Space transcriptome chip captured by ultrahigh-density probe as well as preparation method and application of space transcriptome chip

Abstract

The invention relates to a preparation method of a space transcriptomics chip captured by an ultrahigh-density probe, the chip prepared by the preparation method, and application of the chip in sample nucleic acid molecule detection. The whole solid substrate is fully modified with DNA probes, including poly T probes and probes with TSO information, so that the probe density of the chip can be improved, the gene detection efficiency and resolution are improved, and a space transcriptome technology which is simple in experimental process, low in cost and high in throughput is obtained; the spatial position information of the gene can be obtained while the gene expression level can be detected in a high-throughput manner.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, relates to spatial omics, and particularly to a spatial transcriptomics chip captured by ultra-high density probes, and a preparation method and application thereof. Background Art

[0002] Spatial transcriptomics is a technology used to study gene expression in tissues and cells. Unlike traditional transcriptomics methods, spatial transcriptomics can not only measure the expression level of genes, but also determine the specific location of these genes in the tissue. This technology allows researchers to map gene expression within the spatial range of the tissue, thereby understanding the location of different cell types in the tissue and their gene expression patterns at specific spatial locations. By combining spatial information with gene expression data, researchers can have a more comprehensive understanding of the interactions between cells, the structure and function of tissues. Spatial transcriptomics has a wide range of applications in biomedical research, especially in fields such as cancer research and tissue development. It provides a powerful tool for studying complex tissue structures and cell interactions, and helps to gain a deeper understanding of the spatial level of biological processes.

[0003] At present, the technologies for spatial transcriptome research on the market can be divided into two categories: one is based on imaging, including in situ sequencing ISS (In Situ Sequencing) and in situ hybridization (In situ hybridization). In situ sequencing includes FISSEQ (Fluorescent In Situ Hybridization followed by Sequencing) and STARmap (spatially-resolved transcript amplicon readout mapping). Its principle is to obtain the corresponding gene information by in situ imaging and sequencing of mRNA in cells; in situ hybridization technology includes SMFISH (Single Molecule Fluorescent In Situ Hybridization) and MERFISH (Multiplexed Error-Robust Fluorescence in situ Hybridization). Its principle is to obtain the corresponding gene information by hybridizing the corresponding fluorescent probes to the mRNA molecules in cells and then imaging under a microscope. The advantages of imaging-based technology are high detection efficiency and resolution, but the experiments are often more complicated, the cost is higher, the throughput is lower, and it is difficult to conduct large-scale data analysis; the other is based on high-throughput sequencing, and representative technologies include 10X Visium, HDST, Slide-seq, etc., the principle is to modify DNA probes with known barcode information on a solid matrix, use these probes to capture and reverse transcribe the RNA in the tissue cells that need to be studied, then perform the second-generation sequencing library construction step, and sequence on the machine to obtain the corresponding gene information; the advantages of sequencing-based technology are simple operation and high throughput, but due to the gaps between the modified DNA probes, there are certain limitations on resolution.

[0004] Imaging-based spatial transcriptome technology often has a complex experimental process, high cost, low throughput, and difficulty in large-scale data analysis; spatial transcriptome technology based on high-throughput sequencing has a relatively low gene detection efficiency, and due to the spacing between modified DNA probes, the resolution is limited to a certain extent. Taking 10X visium as an example, Figure 1 As shown, the modified DNA probe area size is 55 μm, and the center areas of the two clusters of DNA probes are separated by 100 μm, so that there is a 45 μm blank area between the two clusters of DNA probes, which leads to a certain degree of limitation in resolution. Summary of the invention

[0005] Based on this, the purpose of the present invention is to provide a spatial transcriptomics chip captured by ultra-high density probes and a preparation method and application thereof.

[0006] The first aspect of the present invention provides a method for preparing a spatial transcriptomics chip captured by ultra-high density probes, comprising the following steps:

[0007] S1. Two primers are modified on a solid substrate, wherein the two primers are a poly T primer for generating a poly T probe and a bridge amplification primer;

[0008] S2. Loading the synthesized library onto the surface of the solid substrate, performing bridge amplification with the bridge amplification primer, and generating a DNA chain on the solid substrate; the composition of the library from 5' to 3' is: amplification primer 1, adapter 1, barcode, barcode sequencing primer, amplification primer 2, the amplification primer 1 has the same base composition as one of the bridge amplification primers, and the amplification primer 2 has a base that is complementary to another one of the bridge amplification primers by at least 50%;

[0009] S3. Sequencing the barcode to obtain corresponding base information, and sequencing to obtain spatial position information;

[0010] S4. By using a template switching primer with a TSO sequence and a unique molecular marker UMI, a TSO sequence and a unique molecular marker UMI are added to the DNA chain to generate a TSO probe cluster with a TSO sequence and a unique molecular marker UMI on a solid substrate;

[0011] And the chip is obtained by extending the poly T primer or connecting the poly T probe cluster.

