume ratio of the tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution is 1:1; the stirring reaction is carried out at room temperature for 20 - 30 min.

[0021] Preferably, the preparation method of Compound 2 comprises the following steps: adding 1-O-hexadecyl-sn-glycero-3-choline phosphate, Bco-β-alanine, 4-dimethylaminopyridine and triethylamine into chloroform, then adding 2,4,6-trichlorobenzoyl chloride and stirring for reaction, adding water to remove the solvent to obtain a solid; stirring and reacting the solid and trifluoroacetic acid in dichloromethane again, and removing the solvent to obtain Compound 2.

[0022] Preferably, the molar ratio of 1-O-hexadecyl-sn-glycero-3-choline phosphate, Bco-β-alanine, 4-dimethylaminopyridine, triethylamine to chloroform is 9 - 11:23 - 26:55 - 65:0.5 - 2:450; the molar ratio of 2,4,6-trichlorobenzoyl chloride to 1-O-hexadecyl-sn-glycero-3-choline phosphate is 1:1; the stirring reaction time is 12 - 15 h; the addition ratio of the solid to the mixed solution is 150 - 200 mg:5 mL; the re-stirring reaction time is 20 - 30 min.

[0023] Preferably, in step (1), the molar ratio of Compound 1 to Compound 2 is 1:0.8 - 1.3; the reaction conditions are pH 7 - 8, 37 °C, stirring for reaction for 3 - 5 h.

[0024] Preferably, step (2) specifically includes the following steps: Dissolve compound 3 in ethyl acetate to obtain an ethyl acetate phase; Add phospholipase D and ethanolamine to water to obtain an aqueous phase; Mix the ethyl acetate phase and the aqueous phase, and add CaCl 2 React, and after the reaction is completed, take the ethyl acetate phase for drying to obtain compound 4.

[0025] Preferably, the concentration of compound 3 in the ethyl acetate phase is 2-4 mg / mL; the concentration of phospholipase D in the aqueous phase is 3-10 mg / mL; the mass ratio of phospholipase D to ethanolamine is 1:5-10; the volume ratio of the ethyl acetate phase to the aqueous phase is 1.5-3:1; the addition amount of CaCl 2 is such that the concentration of CaCl in the solution after addition is 2 3-10 mM; the reaction is a stirring reaction at 30-40 °C for 7-8 h.

[0026] Preferably, in step (3), the expression of CarF protein includes the following steps: Culture myxobacteria and Bacillus subtilis, extract the genome, and amplify the target genes of CarF and Mistic. Under the action of a recombinase, plasmid pet28a, CarF, and Mistic are used to obtain a pet28a-Mistic-CarF recombinant plasmid. The pet28a-Mistic-CarF recombinant plasmid is used for co-expression of Mistic-CarF in Escherichia coli OverExpreessC43(DE3) cells.

[0027] Preferably, in step (3), the purification of CarF protein includes the following steps: Cut and purify the Mistic molecular chaperone and CarF protein through Ni 2+ to obtain CarF protein.

[0028] Preferably, in step (4), the mass ratio of the addition of compound 4 to CarF protein is 1:100-1000; the molar ratio of compound 4 to NADH is 1:1-5; the mass ratio of the addition of compound 4 to catalase is 100:1-10; the pH of the Tris-HCl buffer solution is 7-7.5; the temperature of the reaction is 30-37 °C, and the time is 16-24 h.

[0029] Second, the present invention also provides an application of an amide acetal phospholipid compound in the manufacture of a drug for enhancing the level of acetal phospholipids.

