A composite microbial agent for alleviating continuous cropping obstacles of traditional Chinese medicine crops and its application

Abstract

The present invention discloses a compound microbial agent for alleviating continuous cropping obstacles of traditional Chinese medicine crops and its application. The compound microbial agent of the present invention contains Bacillus amyloliquefaciens Y34, Serratia marcescens Y35, Bacillus amyloliquefaciens Y40 and Streptomyces SD; it can be applied to improve soil, eliminate diseases of Polygonatum odoratum, Pogostemon cablin and Cynanchum stauntonii, and promote crop growth. The compound microbial agent of the present invention can reduce soil-borne diseases during the planting process of traditional Chinese medicine, alleviate continuous cropping obstacles of traditional Chinese medicine, improve the yield and quality of traditional Chinese medicine, and has important application value especially in the cultivation and production of traditional Chinese medicine crops such as Polygonatum odoratum and Pogostemon cablin.

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural microorganisms, and particularly relates to a composite microbial agent for alleviating continuous cropping obstacles of traditional Chinese medicine crops and its application. Background Art

[0002] Continuous cropping obstacle refers to the phenomenon that when a single species is continuously planted in the same piece of land, although the planting conditions remain unchanged, the replanted crops show poor growth and development and a wide range of diseases. This phenomenon exists in many crops, especially traditional Chinese medicine crops. The continuous cropping obstacle causes a serious decline in the yield and quality of medicinal materials, and the limited arable soil ultimately hinders the development of the traditional Chinese medicine industry.

[0003] Current research indicates that continuous cropping mainly leads to a decline in soil nutrients and serious deterioration; the continuous accumulation of autotoxic substances secreted by plants in the soil inhibits plant growth; the content of soil pathogenic bacteria increases and the content of beneficial microbial populations decreases.

[0004] Polygonatum odoratum ( Polygonatum odoratum (Mill.) Druce) is an important bulk medicinal material in traditional Chinese medicine in China. Its main and authentic planting areas are in Hunan Province. However, due to the harm of continuous cropping obstacles, the planting area is continuously shrinking. According to the research on the continuous cropping obstacle of Polygonatum odoratum, the results show that the soil nutrients decline after continuous cropping, the content of phenolic acids increases, and the infection of various pathogenic fungi, especially Fusarium oxysporum, leads to tuber rot. Therefore, eliminating the influence of continuous cropping obstacles of Polygonatum odoratum and improving the reuse rate of Polygonatum odoratum planting land are of great significance for promoting the development of the Polygonatum odoratum industry. Pogostemon cablin ( Pogostemon cablin (Blanco)Benth.) is a representative medicinal material of southern medicine in China. It has a vast planting area in the south. However, Pogostemon cablin is also not suitable for continuous cropping, and large-scale and continuously spreading bacterial wilt often occurs during planting, seriously affecting the yield and quality.

[0005] In view of the above adverse effects, applying microbial flora externally is an effective and environmentally friendly measure. It can form a dominant microbial population together with the original beneficial microorganisms in the soil, promote the benign cycle of elements such as carbon, nitrogen, and potassium in the soil ecosystem, reduce the use of inorganic fertilizers; inhibit the accumulation of pathogenic bacteria in the soil and improve the soil immunity; degrade the autotoxic substances in the soil and promote plant growth, ultimately increasing the crop yield. Compared with traditional chemical pesticides, microbial fertilizers have no pesticide residues, so they are more suitable for traditional Chinese medicine crops with high requirements for pesticide residue detection, can effectively avoid excessive pesticide residues, and reduce the planting risk. In addition, the production cost of microbial fertilizers in agricultural production is moderate, which is conducive to farmers' acceptance. Therefore, developing efficient microbial fertilizers is an important direction for solving the problem of shortage of planting soil for traditional Chinese medicine and an important research field for green and efficient cultivation of traditional Chinese medicine. Summary of the Invention

[0006] The object of the present invention is to provide a composite microbial agent applicable to the green and efficient cultivation of Chinese medicinal materials, and to provide the application of the composite microbial agent in eliminating diseases of Chinese medicinal material crops such as Polygonatum odoratum and Pogostemon cablin, and promoting growth, reducing soil-borne diseases in the process of Chinese medicinal material cultivation, alleviating continuous cropping obstacles of Chinese medicinal materials, and improving the yield and quality of Chinese medicinal materials.

[0007] Bacillus amyloliquefaciens Y34 of the present invention ( Bacillus amyloliquefaciens Y34), its preservation number is GDMCC NO. 65312, preservation date: December 27, 2024, preservation unit code: GDMCC - Guangdong Provincial Microbial Culture Collection Center.

[0008] Serratia marcescens Y35 of the present invention ( Serratia marcescens Y35), its preservation number is GDMCC NO.65313, preservation date: December 11, 2024, preservation unit code: GDMCC - Guangdong Provincial Microbial Culture Collection Center.

[0009] Bacillus amyloliquefaciens Y40 of the present invention ( Bacillus amyloliquefaciens Y40), its preservation number is GDMCC NO. 65314, preservation date: October 21, 2024, preservation unit code: GDMCC - Guangdong Provincial Microbial Culture Collection Center.