[0012] In some embodiments, the poly T primer or the primer for bridge amplification is modified with a chemical group. The modified chemical group can be used to cut the chemical structure in sequencing detection to obtain a free cDNA chain. The chemical group can be a diol modification (-diol), deoxyuracil (DeoxyUridine, dU), deoxyguanosine (8-Oxo-2'-deoxyguanosine), etc.

[0013] In some embodiments, the amplification primer 2 is at least 60%, or at least 70%, or at least 80%, or at least 90% complementary to a modified bridge amplification primer on the solid substrate, and most preferably is completely complementary.

[0014] In some of the embodiments, at least one flow channel is provided on the solid substrate, and preferably, two or more flow channels are provided.

[0015] In some embodiments, the number of consecutive T bases in the poly T is 10-50, further can be 10-40, or 10-35, or 15-35, or 20-35, or 20-30.

[0016] In some embodiments, the sequencing in step S3 is performed by Sanger sequencing, NGS sequencing, nanopore sequencing, etc., preferably NGS sequencing, single-end sequencing, preferably SE50 sequencing.

[0017] In some embodiments, the molar ratio of the polyT primer modified on the solid matrix to the bridge amplification primer is 1-10:1, preferably 2-8:1, and more preferably 4-6:1.

[0018] The second aspect of the present invention is to provide a spatial transcriptomics chip captured by ultra-high density probes obtained by any of the above preparation methods.

[0019] The spatial transcriptomics chip of the present invention comprises a solid matrix, on which a polyT probe cluster and a TSO probe cluster are fixed. The TSO probe is formed by amplifying a DNA chain generated by a bridge amplification primer fixed on the solid matrix and a library, and then extending or connecting with a primer of a template conversion TSO sequence and a unique molecular marker UMI.

[0020] The third aspect of the present invention is to provide the application of the spatial transcriptomics chip captured by the ultra-high density probes in high-throughput sequencing. For example, it can be applied to detect gene expression in a sample and obtain corresponding spatial position information.

[0021] A fourth aspect of the present invention is to provide a method for detecting nucleic acid molecules in a sample, comprising the following steps:

[0022] S1) obtaining any of the above-mentioned ultra-high density probe-captured spatial transcriptomics chips;

[0023] S2) Permeabilizing the tissue to be captured in the sample to be tested so that the mRNA is released from the tissue to the chip surface, hybridizing with the poly T probe on the chip surface, reversely transcribing to obtain cDNA with a TSO complementary sequence, and bridge amplifying the cDNA with the TSO probe to obtain cDNA fixed on a solid matrix with a barcode with spatial position information and information of a unique molecular marker UMI;

[0024] S3) obtaining free cDNA;

[0025] S4) PCR amplification, library construction, and next-generation sequencing to obtain the nucleic acid results of the samples.

[0026] In some of the embodiments, the tissue to be captured may be at least one of nucleic acid molecules from any organism such as viruses, bacteria, cells, etc., or an independent nucleic acid molecule.

[0027] In some specific embodiments, the nucleic acid molecule is an RNA fragment, and further is an mRNA. Since mRNA generally has a polyA tail, the base T in the poly T probe can be used to achieve specific binding to the mRNA.

[0028] In some embodiments, the sample is a tissue section; it can be derived from animal cells or plant cells, or a tissue sample formed by viruses or bacteria, and the tissue of the tissue sample can be living tissue, living tissue cultured in vitro, or a single cell. It is understood that the tissue can also be an organoid tissue formed by one or more tissues or cells.

[0029] In some embodiments, free cDNA can be obtained by breaking the chemical groups in the primers fixed on the solid matrix and recovering them to obtain free cDNA chains.

[0030] In some embodiments, free cDNA can be obtained by using the amplification primer at the 3' end of cDNA or the complementary sequence of adapter 1 to hybridize with the cDNA chain to synthesize the second chain, then denaturing the second chain and recovering the free cDNA chain.

