Bacillus amyloliquefaciens H-6 and its application in the preparation of a medicament for treating or preventing porcine reproductive and respiratory syndrome virus infection
By using Bacillus amyloligo H-6 as an antiviral microecological preparation, the prevention and treatment problems of pig reproductive and respiratory syndrome virus infection were solved, and a low-cost, safe and efficient PRRSV control effect was achieved.
Patent Information
- Application Number
- CN202510407721.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-02
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2045-04-02
AI Technical Summary
The existing technology is difficult to effectively prevent and treat pig breeding and respiratory syndrome virus (PRRSV) infection, and the protective efficacy of existing vaccines is limited, mutant strains lead to epidemics, and the research and development costs of antiviral drugs are high and the cycle is long.
Bacillus amyloligosaccharide H-6 is used as an antiviral microecological preparation to prepare drugs through fermentation broth or complexes, which are used to reduce the sensitivity of cells and animal bodies to PRRSV, inhibit virus invasion and proliferation, and prepare feed additives to prevent and control PRRSV infection.
Bacillus amyloliquefaciens H-6 showed significant anti-PRRSV activity in vivo, reducing viral proliferation, reducing lung damage, reducing mortality, promoting growth, non-toxic side effects, economical and safe, and significantly inhibiting PRRSV detoxification and clinical symptoms.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of antiviral microecological preparations for livestock and poultry, and particularly relates to Bacillus amyloliquefaciens H-6 and its application in the preparation of a medicament for treating or preventing porcine reproductive and respiratory syndrome virus infection. Background Art
[0002] Porcine Reproductive and Respiratory Syndrome (PRRS) is a highly contagious disease mainly characterized by reproductive disorders in sows and respiratory disorders in pigs of all ages caused by Porcine Reproductive and Respiratory Syndrome virus (PRRSV). PRRSV infection can cause respiratory system diseases in pigs of all ages. At the same time, PRRSV infection can also cause disorders of the body's immune system, resulting in immunosuppression, thereby triggering secondary or mixed infections of other pathogens such as Porcine circovirus type 2, Streptococcus suis, and Mycoplasma hyopneumoniae. This causes multiple inflammations to break out simultaneously in the later stage of PRRSV infection, ultimately leading to an increase in the mortality rate of the infected pig population and causing huge economic losses to the live pig breeding industry. However, due to the high variability of PRRSV, the continuous emergence of new strains, immune escape, and poor cross-protection effects between heterologous strains, the protective efficacy of existing vaccines is limited, and PRRSV infection has not been well controlled. The emergence of mutant strains often leads to the prevalence of PRRSV diseases. Related antiviral drug research has found that the research and development of antiviral drugs often have the characteristics of high R & D costs, long R & D cycles, and high production costs. As a green and safe microorganism, probiotics have a wide variety of species and sources, providing a new idea for the research and development of anti-PRRSV drugs and being one of the effective options for developing anti-PRRSV drug preparations at present.
[0003] As one of the important infectious diseases affecting the development of the world's live pig breeding industry, although domestic and foreign research on PRRS has been carried out for more than 30 years, there is still no highly effective antiviral product in clinical practice. Summary of the Invention
[0004] The object of the present invention is to provide a strain of Bacillus amyloliquefaciens H-6 that resists porcine reproductive and respiratory syndrome virus infection to solve the problem that porcine reproductive and respiratory syndrome virus (PRRSV) infection is difficult to prevent and treat. The preservation number of this strain of Bacillus amyloliquefaciens is: CCTCC NO: M 20242740.
[0005] Another object of the present invention is to provide the use of Bacillus amyloliquefaciens H-6 in the preparation of a medicament for treating or preventing porcine reproductive and respiratory syndrome virus infection.
[0006] To achieve the above object, the present invention adopts the following technical measures:
[0007] The applicant screened a strain of Bacillus amyloliquefaciens with significant inhibitory effect on porcine reproductive and respiratory syndrome virus infection from 92 self-retained Bacillus strains. This strain was deposited at the China Center for Type Culture Collection on December 06, 2024. The taxonomic name is Bacillus amyloliquefaciens H-6, and the deposit number is CCTCC NO: M 20242740. The address is Wuhan University, Wuhan, China.