[0010] Streptomyces SD of the present invention ( Streptomyces sp. SD ), its preservation number is GDMCC NO. 65311, preservation date: October 21, 2024, preservation unit code: GDMCC - Guangdong Provincial Microbial Culture Collection Center.

[0011] The first object of the present invention is to provide a composite microbial population, which contains Bacillus amyloliquefaciens Y34 ( Bacillus amyloliquefaciens Y34), Serratia marcescens Y35 ( Serratia marcescens Y35), Bacillus amyloliquefaciens Y40 ( Bacillus amyloliquefaciens Y40) and Streptomyces SD ( Streptomyces sp. SD ); the Bacillus amyloliquefaciens Y34 has a preservation number of GDMCC NO. 65312; the Serratia marcescens Y35 has a preservation number of GDMCC NO. 65313; the Bacillus amyloliquefaciens Y40 has a preservation number of GDMCC NO. 65314; the Streptomyces SD has a preservation number of GDMCC NO. 65311.

[0012] The second object of the present invention is to provide a composite microbial agent, which contains the above-mentioned composite microbial population and microbial agent auxiliary materials.

[0013] Preferably, the cell number ratio of Bacillus amyloliquefaciens Y34∶Serratia marcescens Y35∶Bacillus amyloliquefaciens Y40∶Streptomyces SD in the composite bacterial agent is 1∶1∶1∶1.

[0014] The third object of the present invention is to provide a biological bacterial fertilizer, which contains the composite bacterial agent and fertilizer.

[0015] The fourth object of the present invention is to provide the application of the composite bacterial community, composite bacterial agent or biological bacterial fertilizer in at least one of the following (1)-(4):

[0016] (1) Improving soil;

[0017] (2) Improving the disease resistance of Chinese medicinal herb plants;

[0018] (3) Alleviating the continuous cropping obstacle of Chinese medicinal herb plants;

[0019] (4) Promoting the growth of Chinese medicinal herb plants.

[0020] Preferably, the Chinese medicinal herb plants are Chinese medicinal herb plants of the families Asparagaceae, Lamiaceae and Asclepiadaceae.

[0021] More preferably, the Chinese medicinal herb plants are Polygonatum odoratum, Pogostemon cablin and Cynanchum stauntonii Cynanchum stauntonii (Decne.) Schltr. ex Lévl.).

[0022] Preferably, the application includes the step of applying the composite bacterial community, composite bacterial agent or biological bacterial fertilizer to the roots or rhizosphere soil of Chinese medicinal herb plants.

[0023] Preferably, the application method is irrigation or spraying.

[0024] The composite bacterial agent of the present invention contains Bacillus amyloliquefaciens Y34, Serratia marcescens Y35, Bacillus amyloliquefaciens Y40 and Streptomyces SD. Experiments show that this composite bacterial agent can be applied to improve soil, eliminate the diseases of Polygonatum odoratum, Pogostemon cablin and Cynanchum stauntonii, and promote crop growth. Therefore, the composite bacterial agent of the present invention has important application value in the cultivation and production of Chinese medicinal herb crops such as Polygonatum odoratum and Pogostemon cablin.

[0025] Deposition description

[0026] The Bacillus amyloliquefaciens Y34 (Bacillus amyloliquefaciens Y34) of the present invention was deposited at the Guangdong Provincial Microbial Culture Collection Center on December 27, 2024, with the deposit number: GDMCC NO. 65312, the deposit unit code: GDMCC - Guangdong Provincial Microbial Culture Collection Center, and the address of the deposit unit: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou.

[0027] TheSerratia marcescens Y35 (Serratia marcescens Y35) was deposited in the Guangdong Provincial Microbiological Culture Collection Center on December 11, 2024, with the deposit number: GDMCC NO. 65313, the deposit unit code: GDMCC-Guangdong Provincial Microbiological Culture Collection Center, and the address of the deposit unit: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0028] The present invention Bacillus amyloliquefaciens Y40 (Bacillus amyloliquefaciens Y40) was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024, with the deposit number: GDMCC NO. 65314, the deposit unit code: GDMCC-Guangdong Provincial Microbiological Culture Collection Center, and the address of the deposit unit: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0029] The present invention Streptomyces sp. SD (Streptomyces SD) was deposited in the Guangdong Provincial Microbiological Culture Collection Center on October 21, 2024, with the deposit number: GDMCC NO. 65311, the deposit unit code: GDMCC-Guangdong Provincial Microbiological Culture Collection Center, and the address of the deposit unit: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 These are the morphological and basic biological characteristics of strain Y34; Figure 1 A: The utilization of different carbon sources by strain Y34 and the detection of the acid and alkali production capacity of strain Y34; Figure 1 B in the figure: growth of strain Y34 on different antibiotic media; Figure 1 C in the figure: growth of strain Y34 under different pH conditions; Figure 1 D in the figure: Growth of strain Y34 under different NaCl concentrations; Figure 1 E in: free nitrogen fixation ability test of strain Y34; Figure 1 F, G, and H in the figure are the tests of the ability of strain Y34 to degrade organic phosphorus, inorganic phosphorus, and potassium, respectively; Figure 1 I and J in the figure: the inhibitory effect of strain Y34 on Fusarium oxysporum, which is the inhibition of spore germination and hyphal growth, respectively; Figure 1 K in: Antagonistic test results of strain Y34 against Ralstonia solanacearum.