[0031] The present invention can improve the probe density and thus improve the gene detection efficiency and resolution by modifying the entire solid matrix with a full DNA probe cluster, including a poly T probe cluster and a probe cluster with TSO information. The polyT probe captures mRNA and reverse transcribes it to generate cDNA, which is then hybridized with the TSO probe through the TSO complementary sequence, and then bridge amplification is performed to enable the cDNA to obtain spatial position information and a unique molecular marker; by designing a sequence to achieve a bridge amplification method, the DNA chain that originally did not carry spatial position information and a unique molecular marker obtains the corresponding information, thereby obtaining a spatial transcriptome technology with a simple experimental process, low cost, and high throughput, which can detect the gene expression level with high throughput while obtaining its spatial position information. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram of the modified DNA probe region in the 10X visium spatial transcriptome.

[0033] Figure 2 Schematic diagram of the structures of two primers modified on a solid matrix.

[0034] Figure 3 It is a schematic diagram of the library structure.

[0035] Figure 4 It is a schematic diagram of the process of obtaining spatial position information by sequencing during chip production.

[0036] Figure 5 is a schematic diagram of the structure of the probes generated on the chip.

[0037] Figure 6 Schematic diagram of the RNA capture process during sample detection.

[0038] Figure 7 It is a schematic diagram of obtaining free cDNA during sample testing.

[0039] Figure 8 This is a schematic diagram of the results of detecting polyT and TSO probes after the ultra-high density probe capture chip is manufactured, wherein A: modified TSO probe, B: modified polyT primer.

[0040] Fig. 9 This is a schematic diagram of the results obtained by analyzing the tissue transcriptome captured using a chip, where A: the median number of genes captured by the mouse brain tissue slices used is 11,404; B: the median number of genes captured by the mouse brain tissue on the 10X genomics official website at the same resolution is 4,426. DETAILED DESCRIPTION

[0041] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0042] The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions, such as the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, published in 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0043] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0044] Definitions To facilitate understanding of this technology, certain terms and phrases are defined below.

[0045] The "solid phase carrier" or "solid matrix" or "substrate" all refer to the same product, which refers to any insoluble substrate or matrix to which nucleotide molecules can be attached, such as latex beads, dextran beads, polystyrene surfaces, polypropylene surfaces, polyacrylamide gels, gold surfaces, glass surfaces and silicon wafers. The solid phase carrier can be a flat glass surface. The solid phase carrier can include a flow channel, which can be at least one, or two or more. The solid phase carrier can also be installed inside a circulation pool to allow various reagent solutions to interact. This solid phase carrier constitutes the substrate of the chip.

[0046] The term "barcode" refers to any unique non-naturally occurring nucleic acid sequence that can identify the origin of a nucleic acid fragment. The barcode sequence provides high-quality individual reads of the barcode associated with, for example, DNA, RNA, cDNA, cells, or nuclei, thereby enabling sequencing of multiple species together.

[0047] Any suitable sequence can be used as the "barcode" of the present invention. A suitable sequence means that the spatial barcode domain does not interfere with (i.e., inhibit or distort) the interaction between the RNA of the tissue sample and the capture domain of the "barcode". For example, the design of the "barcode" should make the nucleic acid molecules in the tissue sample not specifically or substantially hybridize with the "barcode" or its complementary part. The "barcode" can be composed of 5-30 nucleotides, and can further be 10 to 25 nucleotides, 10 to 20 nucleotides, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides.

[0048] TSO: Template switch oligo, template switching oligonucleotide, is an oligonucleotide that is added to the 5 end of the non-template chain by reverse transcriptase during the reverse transcription process for downstream cDNA amplification. It is used to introduce a specific sequence tag during the reverse transcription process.

[0049] The principle of complementary base pairing is the phenomenon that the bases of each nucleotide residue form hydrogen bonds according to a specific corresponding relationship1. For example, adenine (A) pairs with thymine (T), guanine (G) pairs with cytosine (C), and in RNA, thymine is replaced by uracil (U), and adenine pairs with uracil. Herein, the bases of the amplification primer 2 in the library can be complementary to the bases of a bridge amplification primer modified on the solid matrix for at least 50%, or 60%, or 70%, or 80%, or 90%. The most preferred is a complete complementary pairing. If the number of bases occupied is not specifically specified, it is generally a complete complementary pairing (100%).

