DNA bar code for identifying Dabie Mountain polygonatum kingianum and polygonatum odoratum and application thereof

Abstract

The invention relates to the technical field of molecular markers, in particular to a DNA bar code of Dabie Mountain polygonatum kingianum and application of the DNA bar code. The DNA bar code disclosed by the invention is as shown in SEQ ID NO.1-3. The Dabie Mountain polygonatum kingianum can be identified by adopting the DNA bar code, and the method specifically comprises the following steps: extracting total DNA from a sample, then carrying out high-throughput sequencing, comparing sequencing reads to the molecular marker, and if the molecular marker can be completely covered, judging that the species of the sample to be detected is the corresponding species.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a DNA barcode of a plant of the genus Polygonatum, and specifically to a DNA barcode for identifying Polygonatum cyrtonema from Dabie Mountains. Background Art

[0002] Dabieshan Polygonatum (Polygonatum dabieshanensis BXHan,SYYi & XWSong) is mainly produced in the Dabie Mountain area of ​​Anhui Province and Henan Province. It is a recently identified new species of the genus Polygonatum. It grows on the edge of the forest and under the forest, at an altitude of 150-1100m. This species is similar to Polygonatum odoratum (Mill.) Druce, but the difference is that the rhizome of Polygonatum odoratum is often white and 0.5-1.0cm, while the rhizome of this species is often yellow and 1.0-2.0cm; the aboveground stem of Polygonatum odoratum has edges and oblong leaves, while the aboveground stem of this species is round and the leaves are oval; the racemes of Polygonatum odoratum have 1-5 flowers, while the racemes of this species have 1-3 flowers; the perianth of Polygonatum odoratum is white-green, while the perianth of this species is green-white. Although the two have some phenotypic differences, due to the overlap of their habitats and the influence of the environment, their phenotypes often converge, and they are often mixed with Polygonatum odoratum for medicinal purposes in the Dabie Mountains. Even professionals still find it difficult to clearly identify them through phenotype. In addition, other species of the genus Polygonatum are distributed in the region, including Polygonatum multiflorum, Polygonatum pratense, Polygonatum chinense, and Polygonatum hupehensis. Some of these species are also phenotypically similar to those of Polygonatum dabieshanense, which affects the identification of Polygonatum dabieshanense. Summary of the invention

[0003] The present invention mainly aims at the above technical problems, provides a simple molecular marker method to realize the identification of Dabie Mountain Polygonatum, and specifically provides a DNA barcode for identifying Dabie Mountain Polygonatum and its application.

[0004] Specifically, the present invention provides the following technical solutions: In a first aspect, the present invention provides a DNA barcode molecular marker of Polygonatum dabieshanense, wherein the sequence of the DNA barcode is shown as SEQ ID NO.1 to SEQ ID NO.3.

[0005] The present invention utilizes a high-throughput sequencing method to assemble contigs sequences from the whole genome sequence of Dabie Mountain Polygonatum, and compares the sequences with the species of the genus Polygonatum published on NCBI. It is found that three sequences contain multiple variation sites, which are suitable as DNA barcodes for identifying Dabie Mountain Polygonatum.

[0006] On the other hand, another object of the present invention is to provide any of the following applications of the above-mentioned DNA barcode: (1) Application in identification of Dabieshan polygonatum; (2) Application in identification, improvement or molecular marker-assisted breeding of Polygonatum germplasm resources; (3) Application in the screening of hybrid breeding of Polygonatum sibiricum or in the creation of different Polygonatum sibiricum varieties; (4) Application in the DNA fingerprint database of Polygonatum spp.; (5) Application in the quality inspection of Polygonatum sibiricum seedlings.

[0007] In another aspect, the present invention provides a method for identifying Polygonatum dabieshanense, comprising: (1) Extracting DNA from the plant to be identified; (2) performing high-throughput sequencing on the total DNA to obtain sequencing reads; (3) aligning the reads described in step 2) to the molecular marker described in claim 1; (4) The species of the sample to be tested is determined based on the coverage of the sequencing reads on the DNA molecular markers. If any one of SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3 can be completely covered, and a consensus sequence that is completely consistent with any one of SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3 can be generated, then the species of the sample to be tested is determined to include Polygonatum dabieshanense.

[0008] Preferably, the high-throughput sequencing in step 2) is second-generation sequencing or third-generation sequencing.

[0009] Preferably, in step 3), any one of Geneious, Bowtie, Tophat, bwa or HISAT software is used to align reads.