[0031] Figure 2 These are the morphological and basic biological characteristics of strain Y35; Figure 2 A: The utilization of different carbon sources by strain Y35 and the detection of the acid and alkali production capacity of strain Y35; Figure 2 B in the figure: growth of strain Y35 on different antibiotic media;Figure 2 C in it: Growth of strain Y35 under different pH conditions; Figure 2 D in it: Growth of strain Y35 under different NaCl concentration conditions; Figure 2 E in it: Detection of free nitrogen fixation ability of strain Y35; Figure 2 F, G, and H in it are, in sequence, detections of the abilities of strain Y35 to decompose organic phosphorus, inorganic phosphorus, and potassium; Figure 2 I and J in it: Inhibitory effects of strain Y35 on Fusarium oxysporum, namely, inhibition of spore germination and mycelial growth; Figure 2 K in it: Inhibitory effects of strain Y35 on Ralstonia solanacearum at 3 d and 7 d.

[0032] Figure 3 are the morphological and basic biological characteristics of strain Y40; among them, Figure 3 A in it: Detection of the utilization of different carbon sources by strain Y40 and the acid and alkali production abilities of strain Y40; Figure 3 B in it: Growth of strain Y40 on different antibiotic media; Figure 3 C in it: Growth of strain Y40 under different pH conditions; Figure 3 D in it: Growth of strain Y40 under different NaCl concentration conditions; Figure 3 E in it: Detection of free nitrogen fixation ability of strain Y40; Figure 3 F, G, and H in it are, in sequence, detections of the abilities of strain Y40 to decompose organic phosphorus, inorganic phosphorus, and potassium; Figure 3 I and J in it: Inhibitory effects of strain Y40 on Fusarium oxysporum, namely, inhibition of spore germination and mycelial growth; Figure 3 K in it: Inhibitory effects of strain Y40 on Ralstonia solanacearum at 3 d and 7 d.

[0033] Figure 4 is the phylogenetic tree of the 16S rDNA gene sequences of strains Y34 and Y40.

[0034] Figure 5 is the phylogenetic tree of the 16S rDNA gene sequence of strain Y35.

[0035] Figure 6 are the tolerances of strains Y34, Y35, and Y40 to four phenolic acids; among them, Figure 6 the plates in A - E are, in sequence, basal salt medium plates with 0 addition and addition of ferulic acid, syringic acid, phloridzin, and p - coumaric acid as the sole carbon source.

[0036] Figure 7 are the morphological and basic biological characteristics of strain SD.

[0037] Figure 8It is the phylogenetic tree of the 16S rDNA gene sequence of strain SD.

[0038] Figure 9 It is the antagonistic test among strains; among them, Figure 9 in A, it is the plate coated with the bacterial solution of Y34, Figure 9 in B, it is the plate coated with the bacterial solution of Y35, Figure 9 in C, it is the plate coated with the bacterial solution of Y40.

[0039] Figure 10 It is the content of available phosphorus, nitrate nitrogen and humic acid in the soil of Polygonatum odoratum under different treatments; among them, Figure 10 in A, it is the situation of available phosphorus content, Figure 10 in B, it is the situation of nitrate nitrogen content, Figure 10 in C, it is the situation of humic acid content. The samples A, B, and C on the graph correspond to treatments A, B, and C in sequence.

[0040] Figure 11 It is the comparison of the tuber wounds of Polygonatum odoratum under different treatments; among them, Figure 11 in A, B, and C, they correspond to the tuber wound situations of Polygonatum odoratum under treatments A, B, and C in sequence.

[0041] Figure 12 It is the situation of new bud growth of Polygonatum odoratum under different treatments; among them, Figure 12 in A, B, and C, they correspond to the new bud growth situations of the tubers of Polygonatum odoratum under treatments A, B, and C in sequence.

[0042] Figure 13 It is the difference in the soil microbial community structure of Pogostemon cablin under different treatments; among them, Figure 13 in A, it is the difference at the phylum level, Figure 13 in B, it is the difference at the genus level. The samples A, B, and C on the graph correspond to treatments A, B, and C in sequence.

[0043] Figure 14 It is the disease resistance situation of Pogostemon cablin under different treatments; among them, Figure 14 in A, it is the growth situation of Pogostemon cablin before treatment A in Example 3, Figure 14 in B, it is the growth situation of Pogostemon cablin before treatment B in Example 3, Figure 14 in C, it is the growth situation of Pogostemon cablin after treatment A in Example 3 (the photographing range is the same piece of land corresponding to the photograph before treatment A), Figure 14 in D, it is the growth situation of Pogostemon cablin after treatment B in Example 3 (the photographing range is the same piece of land corresponding to the photograph before treatment B). Detailed implementation manners

[0044] The following examples are further descriptions of the present invention, rather than limitations on the present invention.