[0030] Compared with the prior art, the present invention has the following beneficial effects: The recombinant myxobacterial CarF protein expressed by Escherichia coli in the present invention is purified in vitro, derived from myxobacteria (Myxococcus xanthus The CarF membrane protein in ( ) can utilize alkylphosphatidylethanolamine with a fatty acid chain to generate the corresponding plasmalogen phosphatidylethanolamine. Then, compound 5 (amide plasmalogen) was synthesized by using an amine-functionalized compound 4 substrate and purified CarF membrane protein. This method can fill the gap in the chemoenzymatic synthesis of plasmalogens, and has the advantages of simplicity, controllability, high efficiency, energy saving, and environmental friendliness. The synthesized plasmalogens have a super ability to scavenge reactive oxygen species in nerve cells and can be applied to therapeutic drugs for neurological diseases, aiming to prevent or improve various diseases caused by the deficiency of plasmalogens by increasing the reduced plasmalogen level. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is the synthetic route for synthesizing compound 1 in the present invention.

[0032] Figure 2 This is the synthetic route for synthesizing compound 4 in the present invention.

[0033] Figure 3 These are the CarF and Mistic genes used in the present invention.

[0034] Figure 4 These are the LC-MS diagrams of compound 2, compound 3, and compound 4 in the present invention.

[0035] Figure 5 This is for purified CarF protein and Ni 2+ Cleavage result diagram.

[0036] Figure 6 This is the mass spectrometry diagram of compound 5 (amide plasmalogen) in the present invention.

[0037] Figure 7 This is the GC-MS diagram of compound 5 (amide plasmalogen) in the present invention.

[0038] Figure 8 These are the detection diagrams of scavenging ROS in two types of nerve cells in vivo for the amide phospholipids in the present invention (Figure A is PC12 neuron cells, and Figure B is BV2 microglial cells). DETAILED DESCRIPTION OF THE INVENTION

[0039] The following specific examples are used to illustrate the technical solutions of the present invention, but the protection scope of the present invention is not limited thereto.

[0040] The preparation of amide-type plasmalogen compounds includes the following steps:

[0041] (1) Compounds 1 and 2 were added to HEPES buffer (final concentration: 100 mM), and the molar ratio of Compound 1 to Compound 2 was 1:0.8 - 1.3. The reaction was stirred at pH 7 - 8 and 37 °C for 3 - 5 h. The solution was removed to obtain Compound 3.

[0042] (2) Compound 3 was reacted with phospholipase D in the ethyl acetate phase and the aqueous phase with the assistance of Ca 2+ ions. Specifically, Compound 3 was weighed and dissolved in ethyl acetate under stirring to obtain the ethyl acetate phase, and the concentration of Compound 3 in the ethyl acetate phase was 2 - 4 mg / mL; phospholipase D was weighed and added to water, and ethanolamine was added for dissolution. The mass ratio of phospholipase D to ethanolamine was 1:5 - 10 to obtain the aqueous phase, and the concentration of phospholipase D in the aqueous phase was 3 - 10 mg / mL; the ethyl acetate phase and the aqueous phase were mixed at a volume ratio of 1.5 - 3:1, and CaCl 2 solution was added, and the concentration of CaCl 2 in the solution was 3 - 10 mM. Stirring was started at 30 - 40 °C for 7 - 8 h. After the reaction was completed, the ethyl acetate phase was taken and dried under nitrogen to obtain Compound 4.

[0043] (3) Expression and purification of CarF protein.

[0044] (4) Compounds 4 and CarF protein were added to Tris - HCl buffer with pH = 7 - 7.5. The mass ratio of Compound 4 to CarF protein added was 1:100 - 1000; then NADH solution and catalase solution were added. The molar ratio of Compound 4 to NADH was 1:1 - 5, and the mass ratio of Compound 4 to catalase added was 100:1 - 10. The reaction was carried out at 30 - 37 °C for 16 - 24 h to obtain Compound 5.

[0045] Among them, the preparation of Compound 1 includes the following steps:

[0046] (a) Solid dodecanoic acid was dissolved in anhydrous ether to obtain a dodecanoic acid solution with a dodecanoic acid concentration of 34 - 36 mg / mL. Then, a dichloromethane solution containing 1 M dicyclohexylcarbodiimide (DCC) (pre - diluted with anhydrous ether for 10 - 15 min, and the volume ratio of the dichloromethane solution containing dicyclohexylcarbodiimide to anhydrous ether was 2 - 3:8 - 10) was added dropwise. The volume ratio of the dodecanoic acid solution to the dichloromethane solution containing 1 M dicyclohexylcarbodiimide (DCC) was 14 - 15:2 - 3; the resulting white suspension was continuously stirred at room temperature for 12 - 16 h, and the obtained white solid was dried to obtain dodecanoic anhydride.