[0008] The protection scope of the present invention includes:
[0009] The fermentation broth of Bacillus amyloliquefaciens H-6, and the fermentation broth contains viable Bacillus amyloliquefaciens H-6 bacteria.
[0010] A compound, and the active ingredient of the compound includes viable Bacillus amyloliquefaciens H-6 bacteria with the deposit number of CCTCC NO: M 20242740.
[0011] The use of Bacillus amyloliquefaciens H-6, the fermentation broth of Bacillus amyloliquefaciens H-6 and / or its compound in the preparation of a medicament for treating or preventing porcine reproductive and respiratory syndrome virus infection.
[0012] The use of Bacillus amyloliquefaciens H-6, the fermentation broth of Bacillus amyloliquefaciens H-6 and / or its compound in the preparation of a medicament for reducing the sensitivity of cells to porcine reproductive and respiratory syndrome virus.
[0013] For the above-mentioned use, preferably, the cells are porcine-derived cells.
[0014] The use of Bacillus amyloliquefaciens H-6, the fermentation broth of Bacillus amyloliquefaciens H-6 and / or its compound in the preparation of a feed additive for pigs.
[0015] Compared with the prior art, the advantages of the present invention are as follows:
[0016] In the present invention, the probiotic Bacillus amyloliquefaciens H-6 is used to conduct anti-infection research on PRRSV at the cellular level and the animal body level, and it is found that it has significant anti-PRRSV activity both in vivo and in vitro. As a potential antiviral probiotic preparation, Bacillus amyloliquefaciens has the following advantages compared with vaccines and traditional antiviral chemical drugs:
[0017] 1. Bacillus amyloliquefaciens has low production cost, strong stress resistance, and is convenient for storage, transportation and use.
[0018] 2. It has no toxic or side effects, no residues, antiviral properties, promotes growth, and is green and safe.
[0019] 3. It has the advantages of being easy to use, safe, having no immune stress, and high economic benefits.
[0020] 4. The fermentation broth of Bacillus amyloliquefaciens H-6 in the present invention can, at the cellular level, reduce the infection activity of PRRSV cells, inhibit the invasion and infection of PRRSV to cells, reduce the proliferation of the virus on cells, and can be used for the prevention and control of PRRSV infection.
[0021] 5. The preparation of Bacillus amyloliquefaciens H-6 in the present invention, when administered orally to experimental pigs, can effectively protect against the morbidity and death caused by PRRSV infection. 80% of the pigs in the control group died, while the survival rate of the pigs fed with the preparation containing Bacillus amyloliquefaciens reached 100%; it can significantly inhibit PRRSV excretion, reduce environmental pollution, can significantly reduce the damage of PRRSV infection to lung tissues and organs, can effectively control the adverse effects caused by PRRSV infection to the body, and can be used for the prevention and control of PRRSV. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Shows the effect of the Bacillus amyloliquefaciens preparation on the proliferation of porcine reproductive and respiratory syndrome virus (PRRSV) at the cellular level.
[0023] Figure 2 Shows the effect of feeding the Bacillus amyloliquefaciens preparation on the survival rate of PRRSV infection.
[0024] Figure 3 Shows the effect of feeding the Bacillus amyloliquefaciens preparation on the clinical symptoms of PRRSV-infected pigs.
[0025] Figure 4 Shows the effect of feeding the Bacillus amyloliquefaciens preparation on the virus content in the serum of PRRSV-infected pigs.
[0026] Where A is the positive control group infected with PRRSV, and B is the experimental group fed with the Bacillus amyloliquefaciens preparation.
[0027] Figure 5 Shows the effect of feeding the Bacillus amyloliquefaciens preparation on the body temperature of PRRSV-infected pigs.
[0028] Where A is the positive control group infected with PRRSV, and B is the experimental group fed with the Bacillus amyloliquefaciens preparation.
[0029] Figure 6 Effect of feeding Bacillus amyloliquefaciens preparation on the body weight of PRRSV-infected pigs.
[0030] Among them, A is the positive control group infected with PRRSV, and B is the experimental group fed with Bacillus amyloliquefaciens preparation.