[0010] On the other hand, the present invention provides another method for identifying Dabieshan Polygonatum, comprising: (1) Extracting DNA from the plant to be identified; (2) performing high-throughput sequencing on the total DNA to obtain sequencing reads; (3) Aligning the reads in step 2) to the aforementioned DNA barcodes, and assembling the aligned reads into contigs; (4) Performing a multiple sequence alignment of the assembled contigs with the aforementioned DNA barcodes. If one of the assembled contigs is consistent with any one of SEQ ID NO: 1, SEQ ID NO: 2, and / or SEQ ID NO: 3, then it is determined that the sample to be tested contains Dabieshan Polygonatum.

[0011] Preferably, the high-throughput sequencing in step 2) is second-generation sequencing or third-generation sequencing.

[0012] Preferably, in step 3), any one of Geneious, Bowtie, Tophat, bwa or HISAT software is used to align reads.

[0013] Preferably, if three of the contigs assembled in step 4) are consistent with SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively, then it is determined that the sample to be tested contains Dabieshan Polygonatum.

[0014] Preferably, in the aforementioned method, if the sample to be tested is a single sample, the sample to be tested is directly determined to be Dabieshan Polygonatum.

[0015] The single DNA barcode molecular marker of the present invention can effectively distinguish whether the tested variety is Dabieshan Polygonatum, providing a guarantee for the identification, planting, resource utilization and breeding of Dabieshan Polygonatum. It is also of great significance for the classification, phylogeny, and phylogenetic research of Polygonatum species, as well as the protection and utilization of Polygonatum resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The method for regulating plant resistance to salt stress and / or cultivating salt stress-resistant plant varieties and its beneficial effects of the present invention are described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0017] Figure 1 It is an alignment of the DNA barcode sequence SEQ ID NO.1 of Dabieshan Polygonatum with the known homologous sequences of Polygonatum odoratum.

[0018] Figure 2 It is an alignment of the DNA barcode sequence SEQ ID NO.2 of Dabieshan Polygonatum with the known homologous sequences of Polygonatum odoratum.

[0019] Figure 3 It is an alignment of the DNA barcode sequence SEQ ID NO.3 of Dabieshan Polygonatum with the known homologous sequences of Polygonatum odoratum.

[0020] Figure 4 This is the comparison result of the DNA barcode sequence SEQ ID NO.1 of Dabieshan Polygonatum in the nr / nt database.

[0021] Figure 5 This is the comparison result of the DNA barcode sequence SEQ ID NO.2 of Dabieshan Polygonatum in the nr / nt database.

[0022] Figure 6 This is the comparison result of the DNA barcode sequence SEQ ID NO.3 of Dabieshan Polygonatum in the nr / nt database.

[0023] Figure 7It is the alignment result of DNA sequencing reads containing Dabieshan Polygonatum on SEQ ID NO.1.

[0024] Figure 8 It is the alignment result of DNA sequencing reads containing Dabieshan Polygonatum on SEQ ID NO.2.

[0025] Figure 9 It is the alignment result of DNA sequencing reads containing Dabieshan Polygonatum on SEQ ID NO.3.

[0026] Figure 10 It is the alignment result of DNA sequencing reads that do not contain Dabieshan Polygonatum on SEQ ID NO.1.

[0027] Figure 11 It is the alignment result of DNA sequencing reads that do not contain Dabieshan Polygonatum on SEQ ID NO.2.

[0028] Figure 12 It is the alignment result of DNA sequencing reads that do not contain Dabieshan Polygonatum on SEQ ID NO.3. DETAILED DESCRIPTION

[0029] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Unless otherwise defined, all technical and scientific terms used in this application have the same meanings as commonly understood by those of ordinary skill in the art to which this application belongs. The Polygonatum plant samples used in the following examples can be obtained through commercial purchase or collected from the wild.

[0031] Example 1 Development of specific molecular markers of Dabieshan Polygonatum Dabieshan polygonatum (Polygonatum dabieshanensis BXHan, SYYi & XWSong) is mainly produced in the Dabie Mountain area of ​​Anhui Province and Henan Province, and grows on the edge of the forest and under the forest, with an altitude of 150-1100m. This species is similar to Polygonatumodoratum (Mill.) Druce, and other species of Polygonatum are distributed in the region, including Polygonatum multiflorum, Polygonatum pratense, Polygonatum jinzhaiensis, and Polygonatum hupehensis. The Dabieshan polygonatum of the present invention is collected from the Dabie Mountain area of ​​Anhui Province.