[0047] (b)After dissolving 5'-AMP in a mixed solution of sodium hydroxide, pyridine, and water (the volume ratio of water to pyridine is 1:1, and the concentration of sodium hydroxide in the mixed solution is 0.4 - 0.6 mM), a 5'-AMP solution with a 5'-AMP concentration of 17 - 19 mg / mL is obtained; a tetrahydrofuran solution (THF) containing 30 - 50 mg / mL of dodecanoic anhydride is added to the 5'-AMP solution in two portions, and the volume ratio of the tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution is 1:1. After addition, a white suspension is formed, and the suspension is continuously stirred at room temperature for 20 - 30 min, and the suspension becomes an almost clear solution.

[0048] (c)Post-extraction treatment: Add anhydrous ether, vigorously stir the two-phase mixture, then let it stand and remove the upper layer. Repeat this step twice. Add distilled water, and adjust the pH of the solution to 3 - 3.5 by dropwise adding hydrochloric acid solution. Then add anhydrous ether for extraction and repeat this step once. Separate the upper layer, transfer it to a Buchner funnel, and wash it with ether. The final product is obtained and dried to obtain Compound 1.

[0049] Among them, the preparation of Compound 2 includes the following steps: Add 1-O-Hexadecyl-sn-glycero-3-phosphocholine, Bco-β-Ala-OH, 4-dimethylaminopyridine (DMAP), and triethylamine (Et 3 N) to chloroform (CHCl 3 ), and the molar ratio of 1-O-Hexadecyl-sn-glycero-3-phosphocholine, Bco-β-Ala-OH, 4-dimethylaminopyridine, triethylamine, and chloroform is 9 - 11:23 - 26:55 - 65:0.5 - 2:450; then add 2,4,6-trichlorobenzoyl chloride (TCBC), and the molar ratio of 2,4,6-trichlorobenzoyl chloride to 1-O-Hexadecyl-sn-glycero-3-phosphocholine is 1:1. Stir and react for 12 - 15 h, and a solid is obtained after removing the solvent by adding water; the solid is stirred and reacted again in a mixed solution of trifluoroacetic acid (TFA) and dichloromethane (CH 2 Cl 2 ) (volume ratio is 1:1) for 20 - 30 min, and the addition ratio of the solid to the mixed solution is 150 - 200 mg:5 mL. After removing the solvent, a colorless oil is obtained to obtain Compound 2.

[0050] Among them, the expression of CarF protein includes the following steps:

[0051] Bacterial culture: The myxobacteria and Bacillus subtilis were activated and cultured in test tubes. The culture temperature of the myxobacteria was 30 °C, and that of Bacillus subtilis was 37 °C. The genomic DNA was extracted and the target genes CarF and Mistic were amplified. The plasmid pet28a, CarF, and Mistic were used to obtain the recombinant plasmid pet28a-Mistic-CarF under the action of recombinase.

[0052] The recombinant plasmid pet28a-Mistic-CarF was used for the co-expression of Mistic-CarF in Escherichia coli OverExpreessC43(DE3) cells. The cells were cultured at 37 °C until the OD 600 was between 0.8 and 1.0. Before induction with isopropyl-β-thiogalactoside (IPTG), the culture was ice-bathed for 30 - 40 min. Isopropyl-β-thiogalactoside (IPTG) was added to a final concentration of 0.2 mM to induce the expression of T7-dependent genes. The culture was shaken at 37 °C for 4 - 5 h. Finally, the bacteria were collected and washed.

[0053] Among them, the myxobacteria ( Myxococcus xanthus ), Bacillus subtilis ( Bacillus subtilis ) used for the expression of CarF protein were purchased from the China General Microbiological Culture Collection Center, with the preservation numbers CGMCC1.3865 and CGMCC1.8886 respectively. Escherichia coli OverExpreessC43(DE3) and DH5α used for the expression of CarF protein were preserved in this laboratory.