[0050] Bridge amplification is mainly used in fields such as DNA library construction and genome sequencing. The basic process of bridge PCR amplification includes the following:

[0051] First amplification: Using the single-stranded DNA adsorbed on the Flowcell (chip) as a template, dNTPs and DNA polymerase are added to generate complementary chains.

[0052] Melting: Add NaOH solution to melt the DNA, wash away the unfixed template strand, and leave the single strand fixed on the Flowcell.

[0053] Bridge formation: Add a neutral solution to allow the other end of the newly generated single strand to complementarily pair with another primer (P7') on the Flowcell to form a bridge structure.

[0054] Second amplification: Using the bridge-shaped single strand as a template, add dNTP and DNA polymerase to extend from the P7' primer to the P5' primer to generate double-stranded DNA.

[0055] Repeat the cycle: Repeat the above steps continuously, and after about 30 rounds of amplification-denaturation cycles, a monoclonal DNA cluster of 1000 copies is finally formed.

[0056] In some embodiments of the present invention, a method for preparing a spatial transcriptome chip captured by ultra-high density probes and a detection method using the chip are provided, comprising the following steps:

[0057] S1. Primer modification: Modify primers on a solid substrate, see Figure 2 The primers are mainly divided into two categories. One type of bridge amplification primers (two sequences, i.e., two sequences of different compositions) are used for bridge amplification of sequencing libraries, and the other type of primers are used to generate poly T probes for capturing mRNA. This type of primer can be a DNA primer directly containing a poly T sequence, or a fixed sequence primer. In the subsequent processing process, a poly T probe is generated by connection or extension, which is named poly T primer; wherein the molar ratio of the poly T primer modified on the solid matrix to the bridge amplification primer is 1-10:1.

[0058] S2. Library synthesis. The sequence of the synthetic library mainly includes the following features: the 5' end sequence (amplification primer 1) has the same base composition as a bridge amplification primer modified on the solid substrate, and the 3' end sequence (amplification primer 2) matches another bridge amplification primer modified on the solid substrate. The matching refers to complementary pairing, such as 50%, 60%, 70%, 80%, 90% or more base complementary pairing, or completely complementary pairing. As long as it can amplify the target sequence as a primer, it is preferably more than 90% complementary pairing or completely complementary pairing. Bridge amplification is performed after the library is loaded onto the surface of the solid substrate; the library has the following composition: from 5' to 3', it is: amplification primer 1, adapter 1, barcode, barcode sequencing primer, amplification primer 2, see Figure 3 The connector 1 region is used for subsequent sequencing, the barcode sequencing primer region is used to sequence the barcode region, and the barcode region (Spatial Barcode) is used to obtain spatial position information in spatial transcriptome data.

[0059] S3. Sequencing to obtain spatial position information: Sequencing the barcode region to obtain the corresponding base information, thereby extracting the position information of the region on the solid matrix. First, the library synthesized in the second step is loaded onto the surface of the solid matrix, followed by bridge amplification. At this time, the synthesized library will continue to hybridize and extend with the modified bridge amplification primers on the solid matrix. After amplification, the barcode sequencing primer region is used as a primer to sequence the barcode to obtain spatial position information, see Figure 4 .

[0060] S4. Probe generation: After sequencing is completed, the amplified DNA chain is added with the template-switching primer TSO sequence (template-switching oligo) and the unique molecular identifier UMI (unique molecular identifiers) sequence at the 3' end by DNA ligation or DNA hybridization extension, and finally a complete TSO probe with the TSO sequence and the unique molecular identifier UMI is generated; the poly T sequence is extended or connected to the poly T generating primer to generate a polyT probe. The poly T probe is used to capture the mRNA molecules in the cell for reverse transcription to obtain cDNA, the TSO sequence is used for template conversion with the cDNA product subsequently reverse transcribed, and the UMI sequence is used to count the number of captured gene copies. See Figure 5 .

[0061] S5. RNA capture: The tissue to be captured is attached to the solid matrix with generated probes, and the mRNA is released from the cells to the chip surface through permeabilization. The polyA tail is hybridized with the probe with poly T sequence on the surface of the solid matrix, and then reverse transcribed to obtain the cDNA part; because the reverse transcription process will add TSO complementary sequence to the 3' end of cDNA, the 3' end of cDNA will produce complementary pairing with the probe containing TSO sequence on the solid matrix after the reverse transcription is completed, and then the bridge amplification process is carried out to make the TSO sequence probe extend the captured cDNA part to form a bridge-like structure. The cDNA reverse transcribed from the PolyT probe originally does not carry the barcode with spatial location information and the unique molecular marker of gene copy number counting. Through bridge amplification, the cDNA obtains the corresponding labeling information. See Figure 6 .