[0032] The specific molecular markers of Dabieshan Polygonatum, i.e. DNA barcodes, were obtained by the following steps: 1) Collect leaves of Polygonatum cyrtonema from Dabie Mountain; 2) Extraction of total DNA from leaves of Polygonatum cyrtonema; 3) Performing second-generation high-throughput sequencing on the above total DNA to obtain sequencing reads; 4) Assemble sequencing reads into contigs.

[0033] 5) Compare the nucleotide sequences with those of Polygonatum species on Genbank to screen for specific marker sites.

[0034] As a result, three fragments were obtained as shown in SEQ ID NO.1 to SEQ ID NO., and the three sequences had multiple polymorphic sites with the homologous nucleotide sequences of the genome of known Polygonatum species.

[0035] SEQ ID NO.1: 5'- TGGCCATACAATCGCTGTTCATAATGGAAAAGAACATTTACCTATTTATATAACAGATCGTATGGTAGGTCACAAATTGGGAGAATTCGCGCCTACTCTGACTTTCGCGAGACATGCGAGAAACGATAATAAATCTCGTCGTTAATTAATTTGGAAAAAAGGGAGCTATACCCAATATCTTGTTTTCATAAGAT ATTGGGTATGACTCCTTCAACGATTCTTAATACATATACATTAAGACGGAAATCTTATCCATTTATAGATGGAACTTCAACAGCAGCTAGGTCTAGAGGAAAGTTGTGAGCATTACGTTCATGCATTACTTCCATACCAAGGTTAGCACGGTTGATGATATCAGCCCAAGTGTTAATAACACGACCCTGACT-3' SEQ ID NO.2: 5'-TTCTTTATTTATTTTTTTTTTCCATACATTTAACATTTACCTATGATGAAAAAAAAAAAGGATCCCATTTTTTCCAATTTGAAAGTCTGAAGTGATCAGAGGGAACGGAGAGAGGGATTCGAACCCTCGGTACAAATAACTCGTACAACGGATTAGCAATCTGCCGCTTTAGTCCACTCAGCCATCTCT CCCAATTCAAAATTGCATTTTTTTTTATATGATGTGAAGTAAAAAGATTGAAACAAAAAAAAACTTCGTTTCTTTTTTTCAATCTTTATTAGTAATAATTTATTATAAGATAGGATAAAGTAACGATAATAATAAAAATATTAGAAAATAATATATTTGAATAATATATTCAAAACAAATTTGAAATTCTAT-3' SEQ ID NO.3: 5'- ACAAAAAGTATTATATTAATTTGATATTATTATATTAATTTTATATTATATATTTTCATTAATTAATTAATACTTAATGATACTAAGAAAAGTATACAAATTGTTAGAAAAATTACTTAAATTTAGTAATTGAATTGTGATACATATGAAATCCTATTTATTTTTTTTTTCGTTTAGAAAAAAAATCTCTTTGACAATTTAATTTGTTTTTCATTTATCTGATTTCGTGGA-3' The three sequences of Dabieshan Polygonatum were further compared with the homologous sequences of Polygonatum odoratum, which is the closest to it in phenotype. It was found that the three sequences were completely different from the known homologous sequences of Polygonatum odoratum ( Figures 1 to 3 ).

[0036] Example 2 Sequence comparison of specific molecular markers of Polygonatum dabieshanensis and closely related species In order to determine whether the molecular markers of the present invention are species specific, the molecular markers of the present invention were compared using the blast program of Geneious Prime, selecting the nr / nt library, not limiting the species, and keeping the other parameters as default. Figures 4 to 6 As shown, it was found that the closely related species of the molecular markers of the present invention in the nr / nt library of NCBI were all plants of the genus Polygonatum. Figure 4The highest consistency between the species compared with SEQ ID NO.1 and the known Polygonatum sequences is 98.4%. Figure 5 The molecular marker of SEQ ID NO.2 showed that the highest consistency between the species and the known Polygonatum sequence was 99.5%. Figure 6 The highest sequence identity of the known Polygonatum genus is 99.1%. It can be seen that the molecular markers of the present invention are different from all known Polygonatum species and have extremely strong specificity.

[0037] Example 3 Identification method of Dabieshan Polygonatum 1) Collect leaves of Polygonatum sibiricum plants as samples to be tested; 2) Extract the total DNA of the sample to be tested; 3) Perform second-generation high-throughput sequencing on the total DNA of the above two samples to obtain sequencing reads; Geneious software was used to align sequencing reads to SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and the maximum mismatch base and the maximum gap ratio were set to 1%.