[0054] The medium used for myxobacteria: 5 g of yeast powder, 1.36 g of CaCl 2 and 0.5 mg of vitamin B12 were dissolved in 1 L of water, and then autoclaved at 121 °C for 20 min in a high-pressure sterilizer.

[0055] The media used for Bacillus subtilis and Escherichia coli: 10 g of NaCl, 5 g of yeast extract, and 10 g of peptone were dissolved in 1 L of water, and then autoclaved at 121 °C for 20 min in a high-pressure sterilizer.

[0056] Among them, the purification of CarF protein includes the following steps:

[0057] The collected bacteria were resuspended in buffer A (20 mM Tris / HCl (pH 8.0) and 150 mM NaCl), and then sonicated on ice to produce a lysate.

[0058] Subsequently, the cell lysate was centrifuged to remove cell debris (4000×g, 4 °C, 15 min), and then added to buffer A containing 1 wt% dodecylphosphocholine (DPC) to dissolve the proteins in the insoluble fraction for 2 - 3 h. Then, insoluble impurities in E. coli were removed (15,000×g, 4 °C, 90 min), and the detergent DPC-soluble fraction was filtered through a 0.45-μm filter membrane using a syringe. Finally, purification was performed by AKTA and HisTrapHP affinity chromatography, and washing was carried out with buffer B (20 mM Tris / HCl (pH 8.0), 150 mM NaCl, 700 mM imidazole, and 0.02 wt% DPC) to finally obtain the target protein.

[0059] Example 1: Preparation of Compound 1

[0060] (a) Weigh 482 mg of dodecanoic acid and dissolve it in 14 mL of anhydrous ether, and stir at room temperature for 10 min to obtain a dodecanoic acid solution. Dilute 2.4 mL of a dichloromethane solution containing 1 M dicyclohexylcarbodiimide (DCC) with 8 mL of ether in advance for 12 min, and then add it dropwise to the above dodecanoic acid solution. Continuously stir the resulting white suspension at room temperature for 14 h, and dry the obtained white solid to obtain dodecanedioic anhydride.

[0061] (b) Dissolve 295 mg of 5'-AMP in a mixed solution of 16 mL of sodium hydroxide, pyridine, and water (the volume ratio of water to pyridine is 1:1, and the mixed solution contains 40 mg of sodium hydroxide) to obtain a 5'-AMP solution. Then, dissolve 480 mg of dodecanedioic anhydride in 16 mL of tetrahydrofuran solution, and add it to the 5'-AMP solution in two portions. After adding, a white suspension is formed, and the suspension is continuously stirred at room temperature for 20 min, and the suspension becomes a clear solution.

[0062] (c) Post-extraction treatment: Add 40 mL of anhydrous ether, and vigorously stir the two-phase mixture for 5 min. Then, allow the two phases to stand still, and carefully remove the upper phase. Repeat the above steps twice. Then, add 7 mL of distilled water, stir, and continue to add 8 mL of hydrochloric acid solution (10 wt%) dropwise while stirring to adjust the pH to 3. Finally, add 80 mL of anhydrous ether for extraction and repeat this step once. Finally, separate the upper layer and transfer it to a Buchner funnel, wash it with 40 mL of anhydrous ether, and dry the final product to obtain Compound 1 (dodecanoic acid - AMP), as Figure 1 shown in the synthetic route of Compound 1.