[0062] In order to facilitate the capture of the target substance by the probe, the target substance in the sample is released by permeabilization. The method of permeabilizing the sample can be chemical treatment, heat treatment, ultrasonic treatment, enzyme treatment, hypotonic treatment, etc., so as to release the target substance from the sample.

[0063] S6. cDNA chain acquisition, library construction, and next-generation sequencing: After the above steps, the cDNA chain is fixed on the solid matrix. In order to obtain the cDNA chain for the subsequent library construction steps, it can be carried out by but not limited to the following methods: In the first step of primer modification, a related chemical structure is introduced at the 5' end of the modified primer (polyT primer or bridge amplification primer), and the chemical structure is cut to obtain a free cDNA chain, see Figure 7 A; You can also use the amplification primer at the 3' end of the cDNA or the complementary sequence of adapter 1 to hybridize with the cDNA chain and then synthesize the second chain, see Figure 7 B, then the second strand is denatured and recovered to obtain free cDNA strands. After the cDNA strands are recovered, conventional libraries are constructed and sequenced.

[0064] The present invention is further described in detail below with reference to specific embodiments.

[0065] Example 1

[0066] The ultra-high density capture chip manufacturing method of this embodiment includes the following steps:

[0067] S1. The transcriptome capture chip can be made based on the substrate of the sequencing chip. The following sequence primers were synthesized at Sangon Biotechnology Co., Ltd. After obtaining the primers, they were diluted to 100 μM with TE buffer according to the volume marked on the centrifuge tube, and then 20 μL of the primers were dissolved in 180 μL of PBS solution. The final concentration of the primers in this embodiment is 10 μM, and 1-10 μM can actually be used; the 5' end of SEQ ID NO: 1 is modified with a DBCO (dibenzocyclooctyne) group.

[0068] The poly T primer used to generate the poly T probe is SEQ ID NO: 1:

[0069] 5'DBCO-AATGATACGGCGACCACCGAGATCTACACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, wherein V refers to a nucleotide selected from the bases A, C, and G, and N refers to a nucleotide selected from the bases A, T, C, and G.

[0070] Then, a sequencing chip substrate (with bridge amplification primers fixed thereon) was taken out from the Salus Pro sequencing reagent set (SRM-SE50). The sequencing chip substrate had two flow channels (flow slots) in total. 100 μL of the above primer solution was added to each flow channel, which was sealed and placed in a 37°C-55°C oven for reaction for 12-16 hours. After the reaction was completed, the bridge amplification primer and the poly T primer were modified on the chip substrate. A solid phase carrier (chip) modified with two primers (bridge amplification primer and poly T primer) was obtained, wherein the molar fixed amount ratio of the polyT primer to the bridge amplification primer was 5:1.

[0071] Bridge amplification primers (primer 1 and primer 2 are used in the same amount):

[0072] Primer 1: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 6);

[0073] Primer 2: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 7).

[0074] S2. The following library sequence (SEQ ID NO: 2) was synthesized at GenScript. The library structure is as follows (the 5' end sequence and the 3' end sequence are matched with the modified bridge amplification primer on the solid matrix). From the 5' end to the 3' end, they are amplification primer 1 (underlined area), adapter 1 (lowercase letter area), barcode (N sequence), barcode sequencing primer (italic part), and amplification primer 2 (dashed line underlined area); after obtaining the library, it was diluted to a concentration of 4pM-8pM. In this example, 4pM was used for the experiment. Then, the library was loaded onto the chip surface. Then, referring to the instructions of the Salus Pro Sequencing Reagent Set (SRM-SE50), the chip was subjected to SE50 sequencing on the Salus Pro sequencer to obtain the barcode information;

[0075] SEQ ID NO:2:

[0076] 5' CAAGCAGAAGACGGCATACGAGAT tctttccctacacgacgctcttccgatctNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATAT GTGTAGATCTCGGTGGTCGCCGTATCATT .