[0038] 4) The species of the sample to be tested is determined according to the coverage of the sequencing reads on the DNA molecular markers. If any one of SEQ ID NO:1, SEQ ID NO:2 and / or SEQID NO:3 can be completely covered, and a consensus sequence that is completely consistent with any one of SEQ ID NO:1, SEQ ID NO:2 and / or SEQID NO:3 can be generated, then the species of the sample to be tested is determined to include Polygonatum dabieshanense.

[0039] Results Figures 7 to 9 As shown, the sequencing reads of the Dabie Mountain Polygonatum sample (mixed with the sequencing reads of the Dabie Mountain Polygonatum of the present invention and other known Polygonatum sequencing reads published on NCBI, the second-generation sequencing species of Polygonatum published by NCBI include Polygonatum acuminatifolium, Polygonatum arisanense, Polygonatum biflorum, Polygonatum binatifolium, Polygonatum campanulatum, Polygonatum caulialatum, Polygonatum cirrhifolium, Polygonatum curvistylum, Polygonatum cyrtonema, Polygonatum cyrtonema var. gutianshanicum, Polygonatum falcatum, Polygonatum filipes, Polygonatum franchetii, Polygonatum gracile, Polygonatum griffithii, Polygonatum hookeri, Polygonatum humile, Polygonatum hunanense, Polygonatum inflatum, Polygonatum infundiflorum, Polygonatum involucratum, Polygonatum kingianum, Polygonatum macropodum, Polygonatum multiflorum, Polygonatum nodosum, Polygonatum odoratum, Polygonatum oppositifolium, Polygonatum prattii, Polygonatum pubescens, Polygonatum punctatum, Polygonatum roseum, Polygonatum sibiricum, Polygonatum sinopubescens, Polygonatum sp. 'Guizhou', Polygonatum stenophyllum, Polygonatum tessellatum, Polygonatum verticillatum, Polygonatum wardii, Polygonatum zanlanscianense , ) completely covers SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, and generates a consensus sequence that is completely consistent with the reference sequence. Figures 10 to 12The data does not contain sequencing reads of Dabie Mountain Polygonatum samples (it only contains sequencing reads of other known Polygonatum genus including Polygonatum odoratum published on NCBI) and cannot cover SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3.

[0040] In summary, firstly, the present invention is a powerful supplement to traditional species identification, and the sample identification process can be automated and standardized, breaking through the excessive reliance on experience, and can use fresh or dried leaves of plants, such as specimen samples, for rapid and effective identification, and can establish an easy-to-use application system in a relatively short time. Secondly, the present invention can distinguish between Dabieshan Polygonatum and closely related species, and can stably and accurately identify Dabieshan Polygonatum and closely related species at a higher resolution level. Finally, the method of the present invention is of great significance for the classification, phylogeny, and phylogenetic research of Polygonatum species, as well as the protection and utilization of Polygonatum resources.

[0041] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A DNA barcode for identifying Dabieshan Polygonatum, characterized in that: The sequence of the DNA barcode is shown in any one of SEQ ID NO.1 to SEQ ID NO.

3.

2. Primers for amplifying the DNA barcode according to claim 1.

3. Any of the following uses of the DNA barcode according to claim 1 or the primer according to claim 2: (1) Application in identification of Dabieshan polygonatum; (2) Application in identification, improvement or molecular marker-assisted breeding of Dabieshan Polygonatum germplasm resources; (3) Application in screening or creating different varieties of Dabie Mountain Polygonatum; (4) Application in constructing a DNA fingerprint database of Dabieshan Polygonatum; (5) Application in the quality inspection of seedlings of Polygonatum cyrtonema in Dabie Mountains.

4. A method for identifying Dabieshan Polygonatum, characterized in that: include: (1) Extracting DNA from the plant to be identified; (2) performing high-throughput sequencing on the total DNA to obtain sequencing reads; (3) aligning the reads described in step 2) to the molecular marker described in claim 1; (4) The species of the sample to be tested is determined based on the coverage of the sequencing reads on the DNA molecular markers. If any one of SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3 can be completely covered, and a consensus sequence that is completely consistent with any one of SEQ ID NO:1, SEQ ID NO:2 and / or SEQ ID NO:3 can be generated, then the species of the sample to be tested is determined to include Polygonatum dabieshanense.

5. The method according to claim 4, characterized in that The high-throughput sequencing described in step 2) is second-generation sequencing or third-generation sequencing.

6. The method according to claim 4, characterized in that In step 3), use Geneious, Bowtie, Tophat, bwa or HISAT to align reads.

Images