[0063] Example 2: Preparation of Compound 2:

[0064] Weigh 47.5 mg of 1-O-Hexadecyl-sn-glycero-3-phosphocholine, 45.3 mg of Bco-β-Ala-OH, 70.2 mg of 4-dimethylaminopyridine (DMAP) and 46.7 μL of triethylamine (Et 3 N) and stir them in 7.5 mL of chloroform (CHCl 3 ) for 10 min. Then add 97.3 μL of 2,4,6-trichlorobenzoyl chloride (TCBC) and stir for 13 h. After the time is up, add 250 μL of double-distilled water to remove the solvent to obtain a solid. Finally, stir the obtained solid in a mixed solution of 5 mL of trifluoroacetic acid (TFA) and dichloromethane (CH 2 Cl 2 ) (the volume ratio of trifluoroacetic acid to dichloromethane is 1:1) for 25 min, and remove the solvent to obtain a colorless oil, which is Compound 2. As shown in the left part of Figure 2 , the route for synthesizing Compound 2 from Compound 1 is shown. As shown in Figure 4 , the GC-MS identification result of Compound 2 is shown.

[0065] Example 3: Preparation of Compound 3:

[0066] Take 17 mg of Compound 2 prepared in Example 2 and 16 mg of Compound 1 prepared in Example 1 and put them into 100 mM HEPES buffer solution. Stir and react at pH 7.5 and 37 °C for 3 h. After the reaction is completed, remove the solution to obtain a white product, which is Compound 3. As shown in the middle part of Figure 2 , the route for synthesizing Compound 3 from Compound 1 and Compound 2 is shown. As shown in Figure 4 , the GC-MS identification result of Compound 3 is shown.

[0067] Example 4: Preparation of Compound 4

[0068] Weigh 3.10 mg of Compound 3 prepared in Example 3 and add it to 3 mL of ethyl acetate. Dissolve it under the action of a magnetic stirrer to obtain an ethyl acetate phase. Then, weigh 10 mg of phospholipase D and dissolve it in 1.5 mL of water, and add 50 mg of ethanolamine to dissolve it to obtain an aqueous phase. Immediately mix the ethyl acetate phase and the aqueous phase, and add 15 μL of 1.5 M CaCl 2 solution. Start stirring at 30 °C and stir and react for 7 h. After the reaction is completed, take the ethyl acetate phase and dry it under nitrogen to obtain Compound 4. As shown in the rightmost part of Figure 2 , the route for synthesizing Compound 4 from Compound 3 is shown. As shown in Figure 4The GC-MS identification results of Compound 4 are shown as follows.

[0069] Example 5: Bacterial Culture and In Vitro Cloning of Target Genes

[0070] (1) Bacterial culture: The myxobacteria and Bacillus subtilis were plated and activated for culture. Single colonies of myxobacteria were picked and inoculated into 5 mL of TGY medium (5 g of yeast powder, 1.36 g of CaCl 2 and 0.5 mg of vitamin B12 were dissolved in 1 L of water, and then sterilized at 121 °C for 20 min in an autoclave). The myxobacteria were cultured overnight at 30 °C on a shaker at a shaker speed of 220 rpm; single colonies of Bacillus subtilis were picked and inoculated into 5 mL of LB medium (10 g of NaCl, 5 g of yeast extract, 10 g of peptone were dissolved in 1 L of water, and then sterilized at 121 °C for 20 min in an autoclave). The Bacillus subtilis was cultured overnight at 37 °C on a shaker at a shaker speed of 220 rpm; after overnight culture, the bacterial cells were collected, and genomic DNA was extracted using a bacterial genomic DNA extraction kit.

[0071] (2) Obtaining gene fragments by PCR amplification: The upstream and downstream primers of CarF and Mistic were designed using Primer 5.0 respectively, and the sequences were as follows:

[0072] CarF-F: ATGAAGACCCAAGAGATTGAAAAGAAGGT;

[0073] CarF-R: CTACGGGCGCGTGGAGGC;

[0074] mistic-F: atgttttgtacattttttgaaaaacatcaccg;

[0075] mistic-R: tcattctttttctccttcttcagatact.

[0076] The reaction was carried out in a PCR instrument. After the reaction was completed, the sample was loaded onto a 1 wt% agarose gel, and electrophoresis was carried out at a constant voltage of 120 v for 30 min to separate the products. After staining with ethidium bromide for 20 min, the bands were observed under a gel imager. The gel imaging diagram is as Figure 3 shown, and the target DNA band was obtained, and the target band was recovered.