[0077] S3. After sequencing, add 100 μL of denaturing reagent to the chip and place it in an oven at 55°C for 10 min, then wash the chip with 200 μL of wash buffer; synthesize the following sequence primers (template switching primers, i.e. TSO probe generation primers SEQ ID NO: 3, and detection primers SEQ ID NO: 4) at Sangon Biotechnology, obtain the primers and dilute them to 100 μM with TE buffer according to the volume marked on the centrifuge tube, take 2 μL of SEQ ID NO: 3 primer solution and mix it with 198 μL of 3XSSC, then add it to the above chip and react at 37°C for 30 min. Prepare phi29 (NEB) reaction solution, 10 μL 10X phi29 DNA polymerase reaction buffer, 5 μL phi29 DNA polymerase, 5 μL dNTP mix, 80 μL ddH2O, add it to the above chip after the previous step, then react in an oven at 30°C for 30 min. A spatial transcriptomics chip was obtained by generating ultra-high-density probe capture of TSO probes and poly T probes with TSO sequences and unique molecular markers UMI on a solid matrix.

[0078] After the reaction is completed, the TSO sequence probe has been generated, and its generation status is tested. Add 100μL of denaturing reagent to the chip, place it in an oven at 55℃ for 10 minutes, and then wash the chip with 200μL wash buffer; take 2μL of SEQ ID NO:4 primer solution and mix it with 198μL of 3XSSC, add it to the chip and react at 37℃ for 30 minutes. After completion, place the chip on the Salus Pro sequencer to scan and take pictures. If many bright spots can be observed in the photos, it means that the TSO sequence probe has been successfully generated. Figure 8 As shown in A.

[0079] Template-switching primers with TSO sequence (template-switching oligo) (underlined part) and unique molecular identifier UMI sequence (italic part), i.e., TSO probe generation primers:

[0080] SEQ ID NO: 3:

[0081] 5' TCTGCTGAGTCTGCTGAGTCGAGAACGTCTC NNNNNNNNNNAATGATACGGCGACCACCGAGATCTACAC.

[0082] SEQ ID NO:4: 5'cy5-TCTGCTGAGTCTGCTGAGTCGAGAACGTCTC.

[0083] The results are as follows Figure 8 As shown: The polyT primer modified in step S1 is detected at the same time. If the primer modification is successful, the fluorescent signal can be observed in the entire area ( Figure 8 B) Figure 8 As shown in B, all regions on the chip have been modified with polyT primers that can be used for subsequent mRNA capture. Figure 1 Take the 10X visium technology as an example. Figure 1 The chip in the present invention is modified with polyT capture probes only in the circular area, with obvious intervals in the middle. The probe density of the chip produced by the present invention is significantly improved compared with other technologies.

[0084] Example 2: Ultra-high density capture chip captures tissue mRNA

[0085] 1. Referring to the instructions for the Salus spatial transcriptome reagent, tissue patching, tissue permeabilization, reverse transcription reaction, and tissue digestion were completed in sequence on the ultra-high density capture chip prepared by the preparation method in Example 1. At this time, the polyT probe has captured mRNA and reversely transcribed cDNA and added the TSO complementary sequence. Subsequently, 100 μL of denaturation reagent was added to the tissue reaction area, and the reaction was carried out in an oven at 45°C for 10 minutes to convert the cDNA chain into a single-stranded state; after denaturation, the tissue reaction area was cleaned with 100 μL of 0.1XSSC solution, and 100 μL of amplification reagent (Salus) was added, and the reaction was carried out in an oven at 45°C for 10 minutes to perform bridge amplification. The cDNA with the TSO complementary sequence will hybridize with the TSO probe and begin to extend; after completion, the above-mentioned denaturation, cleaning, and amplification steps were repeated 3 times.

[0086] 2. The following primers were synthesized at Sangon Biotechnology Co., Ltd. After obtaining the primers, they were diluted to 100 μM with TE buffer according to the volume marked on the centrifuge tube, and phi29 (NEB) reaction system was prepared, including 10 μL 10Xphi29 DNA polymerase reaction buffer, 5 μL phi29 DNA polymerase, 5 μL dNTP mix, 5 μL SEQ ID NO: 5 primer, and 70 μL ddH2O. The primers were added to the tissue reaction area to synthesize the second-strand cDNA, and the reaction was carried out in an oven at 30°C for 1h-2h. Subsequently, the second-strand cDNA was recovered to obtain free cDNA chains, PCR amplification, library construction, and second-generation sequencing were performed according to the instructions of the Salus spatial transcriptome reagent.