[0045] Example 1

[0046] 1. Isolation and Obtaining of Strains Y34, Y35, Y40, and SD

[0047] For Y34, Y35, and Y40, take the roots of healthy-growing polygonatum odoratum from Hunan Province, disinfect them with 75% ethanol aqueous solution by volume for 30 s, then disinfect with 2% NaClO aqueous solution by mass for 5 min, rinse with sterile water 5 - 6 times, add an appropriate amount of YMA liquid medium (according to the YMB medium formula in Table 1, remove the agar powder component to obtain YMA liquid medium), streak and purify on a YMB plate, and incubate at 28°C for 2 - 3 d in a constant temperature incubator.

[0048] Table 1 YMB Medium Formula (1 L)

[0049]

[0050] For SD, take the rhizosphere soil of healthy-growing polygonatum odoratum from Hunan Province. Add 1 g of rhizosphere soil to an appropriate amount of YMA liquid medium, shake well for 10 min, then let it stand for 30 min. Take the supernatant and dilute it to 10 -3 times, and then spread and purify it on an enrichment soil plate (a special plate prepared using rhizosphere soil, which can effectively enrich and culture Streptomyces; specifically prepared through the following steps: take 500 g of the root system soil of healthy-growing polygonatum odoratum, add water to 2 L, mix well and sterilize (121°C, 30 min), after sterilization, let it stand for 12 h, take the supernatant and dilute it 10 times, add agar powder to a final concentration of 1.5%, re-sterilize (121°C, 30 min) and then pour the plate), and incubate at 28°C for 2 - 3 d in a constant temperature incubator.

[0051] 2.1 Analysis of Carbon Source Utilization Characteristics

[0052] Prepare a variety of single-carbon-source media (according to the YMB medium formula in Table 1, replace the mannitol component with an equal mass of other carbon sources to obtain a single-carbon-source medium). The carbon sources include mannitol, inositol, glycerol, sodium citrate, malonic acid, sodium oxalate, starch, glucose, fructose, D-xylose, arabinose, lactose, sucrose, and maltose. Then, pipette 5 µL of the diluted bacterial solution and spot it on the plate, write the strain number and date on the plate, and place it in an incubator at 28°C for 3 days.

[0053] 2.2 Antibiotic Resistance Test

[0054] Prepare various antibiotic media (add a single antibiotic separately according to the YMB medium formula in Table 1 as the antibiotic medium). The antibiotics include chloramphenicol, chlortetracycline, rifampicin, kanamycin, gentamicin, fosfomycin, streptomycin, ampicillin, spectinomycin, and tetracycline. Subsequently, pipette 5 μL of the diluted bacterial solution and spot it on the plate. Write the strain number and date on the plate, and place it in an incubator at 28°C for 3 days.

[0055] 2.3 Analysis of NaCl tolerance characteristics

[0056] (1)Prepare the medium one day in advance, which are normal YMB medium or YMB medium supplemented with NaCl at final concentrations of 1%, 2%, 3%, 4%, and 5% (w / w). Weigh each component according to Table 1 and the medium formula with each concentration of NaCl added, mix them, add water to make up to 1 L, adjust the pH to 7.0 with 5% NaOH solution or 5% HCl solution, and sterilize at 121°C for 30 min; then dispense into plates.

[0057] (2)Dilute the bacterial solutions from different sources by 10 2 times for later use (add 1 mL of YMB to a 2 mL sterilized centrifuge tube, then add 10 μL of the corresponding isolated bacteria, mix well, and operate beside the alcohol lamp).

[0058] (3)Pipette 5 μL of the diluted bacterial solution and spot it on the plate. Write the strain number and date on the plate, and place it in an incubator at 28°C. After 3 days, observe the growth of each bacterium at different NaCl concentrations by comparing with the growth on the normal YMB medium, record and take pictures.

[0059] 2.4 pH experiment

[0060] Prepare YMB medium plates with pH values of 5, 7, 9, 11, and 13. Pipette 5 μL of the diluted bacterial solution and spot it on the plates with different pH values. Observe the growth after 3 days and take pictures.

[0061] 2.5 Phosphorus-solubilizing ability

[0062] Prepare plates of Mengjinna organic phosphorus (lecithin), Mengjinna inorganic phosphorus (tricalcium phosphate), and potassium-solubilizing activity determination medium. Divide each plate into 6 regions, and successively pipette 5 μL of the bacterial solution and spot it at the center of each region (ensure accurate sampling and prevent the bacterial solution from flowing). Incubate in an incubator at 28°C for 3 d, and observe whether the strain grows and whether phosphorus-solubilizing and potassium-solubilizing zones are formed.

[0063] The medium formula is as follows:

[0064] ① Mengjina Organophosphorus (Lecithin) Bacterial Medium (1 L): Glucose 10.0 g, (NH4)2SO4 0.5 g, NaCl 0.3 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·4H2O 0.03 g, KCl 0.3 g, CaCO3 1.0 g, Lecithin 0.3 g, Agar 20 g, pH 7.0. Among them, lecithin is dissolved by heating with 75% ethanol aqueous solution, sterilized separately, and mixed with the culture medium solution that has been sterilized and cooled to 60 °C, and then poured into plates.