[0031] Figure 7 Effect of feeding Bacillus amyloliquefaciens preparation on the virus content in the anal swabs of PRRSV-infected pigs.
[0032] Among them, A is the positive control group infected with PRRSV, and B is the experimental group fed with Bacillus amyloliquefaciens preparation.
[0033] Figure 8 Effect of Bacillus amyloliquefaciens preparation on the virus content in the pharyngeal swabs of PRRSV-infected pigs.
[0034] Among them, A is the positive control group infected with PRRSV, and B is the experimental group fed with Bacillus amyloliquefaciens preparation.
[0035] Figure 9 Effect of Bacillus amyloliquefaciens preparation on the virus content in the nasal swabs of PRRSV-infected pigs.
[0036] Among them, A is the positive control group infected with PRRSV, and B is the experimental group fed with Bacillus amyloliquefaciens preparation.
[0037] Figure 10 Effect of Bacillus amyloliquefaciens preparation on the pathological changes of tissues and organs of PRRSV-infected pigs. Detailed implementation mode
[0038] To better understand the content of the present invention, the following further describes the content of the present invention in combination with specific embodiments. However, the protection scope of the present invention is not limited to the following embodiments. The test methods and conditions in the embodiments of the present invention are all conventional methods unless otherwise specified. The technical solutions described in the present invention are all conventional solutions in the field unless otherwise specified; the reagents or materials are all from commercial channels unless otherwise specified.
[0039] Example 1:
[0040] Screening of probiotic strains against PRRSV infection
[0041] 1. Culture of Marc-145 cells
[0042] Take out the cryopreserved Marc145 cells from the liquid nitrogen tank, quickly thaw them by heating in a 37°C water bath, then place the cell suspension in a centrifuge tube for centrifugation. After centrifugation, discard the supernatant, resuspend with 1640 complete medium containing 10% serum and transfer to a T25 cell culture flask. Place the cell flask in a constant temperature cell incubator at 37°C with 5% CO2 for culture. After the cells grow into a uniform monolayer, discard the supernatant, wash 3 times with PBS, then add trypsin to digest the cells for 3 - 5 minutes, terminate the digestion with 1640 complete medium, centrifuge and discard the supernatant, add fresh complete medium to resuspend the cells, and then transfer the cells into a new cell culture flask or culture plate for standby.
[0043] 2. Preparation of probiotic fermentation broth
[0044] Streak-culture the glycerol bacteria of 92 self-preserved Bacillus strains stored in the applicant's laboratory, then pick a single colony and inoculate it into 50 ml of NB liquid medium. After culturing on a shaker at 37°C for 24 hours, centrifuge at 3500 r / min for 10 minutes, take the supernatant and store it at -80°C for standby.
[0045] 3. Anti-PRRSV treatment of probiotic fermentation broth in Marc 145 cells and alveolar macrophages (PAM)
[0046] Uniformly inoculate Marc145 cells into a 24-well cell culture plate and place it in a constant temperature cell incubator for culture. After the cells grow into a uniform monolayer, discard the supernatant, wash 3 times with sterile PBS, then inoculate with 1640 medium containing different probiotic fermentation broths, where the concentration of the probiotic fermentation broth is 10 μL / mL. Additionally, set up a blank control group without the fermentation broth. After 6 hours, discard the supernatant, wash 3 times with PBS, then inoculate with a mixture of 1640 medium containing different probiotic fermentation broths and PRRSV virus (0.1 MOI). After culturing in the cell incubator for 2 hours, discard the supernatant, wash 3 times with PBS, then inoculate with a new medium containing different probiotic metabolites, and place the 24-well cell culture plate in a constant temperature cell incubator for 24 hours. The method of treating primary alveolar macrophages (PAM cells) with the probiotic fermentation broth is the same as that for Marc145.