[0077] (3) Construction of plasmid Pet28a-Mistic-CarF: Mistic, CarF and Pet28a obtained from step (2) were reacted at 50 °C for 30 min under the action of a recombinase to obtain the Pet28a-Mistic-CarF plasmid.

[0078] Example 6: Expression and Purification of CarF Protein

[0079] (1) Protein Expression: Escherichia coli OverExpreessC43(DE3) cells transformed with the Pet28a-Mistic-CarF plasmid in Example 5 were cultured in 500 mL of LB medium (10 g NaCl, 5 g yeast extract, 10 g peptone dissolved in 1 L of water, and then autoclaved at 121 °C for 20 min) at 37 °C until the OD 600 was between 0.8 and 1.0. Then, it was ice-bathed for half an hour, followed by the addition of 100 μL of 1 M isopropyl-β-thiogalactoside (IPTG) solution, and induced at 37 °C for 3 h. Finally, the bacteria were collected and washed.

[0080] (2) Protein Purification: The bacteria collected in step (1) were resuspended in buffer A (20 mM Tris / HCl (pH 8.0) and 150 mM NaCl), and then sonicated on ice to produce a lysate. Next, the cell lysate was centrifuged at 4000×g, 4 °C for 15 min to remove cell debris, and then added to buffer A containing 1 wt% dodecylphosphocholine (DPC) to dissolve the protein in the insoluble fraction for 2 h. Immediately afterwards, it was centrifuged at 15,000×g, 4 °C for 90 min to remove insolubles. Finally, it was filtered through a 0.45 μm filter membrane using a syringe, purified by AKTA and HisTrapHP affinity chromatography, and washed with buffer B (20 mM Tris / HCl (pH 8.0), 150 mM NaCl, 700 mM imidazole, and 0.02 wt% DPC) to finally obtain the target protein, as shown in Figure 5 A in the figure, and obtain the single-product Mistic-CarF protein.

[0081] (3) Removal of Molecular Chaperone Mistic at the SNAC Cleavage Site: Elute the protein in step (2) from Ni-NTA, specifically by performing the following operations.

[0082] a. Use a desalting column to completely remove imidazole from the eluted Mistic-CarF membrane protein, and change it 4 times to change the buffer to the lysis buffer (pH 8.2, containing 0.1 M HEPES, 0.1 M NaCl, 0.1 M acetone oxime, and 5 mM DPC).

[0083] b. After changing the buffer 4 times, measure the protein concentration to be 0.5 - 1.0 mg / mL. If the protein concentration is high, dilute the protein concentration to this range using the lysis buffer.

[0084] c. In a 1.5 mL centrifuge tube, add 10 μL of 0.1 M NiCl 2 solution, and then add 1 mL of the above-mentioned Mistic-CarF protein to the same tube. Pipette several times to mix evenly.

[0085] d. Incubate the reaction at room temperature (20 °C) for 24 h without shaking or vortexing.

[0086] e. After the reaction is completed, add the resulting protein solution back into the concentrator tube and exchange the buffer 3 times to exchange the protein into the desired buffer (pH 8.0, containing 20 mM Tris and 0.15 M NaCl) and remove free Ni 2+ , as shown in B of Figure 5 and C of 5, and finally obtain a CarF protein with higher purity.

[0087] Example 7: Preparation of Compound 5

[0088] Synthesis of Compound 5: Take 7 mg of Compound 4 (alkyl phosphatidylethanolamine) prepared in Example 4 in 0.5 M Tris-HCl buffer with pH = 7.2, add NADH with a final concentration of 20 mM and catalase at 30 μg / mL, and take 8 μL of the purified CarF protein in Example 6 for the reaction. The reaction temperature is 37 °C and the reaction time is 22 h. Finally, Compound 5 is obtained. As Figure 6 shown is the mass spectrum of Compound 5 (amide acetal phospholipid), indicating that the amide acetal phospholipid has been successfully synthesized in the present invention.