[0065] ② Mengjina Inorganic Phosphorus (Tricalcium Phosphate) Bacterial Medium (1 L): Glucose 10 g, (NH4)2SO4 0.5 g, NaCl 0.3 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·4H2O 0.03 g, CaCO3 5.0 g, KCl 0.3 g, Ca3(PO4)2 5.0 g, Agar 20 g, pH 7.0.

[0066] ③ Potassium-Solubilizing Activity Assay Medium (1 L): Glucose 5.0 g, Anhydrous Magnesium Sulfate 0.5 g, Ferric Chloride 0.005 g, Calcium Carbonate 0.1 g, Calcium Phosphate 2.0 g, Potassium-Containing Mineral 2.0 g, Bromothymol Blue 100 mg, Agar 15 g, pH 7.2.

[0067] 2.6 Detection of Acid or Alkaline Production Ability of Strains on the Medium

[0068] Prepare Acid-Base (Bromothymol Blue) Medium. Weigh each component according to the formula in Table 2 and mix them, add water to make up to 1 L, adjust the pH to 7.0 with 5% NaOH solution or 5% HCl solution, and sterilize at 121 °C for 30 min. Then dispense into plates.

[0069] Table 2 Acid-Base Medium Formula (1 L)

[0070]

[0071] Inoculate 5 μL of each of the aforementioned diluted bacterial solutions onto the acid-base medium plates, culture at 28 °C for 3 - 5 days, and observe the color of the medium. If the medium turns blue, it means that the metabolite produced by the bacterium when utilizing this carbon source is alkaline (alkaline production); if the medium turns yellow, it means that the metabolite produced by the bacterium when utilizing this carbon source is acidic (acid production); if the medium does not change color and is green, it means that the metabolite produced by the bacterium when utilizing this carbon source is neutral.

[0072] 2.7 IAA Production Test of Strains

[0073] The strain was inoculated into 50 mL of LB liquid medium containing L-tryptophan (100 mg / L). After culturing for 1 day at 28°C and 180 rpm, 50 μL of the bacterial solution was dropped onto a white ceramic plate, and an equal volume of Salkowski colorimetric solution (containing 50 mL of 35% HClO4 and 1 mL of 0.5 mol / L FeCl3) was added. After thorough mixing, it was left to stand in the dark for 30 min. If the color turned red, it indicated that the bacterial solution contained IAA.

[0074] 2.8 Siderophore production test

[0075] 5 μL of the strain was pipetted onto a plate of CAS medium (60.5 mg of chrome azurol S (CAS), 72.9 mg of cetyltrimethylammonium bromide (ITIA), 2.645 mg of ferric chloride hexahydrate, 295.25 mg of sodium dihydrogen phosphate dihydrate, 1213.5 mg of disodium hydrogen phosphate dodecahydrate, 125 mg of ammonium chloride, 37.5 mg of potassium dihydrogen phosphate, 62.5 mg of sodium chloride, 9.0 g of agar, 1 L of distilled water, pH 6.8). It was cultured at 28°C for 3 days. If a yellow ring appeared around the colony, it indicated siderophore production.

[0076] 2.9 Ability of the strain to tolerate phenolic acids

[0077] Prepare the minimal salt medium (MSM): Weigh 5.8 g of K2HPO4, 2.0 g of (NH4)2SO4, 4.5 g of KH2PO4, 0.02 g of CaCl2, 0.16 g of MgCl2, 0.0018 g of FeCl3, 0.0024 g of Na2MoO4·2H2O, 0.0015 g of MnCl2·2H2O, and 18 g of agar. Add water to 1 L, adjust the pH to 7.0, and add one of p-Coumaric acid, Phloridzin, Syringic acid, Ferulic acid at a final concentration of 0.5 g / L as the sole carbon source; then make it into a culture medium plate. Inoculate 5 μL of each of the previously diluted bacterial solutions onto the plate and culture at 28°C for 7 days, and observe the colony morphology.

[0078] 2.10 Experiment on the strain antagonizing Fusarium oxysporum

[0079] Prepare a PDA plate containing spores: Prepare a spore suspension of Fusarium fungi. Inoculate Fusarium oxysporum on a PDA plate and culture at 28°C for 3 days. Scrape off the spores, add sterilized deionized water, filter with sterile absorbent cotton, observe with a hemocytometer, and dilute to make about 1×10 7Suspension of spores at a concentration of [[[number]]] spores / mL. Take 8 mL of the spore suspension and add it to 100 mL of PDA medium (extract of 20.0 g of potatoes, 2.0 g of glucose, 1.5 g of Agar, made up to 0.1 L with water) that has been melted and cooled to about 45 °C. Shake well and pour into petri dishes. Use a borer to make holes in the prepared PDA plates with spores, add 100 μL of the bacterial solution to the holes, and then incubate at 28 °C for 1 day to observe the spore germination. Antagonistic experiment on the mycelial growth of Fusarium oxysporum: Use a borer to obtain fungal blocks from the Fusarium oxysporum plate, place them in the center of the PDA plate, and drop 5 μL of the bacterial solution at equal intervals 1.0 cm around the fungal blocks. Incubate at 28 °C for 5 days and observe.