[0047] 4. Determination of virus load in cells and virus fluids
[0048] The 24-well cell plate after the above-mentioned 24-hour culture was placed in an -80°C refrigerator and repeatedly frozen and thawed 3 times to fully release the virus particles in the cells. Then, the supernatant was collected by centrifugation for virus load detection. The detection method was carried out according to the real-time fluorescence quantitative PCR method recommended by the national standard for porcine reproductive and respiratory syndrome virus detection in the People's Republic of China (GB / T 18090-2023). The primer sequences were F: 5’-GCACTGATTGACAYTGTGCC-3’; R: 5’-CGCATGGTTCTCGCCAAT-3’; and the probe primer was: 5’-(FAM)AGTCACCTATTCAATTAGGGCGACCG(TAMRA)-3’.
[0049] The results are shown in Table 1 and Figure 1 As shown, among the 92 screened probiotic strains, it was found that the fermentation broths of probiotic strains No. 57, No. 62, No. 66, No. 71, No. 74, and No. 88 had significant anti-PRRSV activity compared with the control group, with P < 0.001 and CT values higher than those of the control group. Marc145 cells and primary PAM cells were treated with the fermentation broth of strain No. 74 and then infected with the PRRSV attenuated strain NAD30, the highly virulent strain WH3, and the recombinant strain PRRSV-GFP, respectively. After 24 hours of infection, the virus content in the cells was detected. The results showed that the average CT values of NAD30, WH3, and PRRSV-GFP in Marc145 cells treated with the fermentation broth of strain No. 74 increased by 12.88, 13.09, and 2.39, respectively, compared with the control group; the average CT values of NAD30, WH3, and PRRSV-GFP in primary PAM cells treated with the fermentation broth of strain No. 74 increased by 7.43, 10.52, and 6.07, respectively, compared with the control group. The above results indicate that probiotic strain No. 74 can significantly inhibit the proliferation of the PRRSV attenuated strain NAD30, the highly virulent strain WH3, and the recombinant strain PRRSV-GFP in Marc145 cells and primary PAM cells. Strain No. 74 has broad-spectrum antiviral activity against PRRSV, so strain No. 74 was further identified.
[0050] 5. Biological characteristics and identification of strain H-6 with anti-PRRSV activity
[0051] After testing, it was found that probiotic strain No. 74 was a Gram-positive bacterium, which could form spores and was non-motile; the colonies on the NA medium were circular structures with a diameter of 3-4 mm and a smooth surface. The study found that the optimal growth temperature of this bacterium was 37°C, and the optimal growth pH was 6-7. 16S detection showed that the similarity of this bacterium to Bacillus amyloliquefaciens was as high as 99.9%.
[0052] The applicant of the present invention named it Bacillus amyloliquefaciens H-6. This strain was sent to the China Center for Type Culture Collection (CCTCC) on December 06, 2024. Classification name: Bacillus amyloliquefaciens H-6, deposit number: CCTCC NO: M 20242740, address: Wuhan University, Wuhan, China.
[0053] Table 1. Screening of Probiotics Against PRRSV
[0054]
[0055] Example 2:
[0056] Effect of Probiotic Preparation on PRRSV Infection in Pigs
[0057] 1. Preparation of Probiotic Preparation Against PRRSV
[0058] First, the cryopreserved Bacillus amyloliquefaciens H-6 was resuscitated. An appropriate amount of freeze-dried bacterial powder was dipped with a 1 mL pipette tip and inoculated into NB liquid medium, followed by shaking culture at 37 °C for 12 h. After 12 h, an appropriate amount of bacterial liquid was taken with an inoculation loop and streaked on NA solid plate medium and cultured at 37 °C for 12 h. Then, single colonies were picked and inoculated into NB liquid medium, and cultured at 37 °C and 160 rpm for 12 h.
[0059] Subsequently, the H-6 bacterial liquid was inoculated into a 30 L small-scale industrial fermenter at a volume ratio of 1:1000 and fermented at a constant temperature of 37 °C. The fermentation medium was NB liquid medium with a pH of 6.5 - 7.0. During the fermentation process, the tank pressure was always maintained at 0.05 - 0.06 MPa, and the initial rotation speed of the fermenter was 150 rpm. When the dissolved oxygen in the fermenter was lower than 20%, the rotation speed was gradually increased to 700 rpm. After 16 h of fermentation, microscopic examination was carried out to observe the formation of bacterial spores, and the spore conversion rate was estimated by the five-point counting method. When the spore conversion rate reached more than 90%, the fermentation was stopped, the tank was emptied, and the bacterial liquid was counted. The concentration of the emptied bacteria was generally 100 - 150×10 9 CFU / mL. Then, the fermentation broth was spray-dried to prepare H-6 probiotic fermentation dry powder as the raw material of the probiotic preparation against PRRSV, and stored in a 4 °C refrigerator for later use.