[0089] GC-MS analysis product of Compound 5: Freeze-dry Compound 5, and then perform derivatization treatment with fatty acid methyl ester. At the same time, resuspend the dried powder in chloroform:methanol (2:1, v / v), and add 2,6-di-tert-butyl-4-methylphenol (BHT) to 0.01% to minimize oxidation.

[0090] Dry the 2 mg resuspended solution of Compound 5 under nitrogen and, at 55 °C, use 1 mL of benzene and 2 mL of methanol solution containing 1 wt% H 2 SO 4 for acid hydrolysis overnight. Quench the reaction with 2 mL of 0.2 M KHCO 3 solution, gently mix with 5 mL of n-hexane containing 0.01 wt% BHT, and then centrifuge at 500×g for 3 min. Transfer the upper hexane phase to a separate tube, mix the lower layer with 5 mL of n-hexane again, transfer the upper phase, combine it with the upper hexane phase extracted for the first time, and dry it with nitrogen.

[0091] A triple quadrupole gas chromatography-mass spectrometry analyzer (GC-MS; 7890B / 7000C, Agilent, USA) was used, with a DB-5 fused silica capillary column (30 m × 0.25 mm × 0.25 μm); the flow rate of helium carrier gas was 1 mL / min, 1 μL of sample was injected, the column temperature was increased from 60 °C to 270 °C at a rate of 6 °C / min and held for 10 min; the inlet temperature, MSD transfer line, ion source, and quadrupole temperature were set at 250 °C, 280 °C, 230 °C, and 150 °C, respectively; the fixed electron energy was 70 eV, and the mass selective detector scan mode was 40 to 500 m / z. As Figure 7 shown, the GC-MS results indicated that the product of compound 5 was successfully obtained.

[0092] Example 8: Evaluation of the characteristics of the amide acetal phospholipid of compound 5

[0093] The specific steps are as follows:

[0094] a. Preparation of amide acetal phospholipid solution: Compound 5 was dissolved in DMSO to prepare an amide acetal phospholipid solution with a concentration of 500 μg / mL for standby.

[0095] b. Preparation of H 2 O 2 solution: A solution of H 2 O 2 with a concentration of 500 μM was prepared for standby.

[0096] c. Cell culture: PC12 neuronal cells were cultured in DMEM / F-12 medium (purchased from Thermo fisher) under standard conditions (5% CO 2 / 37 °C), and 1 mL of insulin-transferrin-selenium (100×), 40 ng / mL of dexamethasone, 10 wt% FBS, 100 U / mL of penicillin, and 100 U / mL of streptomycin were added during the culture process. BV2 microglial cells were also cultured in DMEM / F-12 medium under standard conditions (5% CO 2 / 37 °C), and 10 wt% FBS, 100 U / mL of penicillin, and 100 U / mL of streptomycin were added during the culture process.

[0097] d. Detection of the effect of amide acetal phospholipid on scavenging ROS: Hydrogen peroxide was added to PC12 neuronal cells and BV2 microglial cells respectively for 12 h, and after AMD-pls pretreatment for 12 h, the ROS levels in the two types of cells were detected using a ROS detection kit (Beyotime).

[0098] e. Evaluation of amide acetal ions: The results are as Figure 8As shown, the data indicate that the amide acetal phospholipids (Compound 5) synthesized by the present invention have a scavenging effect on ROS in two different types of nerve cells in vivo, and the effect is significant, showing great potential in the treatment of neurological diseases.

[0099] The above are only the preferred embodiments of the present invention, and do not limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the specification of the present invention, or directly or indirectly applied in other related technical fields, shall be equally included in the patent protection scope of the present invention.