[0080] 2.11 Antagonistic experiment of the strain against Ralstonia solanacearum

[0081] Culture Ralstonia solanacearum in LB medium until the OD600 value reaches 0.6, and prepare the bacterial solution in a spray bottle. Drop 10 μL of the test bacterial solution on the YM plate medium and incubate at 28 °C for 12 h. Then evenly spray the Ralstonia solanacearum solution on the plate and incubate at 28 °C for 3 to 7 days to observe. The Fusarium oxysporum and Ralstonia solanacearum involved in the above two antagonistic experiments were isolated from the rhizosphere soil of Polygonatum odoratum or Pogostemon cablin.

[0082] The results showed that after the strain Y34 was incubated at 28 °C for 3 d on the YMB plate, the colony edge was smooth, with a convex shape, and the colony color was white. The strain Y34 could grow on plates with 0 carbon source or with mannitol, inositol, glycerol, sodium citrate, sodium oxalate, starch, glucose, fructose, D-xylose, arabinose, lactose, sucrose, maltose as the sole carbon source. The suitable pH range for growth was pH5 - pH13. It had resistance to chloramphenicol, chlortetracycline, tetracycline, and ampicillin, produced acid (the metabolite turned the bromothymol blue medium yellow, indicating that its metabolite was acidic), had the ability to decompose organic phosphorus and inorganic phosphorus, had the ability to decompose potassium, had the ability of free nitrogen fixation, could antagonize the spore germination and mycelial growth of Fusarium oxysporum, had the ability to produce IAA, had the ability to produce iron, and could tolerate up to 5% NaCl ( Figure 1 ), and the growth of the bacteria was inhibited by phloridzin and p-coumaric acid ( Figure 6 ).

[0083] After the strain Y35 was cultured at a constant temperature of 28 °C on a YMB plate for 3 days, the colonies were transparent, slightly white, with smooth edges and raised. Strain Y35 can grow on plates with 0 carbon source or with mannitol, inositol, glycerol, sodium citrate, malonic acid, sodium oxalate, starch, glucose, fructose, D-xylose, arabinose, lactose, sucrose, maltose as the sole carbon source. The suitable pH range for growth is pH5 - pH13. It has resistance to chloramphenicol, chlortetracycline, tetracycline, and ampicillin, produces acid (the metabolite turns the bromothymol blue medium yellow, indicating that its metabolite is acidic), has the ability to decompose organic phosphorus and inorganic phosphorus, has the ability to decompose potassium, has the ability of free nitrogen fixation, can antagonize the spore germination and hyphal growth of Fusarium oxysporum, can antagonize the growth of Ralstonia solanacearum, has the ability to produce IAA and the ability to produce iron, and can tolerate up to 5% NaCl ( Figure 2 ), and the growth of the bacteria is not inhibited by phenolic acids ( Figure 6 ).

[0084] After the strain Y40 was cultured at a constant temperature of 28 °C on a YMB plate for 3 days, the colonies were white, with smooth edges and raised. Strain Y40 can grow on plates with mannitol, inositol, starch, glucose, D-xylose, arabinose, lactose, sucrose, maltose, glycerol, sodium citrate, malonic acid, sodium oxalate, fructose as the sole carbon source. The suitable pH range for growth is pH5 - pH13. It has resistance to chloramphenicol, chlortetracycline, tetracycline, and ampicillin, produces acid (the metabolite turns the bromothymol blue medium yellow, indicating that its metabolite is acidic), has the ability to decompose organic phosphorus and inorganic phosphorus, does not have the ability to decompose potassium, can inhibit the spore germination and hyphal growth of Fusarium oxysporum, can antagonize the growth of Ralstonia solanacearum, does not have the ability to produce IAA, has the ability to produce iron, and can tolerate up to 5% NaCl ( Figure 3 ), and the growth of the bacteria is not inhibited by phenolic acids ( Figure 6 ).

[0085] After the strain SD was cultured at a constant temperature of 28 °C on a Gao's No. 1 medium plate for 3 days, the colonies were grayish-white, with smooth edges and raised, and the texture was rough ( Figure 7 ). The formula of Gao's No. 1 medium: soluble starch 20 g, KNO3 1.0 g, K2HPO4 0.5 g, MgSO4·7H2O 0.5 g, NaCl 0.5 g, FeSO4·7H2O 0.01 g, agar 20 g, add distilled water to make up to 1000 mL, pH7.4.

[0086] 3. Molecular biological identification of strains Y34, Y35, Y40 and SD

[0087] Molecular biological identification of strains Y34, Y35, Y40 and SD was carried out by 16S rDNA. The genomic DNA of each strain was amplified by PCR using primers (F: AGAGTTTGATCCTGGCTCAG; R: TACGGCTACCTTGTTACGACTT), and a fragment of about 1.4 kb was amplified. The nucleotide sequence of the 16S rDNA of the amplified strain Y34 is shown in SEQ ID NO.1, 1451 bp; the nucleotide sequence of the 16S rDNA of the amplified strain Y35 is shown in SEQ ID NO.2, 1402 bp; the nucleotide sequence of the 16S rDNA of the amplified strain Y40 is shown in SEQ ID NO.3, 1449 bp; the nucleotide sequence of the 16S rDNA of the amplified strain SD is shown in SEQ ID NO.4, 1386 bp. The amplified sequences were aligned by DNAMAN software, assembled by SNAPGENE software, and compared for homology in the NCBI (https: / / blast.ncbi.nlm.nih.gov / ) gene bank. The phylogenetic tree was constructed by the neighbor-joining method using MEGA11.0 software for phylogenetic analysis.