[0060] 2. Preparation of Experimental Animal Facilities and Experimental Animals
[0061] One week before the start of the animal experiment, the animal experiment room was thoroughly cleaned and fumigated and disinfected for standby. Two days before the experiment, the experimental piglets were transported to the animal room. Ten healthy PRRSV-negative piglets at 40 days of age were randomly grouped and fed in the animal room for 2 days. The feeding status of the piglets was observed to ensure that each piglet could eat and drink normally.
[0062] 3. Animal experiment design
[0063] Ten PRRSV-negative pigs (40-day-old weaned piglets) were randomly divided into two groups, a control group and an experimental group, with 5 pigs in each group. The numbers of the 5 pigs in the control group were 131, 132, 133, 134, and 135 respectively, and the numbers of the 5 pigs in the experimental group were 41, 42, 43, 44, and 45. All animals were raised in an animal room that met the GMP animal experiment specifications. The control group was fed piglet feed without H-6 preparation; the experimental group was fed piglet feed containing H-6 preparation and ensured that each pig was fed 5×10 89 CFU live bacteria preparation; after 10 days of feeding, they were infected with the highly pathogenic PRRSV strain WH3 by nasal drip, and the infection dose was 10 4 TCID 50 , and the experimental grouping is shown in Table 2.
[0064] Table 2. Grouping of animal experiments on probiotic preparations against PRRSV infection
[0065]
[0066] 4. Effects of Bacillus amyloliquefaciens preparation on the clinical morbidity of PRRSV-infected pigs
[0067] After PRRSV infection, the body temperature (rectal temperature) and body weight of the piglets were measured. At the same time, the clinical characteristics of the piglets after infection were observed and recorded, including appetite, mental state, body surface state, respiratory symptoms, and neurological symptoms, and scored according to the clinical indicators shown in Table 3. Among them, the score for a death case = total clinical score + 5 points = 20 points, and the clinical evaluation criteria are shown in Table 3. The results are shown in Table 4 and Figure 3 as shown. The clinical morbidity symptoms of the experimental group after infection were significantly lower than those of the infected pigs in the control group.
[0068] Table 3. Overall clinical symptom evaluation criteria for PRRSV-infected piglets
[0069]
[0070] Table 4. Clinical symptom scoring of PRRSV-infected piglets
[0071]
[0072] 5. Effects of Bacillus amyloliquefaciens preparation on the mortality rate of PRRSV-infected pigs
[0073] After PRRSV infection, the health status of pigs was observed daily, and the clinical conditions of the infected pigs were recorded and clinically evaluated. The results are shown in Table 4: In the control group, 2 pigs died on the 14th day, 1 pig died on the 18th day, and 1 pig died on the 24th day, with a survival rate of 20%; no deaths occurred in the experimental group, and the survival rate was 100%.
[0074] 6. Effects of Bacillus amyloliquefaciens preparation on the body temperature of PRRSV-infected pigs
[0075] Starting from the 0th day after PRRSV infection, the body temperature of pigs was measured every other day until the 30th day. In the control group, the infected pigs began to die on the 14th day. The dead pigs were immediately dissected to observe the visceral lesions; after the experiment, all pigs in the experimental group were dissected to observe the visceral lesions.
[0076] The results are shown in Table 5 and Figure 5 as follows: In the control group, the body temperature of pig No. 131 reached 41°C on the 4th day after infection and remained above 40°C until it died on the 24th day; the body temperatures of pigs No. 132, 133, 134, and 135 all reached above 40°C on the 4th day after infection, and the body temperatures of pigs No. 133 and 134 reached above 41°C on the 6th day after infection. Then, pig No. 133 died on the 18th day after infection, and pig No. 134 died on the 14th day after infection; in the experimental group, pigs No. 41 and 42 began to show body temperatures above 40°C successively on the 8th day after infection. Among them, pigs No. 41 and 42 had a fever state of 41°C on the 10th and 12th days after infection, and then fluctuated between 40°C and 39°C and finally stabilized below 40°C, and no deaths occurred during this period.