[0087] Amplification primer: SEQ ID NO: 5: 5'AATGATACGGCGACCACCGAGATCTACAC.

[0088] The tissue slices used in this example are mouse brain tissue slices.

[0089] The sequencing data were aligned using the Salus spatial transcriptome analysis pipeline. The results are shown in Fig. 9 As shown in A, the median number of genes captured by the mouse brain tissue slices used in this example is 11404, and the mouse brain tissue example data on the 10X genomics official website is used as a reference ( Fig. 9 B), the median number of captured genes at the same resolution is 4426, so the spatial transcriptome method based on ultra-high density probe capture described in the present invention can significantly increase the gene capture amount.

[0090] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A method for preparing a spatial transcriptomics chip captured by ultra-high density probes, characterized in that: The following steps are involved: S1. Two primers are modified on a solid substrate, wherein the two primers are a poly T primer and a bridge amplification primer for generating a poly T probe; S2. loading the synthesized library onto the surface of the solid substrate, performing bridge amplification with the bridge amplification primer, and generating a DNA chain on the solid substrate; The composition of the library from 5' to 3' is: amplification primer 1, adapter 1, barcode, barcode sequencing primer, amplification primer 2; the base composition of amplification primer 1 is the same as one of the bridge amplification primers, and amplification primer 2 has bases that are complementary to another of the bridge amplification primers by at least 50%; S3. Sequencing the barcode to obtain corresponding base information, and sequencing to obtain spatial position information; S4. By using a template switching primer with a TSO sequence and a unique molecular marker UMI, a TSO sequence and a unique molecular marker UMI are added to the 3' end of the DNA chain to generate a TSO probe cluster with a TSO sequence and a unique molecular marker UMI on a solid substrate; And the chip is obtained by extending or connecting the poly T primer to a poly T probe cluster.

2. The preparation method according to claim 1, characterized in that: The poly T primer or the primer for bridge amplification is modified with a chemical group; the chemical group is preferably dibenzocyclooctyne, thiol, or amino.

3. The preparation method according to claim 1, characterized in that: The solid substrate is provided with at least one flow channel, preferably, two or more flow channels.

4. The preparation method according to claim 1, characterized in that: The number of consecutive T bases in the poly T primer is 10 to 50, preferably 15 to 30.

5. The preparation method according to claim 1, characterized in that: The sequencing in step S3 is NGS sequencing, and more preferably SE50 sequencing is used.

6. The preparation method according to any one of claims 1 to 5, characterized in that: The molar ratio of the polyT primer modified on the solid matrix to the bridge amplification primer is 1-10:1, preferably 2-8:1, and more preferably 4-6:

1.

7. A spatial transcriptomics chip captured by ultra-high density probes obtained according to any one of the preparation methods of claims 1-6.

8. Use of the spatial transcriptomics chip captured by ultra-high density probes according to claim 7 in high-throughput sequencing.

9. A method for detecting nucleic acid molecules in a sample, characterized in that: The following steps are involved: S1) obtaining a spatial transcriptomics chip captured by ultra-high density probes according to any one of claims 1 to 6; S2) permeabilizing the tissue to be captured in the sample to be tested so that mRNA is released from the tissue to the surface of the chip, hybridizing with the poly T probe on the surface of the spatial transcriptomics chip, reversely transcribing to obtain cDNA with a TSO complementary sequence, and bridge amplifying the cDNA with the TSO probe on the surface of the spatial transcriptomics chip to obtain cDNA fixed on a solid matrix with a barcode with spatial position information and information of a unique molecular marker UMI; S3) obtaining free cDNA; S4) PCR amplification, library construction, and next-generation sequencing to obtain the nucleic acid results of the samples.

10. The detection method according to claim 9, characterized in that: The sample to be tested is a tissue section.

11. The detection method according to claim 9, characterized in that: The method for obtaining free cDNA comprises: breaking the chemical groups in the modified primers on the solid matrix of the chip, recovering and obtaining free cDNA chains.

12. The detection method according to claim 9, characterized in that: The method for obtaining free cDNA includes: using the amplification primer at the 3' end of cDNA or the complementary sequence of adapter 1 to hybridize with the cDNA chain to synthesize a second chain, then denaturing the second chain, and recovering the free cDNA chain.

Images