[0088] It was found that strain Y34 belongs to the genus Bacillus ( Bacillus ), and is most closely related to Bacillus amyloliquefaciens ( Figure 4 ). By comparing the morphological characteristics, physiological and biochemical properties of the control strain Y34 and the phylogenetic tree constructed by the 16S rDNA gene sequence, it was identified that strain Y34 belongs to the Bacillus genus. Therefore, strain Y34 was named Bacillus amyloliquefaciens Y34 (Bacillus amyloliquefaciens Y34).

[0089] Strain Y35 belongs to the genus Serratia ( Serratia ), and is most closely related to Serratia marcescens ( Figure 5 ). By comparing the morphological characteristics, physiological and biochemical properties of the control strain Y35 and the phylogenetic tree constructed by the 16S rDNA gene sequence, it was identified that strain Y35 belongs to the Serratia genus. Therefore, strain Y35 was named Serratia marcescens Y35 (Serratia marcescens Y35).

[0090] Strain Y40 belongs to the genus Bacillus ( Bacillus ), and is most closely related to Bacillus amyloliquefaciens ( Figure 4). Based on the morphological characteristics, physiological and biochemical properties of the control strain Y40, and the phylogenetic tree analysis constructed using the 16S rDNA gene sequence, it was identified that strain Y40 belongs to Bacillus genus, so strain Y40 was named Bacillus amyloliquefaciens Y40 (Bacillus amyloliquefaciens Y40).

[0091] Strain SD belongs to the genus Streptomyces ( Streptomyces ), and is most closely related to Streptomyces sp. ( Figure 8 ). Based on the morphological characteristics, physiological and biochemical properties of the control strain SD, and the phylogenetic tree analysis constructed using the 16S rDNA gene sequence, it was identified that strain SD belongs to Streptomyces genus, so strain SD was named Streptomyces sp. SD (Streptomyces SD).

[0092] Prepare YMB medium plates, and pipette 50 μL of the bacterial solutions of Y34, Y35, and Y40 onto different plates and spread evenly. Then, punch 9 holes on the plates, and add 50 μL of the bacterial solutions of the other 3 strains except the one that has been spread into the holes. Use 3 holes for each of the other strains as replicates, and culture at 28 °C for 1 day, and observe the plate morphology.

[0093] The results showed that there was no mutual antagonism and growth inhibition among the four strains ( Figure 9 ).

[0094] Example 2

[0095] 1. Polygonatum odoratum planting

[0096] The experimental site was a laboratory greenhouse, and the soil was a mixed soil with sand:soil = 1:1. Polygonatum odoratum was planted at intervals of 10 cm in 50*50 cm square pots, with a total of 30 plants.

[0097] 2. Design of microbial community combination and inoculation treatment method

[0098] Polygonatum odoratum was inoculated with disease-causing bacteria: Use a sharp needle to scratch the surface of the Polygonatum odoratum tuber (0.5 cm wound), and then pour 500 mL of the spore solution of Fusarium solani ( Fusarium solani ), 1×10 7 cells / mL) into each pot as the disease treatment; the blank control group only scratched the surface of the Polygonatum odoratum tuber with a sharp needle (0.5 cm wound) and did not pour Fusarium solani.

[0099] Three days after the disease treatment, Polygonatum odoratum was inoculated with the microbial agents. The microbial agent combinations for each treatment are shown in Table 3. A total of 3 different treatment groups were designed, with 30 seedlings in each treatment group and single-plant biological replicates.

[0100] Table 3 Bacterial agent combinations for different treatments of Polygonatum odoratum

[0101]

[0102] The strains Y34, Y35, Y40, and SD in Table 3 were isolated as described in Example 1.

[0103] The preparation method and treatment method of the bacterial agent combination treatment solution are as follows:

[0104] All tap water used below was left standing overnight before use to remove chlorine.

[0105] The strains Y34, Y35, and Y40 were respectively inoculated into an organic nutrient liquid medium (soluble starch 5.0 g, urea 2.0 g, potassium dihydrogen phosphate 6.0 g, yeast extract 10.0 g, magnesium sulfate 1.0 g, soybean leaching solution 10.0 g, beef extract 5.0 g, distilled water 1 L, pH 7.5) and cultured at 28°C for 3 - 7 days until the OD600 value was about 0.6. The OD600 value was measured. According to the OD600 value, the required volume of the bacterial solution was aspirated, and centrifuged at 4000 g for 20 min. After discarding the supernatant, it was resuspended with tap water to ensure that the concentration of each of the strains Y34, Y35, and Y40 in the prepared bacterial solution was 1.2×10 7 CFU / mL (that is, calculated according to the bacterial solution concentration of 2×10 9 CFU / mL when OD600 = 1, and the OD600 of each bacterium in the solution was 0.006), and thus a bacterial solution containing the strains Y34, Y35, and Y40 was prepared.