[0077] Table 5. Effects of Bacillus amyloliquefaciens preparation on the body temperature of PRRSV-infected pigs
[0078]
[0079] 7. Effects of Bacillus amyloliquefaciens preparation on the body weight of PRRSV-infected pigs
[0080] Starting from the 0th day after PRRSV infection, the body weight of pigs was measured every other day until the 30th day. The results are shown in Table 6 and Figure 6 as follows: In the control group, the body weight of pigs increased slowly after infection. Pigs No. 131, 132, 133, and 134 all showed a stagnant body weight. Among them, pigs No. 133 and 135 died on the 24th and 16th days after infection respectively. Pigs No. 131 and 134 showed a decrease in body weight and died on the 18th and 14th days after infection respectively. Pig No. 132 had a slow increase in body weight but did not die; in the experimental group, except for pig No. 41 showing a decrease in body weight on the 16th day after infection, the body weights of the other pigs were in a slow growth state.
[0081] Table 6. Effects of Bacillus amyloliquefaciens preparation on the body weight of PRRSV-infected pigs
[0082]
[0083] 8. Determination of serum virus load of PRRSV-infected pigs with Bacillus amyloliquefaciens preparation
[0084] From the 0th day of PRRSV infection, the anterior vena cava blood of infected pigs was collected every 7 days. The serum was placed at 37°C for 2 h and then transferred to 4°C for 1 - 2 h. The precipitated serum was collected in a biosafety cabinet and centrifuged at 4000 r / min for 5 - 10 min in a 4°C centrifuge. The supernatant was collected, aliquoted, and stored in an -80°C refrigerator for subsequent detection of serum virus load.
[0085] The results are shown in Table 7 and Figure 4 as follows. The CT values of the serum of the control group pigs were all below 20 on the 7th day of infection. Among them, pig No. 131 died on the 24th day after infection, pig No. 133 died on the 20th day after infection, and pigs No. 134 and 135 died on the 14th day after infection; the virus load in the serum of the experimental group pigs was high from the 7th day after infection and then gradually decreased. The CT values of the serum of the experimental group pigs all reached above 30 on the 28th day of infection, and the average CT value of the serum was greater than 35 on the 42nd day of infection. No death occurred during the infection period.
[0086] Table 7. Effects of Bacillus amyloliquefaciens preparation on the virus load in the serum of PRRSV-infected pigs
[0087]
[0088] 9. Effects of Bacillus amyloliquefaciens preparation on the virus load of PRRSV-infected pigs' anal swabs
[0089] From the 0th day of PRRSV infection, the anal swabs of infected pigs were collected every two days for a total of 30 days. The content of PRRSV in the anal swabs was detected by the real-time fluorescence quantitative PCR method recommended in the national standard for porcine reproductive and respiratory syndrome detection in the People's Republic of China (GB / T 18090 - 2023).
[0090] The results are shown in Table 8 and Figure 7 as follows. The virus load of the anal swabs of the control group pigs was significantly higher than that of the experimental group pigs. The CT values of the experimental group generally fluctuated at the upper limit of 30, while the CT values of the anal swabs of the control group pigs were generally below 30, and pigs No. 131, 133, 134, and 135 died one after another.
[0091] Table 8. Effects of Bacillus amyloliquefaciens preparation on the virus load in the anal swabs of PRRSV-infected pigs
[0092]
[0093] 10. Effect of Bacillus amyloliquefaciens preparation on viral load in pharyngeal swabs of PRRSV-infected pigs
[0094] From the 0th day of PRRSV infection, pharyngeal swabs of infected pigs were collected every two days for a total of 30 days. The content of PRRSV in the pharyngeal swabs was detected using the real-time fluorescence quantitative PCR method recommended in the national standard for detecting Porcine reproductive and respiratory syndrome virus in the People's Republic of China (GB / T 18090-2023).