Claims

1. A method for preparing an amide acetal phospholipid compound, characterized in that: The steps include: (1) Compound 1 and Compound 2 are reacted in HEPES buffer at a pH of 7-8 to obtain Compound 3; (2) dissolving compound 3 in ethyl acetate to obtain an ethyl acetate phase; adding phospholipase D and ethanolamine to water to obtain an aqueous phase; mixing the ethyl acetate phase and the aqueous phase, and adding CaCl2 to react; after the reaction is completed, taking the ethyl acetate phase and drying it to obtain compound 4; (3) Expression and purification of CarF protein from myxobacteria; (4) Compound 4 and CarF protein are reacted in Tris-HCl buffer with the assistance of NADH and catalase, and the pH of the Tris-HCl buffer is 7-7.5 to obtain compound 5; The structural formula of compound 1-5 is as follows: 。 2. The method for preparing an amide acetal phospholipid compound according to claim 1, characterized in that: The preparation method of compound 1 comprises the following steps: dissolving 5'-AMP in a mixed solution of sodium hydroxide, pyridine and water to obtain a 5'-AMP solution; adding a tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution, stirring for reaction, and performing extraction and post-treatment after the reaction to obtain compound 1.

3. The method for preparing an amide acetal phospholipid compound according to claim 2, wherein The volume ratio of pyridine to water is 1:1; the concentration of sodium hydroxide in the mixed solution is 0.4-0.6 mM; the concentration of 5'-AMP in the 5'-AMP solution is 17-19 mg / mL; the concentration of dodecanoic anhydride in the tetrahydrofuran solution containing dodecanoic anhydride is 30-50 mg / mL; the volume ratio of the tetrahydrofuran solution containing dodecanoic anhydride to the 5'-AMP solution is 1:1; and the stirring reaction is stirred at room temperature for 20-30 minutes.

4. The method for preparing an amide acetal phospholipid compound according to any one of claims 1 to 3, characterized in that: The preparation method of compound 2 comprises the following steps: adding 1-O-hexadecyl-sn-glyceryl-3-phosphocholine, Bco-β-alanine, 4-dimethylaminopyridine and triethylamine into chloroform, then adding 2,4,6-trichlorobenzoyl chloride and stirring for reaction, adding water to remove the solvent to obtain a solid; stirring the solid again in a mixed solution of trifluoroacetic acid and dichloromethane for reaction, and removing the solvent to obtain compound 2.

5. The method for preparing an amide acetal phospholipid compound according to claim 4, characterized in that: The molar ratio of 1-O-hexadecyl-sn-glyceryl-3-phosphocholine, Bco-β-alanine, 4-dimethylaminopyridine, triethylamine and chloroform is 9-11:23-26:55-65:0.5-2:450; the molar ratio of 2,4,6-trichlorobenzoyl chloride and 1-O-hexadecyl-sn-glyceryl-3-phosphocholine is 1:1; the stirring reaction time is 12-15h; the ratio of the added amount of the solid and the mixed solution is 150-200mg:5mL; the stirring reaction time again is 20-30min.

6. The method for preparing an amide acetal phospholipid compound according to claim 1, characterized in that: In step (1), the molar ratio of compound 1 to compound 2 is 1:0.8-1.3; the reaction conditions are 37° C. and stirring for 3-5 hours.

7. The method for preparing an amide acetal phospholipid compound according to claim 1, characterized in that: The concentration of compound 3 in the ethyl acetate phase is 2-4 mg / mL; the concentration of phospholipase D in the aqueous phase is 3-10 mg / mL; the mass ratio of phospholipase D to ethanolamine is 1:5-10; the volume ratio of the ethyl acetate phase to the aqueous phase is 1.5-3:1; the amount of CaCl2 added is such that the concentration of CaCl2 in the solution after addition is 3-10 mM; and the reaction is stirred at 30-40°C for 7-8h.

8. The method for preparing an amide acetal phospholipid compound according to claim 1, characterized in that: In step (4), the mass ratio of the compound 4 to the CarF protein is 1:100-1000; the molar ratio of the compound 4 to NADH is 1:1-5; the mass ratio of the compound 4 to catalase is 100:1-10; the reaction temperature is 30-37°C, and the reaction time is 16-24h.

9. Use of an amide acetal phospholipid compound prepared by the preparation method according to any one of claims 1 to 8 in the manufacture of a medicament for treating Alzheimer's disease, Parkinson's disease or Zellweger syndrome.

Images