[0095] The results are shown in Table 9 and Figure 8 as follows. The viral load in the pharyngeal swabs of pigs in the control group was significantly higher than that in the experimental group. The CT values of the pharyngeal swabs of pigs in the control group were all below 30 from the 4th day after infection. The CT values of the experimental group began to decrease on the 6th day after infection and then gradually increased, and no deaths occurred during this period. Moreover, the pharyngeal swabs of pig No. 42 became negative on the 28th day after infection, and the pharyngeal swabs of pig No. 43 became negative on the 30th day after infection.
[0096] Table 9. Effect of Bacillus amyloliquefaciens preparation on viral load in pharyngeal swabs of PRRSV-infected pigs
[0097]
[0098] 11. Effect of Bacillus amyloliquefaciens preparation on viral load in nasal swabs of PRRSV-infected pigs
[0099] From the 0th day of PRRSV infection, nasal swabs of infected pigs were collected every two days for a total of 30 days. The content of PRRSV in the nasal swabs was detected using the real-time fluorescence quantitative PCR method recommended in the national standard for detecting Porcine reproductive and respiratory syndrome virus in the People's Republic of China (GB / T 18090-2023).
[0100] The results are shown in Table 10 and Figure 9 as follows. The viral load in the nasal swabs of pigs in the experimental group after infection was significantly lower than that in the control group. Moreover, the nasal swabs of pig No. 41 and pig No. 42 in the experimental group became negative from the 28th day after infection.
[0101] Table 10. Effect of Bacillus amyloliquefaciens preparation on viral load in nasal swabs of PRRSV-infected pigs
[0102]
[0103] 12. Effect of Bacillus amyloliquefaciens preparation on lung tissue lesions in PRRSV-infected pigs
[0104] After the blank control group died of PRRSV infection, it was immediately dissected; the pigs in the experimental group were dissected on the 42nd day after infection, and normal pigs of the same age that were not infected with PRRSV were dissected on the same day. Observe the lung lesions of the pigs, such as Figure 10As shown, there were obvious parenchymal lesions in the lungs of pigs in the PRRSV-infected control group, while there were no obvious abnormalities in the lungs of piglets in the experimental group fed with the H-6 probiotic preparation and the negative control group without challenge; there were no obvious lesions in the remaining organs. In summary, feeding the Bacillus amyloliquefaciens preparation can significantly reduce the degree of lung tissue and organ damage caused by PRRSV.
Claims
1. An isolated Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens ), with the deposit number of the Bacillus amyloliquefaciens being CCTCC NO: M 20242740.
2. The fermentation broth of Bacillus amyloliquefaciens H-6 according to claim 1, wherein the fermentation broth contains viable Bacillus amyloliquefaciens H-6 cells.
3. A compound, wherein the active ingredient of the compound comprises viable Bacillus amyloliquefaciens H-6 cells with the preservation number of CCTCC NO: M 20242740.
4. Use of the Bacillus amyloliquefaciens H-6 according to claim 1, the fermentation broth of Bacillus amyloliquefaciens H-6 according to claim 2, and / or the compound according to claim 3 in the preparation of a medicament for preventing porcine reproductive and respiratory syndrome virus infection.
5. Use of the Bacillus amyloliquefaciens H-6 according to claim 1, the fermentation broth of Bacillus amyloliquefaciens H-6 according to claim 2, and / or the compound according to claim 3 in the preparation of a medicament for reducing the sensitivity of cells to porcine reproductive and respiratory syndrome virus.
6. The application according to claim 5, wherein the cells are porcine-derived cells.
7. Use of the Bacillus amyloliquefaciens H-6 according to claim 1, the fermentation broth of Bacillus amyloliquefaciens H-6 according to claim 2, and / or the compound according to claim 3 in the preparation of a feed additive for pigs.
8. A pig feed, wherein the pig feed contains the Bacillus amyloliquefaciens H-6 according to claim 1, the fermentation broth of Bacillus amyloliquefaciens H-6 according to claim 2, and / or the compound according to claim 3.
Citation Information
Cited By
Bacillus compound preparation containing grape seed extract and application of bacillus compound preparation in preparation of medicine for treating or preventing PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) infection
CN122140826A