[0106] The strain SD was inoculated into 3 L of Gause's No. 1 medium and cultured at 28°C for 7 days, and then the cells were collected by centrifugation. Then, an appropriate amount of SD cells (controlling the final concentration of the strain SD to be 1.2×10 7 CFU / mL) was added to the previously prepared bacterial solution containing the strains Y34, Y35, and Y40, and thus a bacterial solution containing the strains Y34, Y35, Y40, and SD was prepared, and the concentrations of Y34, Y35, Y40, and SD in this bacterial solution were all 1.2×10 7 CFU / mL.

[0107] Treatment A was the disease control group, without adding the growth-promoting bacterial group, and the treatment solution of Treatment A was tap water.

[0108] Treatment B was the treatment with the addition of the bacterial group, and the treatment solution of Treatment B was the previously prepared bacterial solution containing the strains Y34, Y35, Y40, and SD.

[0109] Treatment C was the blank control group, and the treatment solution of Treatment C was tap water.

[0110] During the treatment, gently pour the prepared treatment solution of Treatment A, B or C around the rhizosphere of the Polygonatum odoratum plants, 500 mL per pot. Subsequently, repeat the treatment every 2 weeks. Measure the relevant indicators 90 days after the start of the treatment.

[0111] 3. Results

[0112] The results ( Figure 10 ) showed that the available phosphorus, nitrate nitrogen and humic acid contents in the soil of Polygonatum odoratum treated with Treatment B and Treatment C were significantly higher than those treated with Treatment A. Moreover, the results ( Figure 11 ) showed that the tuber wounds of Treatment B and Treatment C healed well, and there was no blackening and rotting of the wounds in Treatment A. In addition, the number of diseased plants in Treatment B and Treatment C was small, the rot rate was low, and new buds grew ( Figure 12 ). More importantly, the results ( Figure 13 ) showed that in Treatment B, in addition to the significant increase in the content of Streptomyces ( Streptomyces ), the contents of Firmicutes ( Firmicutes ), Actinobacteria ( Actinobacteriota ) and their various genera also increased significantly, effectively improving the soil microbial structure. The above results indicate that the compound bactericide in Treatment B has a significant effect on improving soil nutrients and the disease resistance of Polygonatum odoratum plants.

[0113] Example 3

[0114] 1. Pogostemon cablin cultivation

[0115] The experimental plot was a Pogostemon cablin cultivation area in Qiaoyuan Town, Huilai County, Guangdong Province. The soil was sandy soil, and the treatment material was the Pogostemon cablin area that had started to get sick. The Pogostemon cablin was a mature seedling, planted at an interval of 50 cm, with a total of 48 plants.

[0116] 2. Bacterial community combination design and inoculation treatment method

[0117] The Pogostemon cablin field was treated with inoculation of the bactericide. The bactericide combinations of each treatment are shown in Table 4. A total of 2 different treatment groups were designed, with 30 seedlings in each treatment group and single-plant biological replicates.

[0118] Table 4 Bactericide combinations of different treatments for Pogostemon cablin experiments

[0119]

[0120] The strains Y34, Y35, Y40, and SD in Table 4 were isolated in Example 1.

[0121] The commercial Bacillus subtilis in Table 4 was produced by Beihai Yiqiang Biotechnology Co., Ltd. Product name: Bacillus subtilis, viable bacteria count 100 billion / g, dosage form: water-soluble powder, purchase website: https: / / item.jd.com / 10034826879550.html .

[0122] The preparation method and treatment method of the microbial agent combination treatment solution are as follows:

[0123] All tap water used below has been placed overnight before use to remove chlorine.

[0124] Inoculate strains Y34, Y35, and Y40 into an organic nutrient liquid medium (soluble starch 5.0 g, urea 2.0 g, potassium dihydrogen phosphate 6.0 g, yeast extract 10.0 g, magnesium sulfate 1.0 g, soybean leaching solution 10.0 g, beef extract 5.0 g, distilled water 1 L, pH 7.5) and culture at 28°C for 3 - 7 days until the OD600 value is about 0.6, and measure the OD600 value. According to the OD600 value, absorb the required volume of the bacterial solution, and centrifuge at 4000 g for 20 min. After discarding the supernatant, resuspend with tap water to ensure that the concentration of each of the strains Y34, Y35, and Y40 in the prepared bacterial solution is 1.2×10 7 CFU / mL (that is, calculated according to the bacterial solution concentration of 2×10 9 CFU / mL when OD600 = 1, and each bacterium is OD600 = 0.006 in the solution), and thus a bacterial solution containing strains Y34, Y35, and Y40 is prepared.

[0125] Inoculate strain SD into 3 L of Czapek's No. 1 medium and culture at 28°C for 7 days, then centrifuge to collect the bacterial cells. Then add an appropriate amount of SD bacterial cells (controlling the final concentration of strain SD to be 1.2×10 7 CFU / mL) to the previously prepared bacterial solution containing strains Y34, Y35, and Y40, and thus a bacterial solution containing strains Y34, Y35, Y40, and SD is prepared, and the concentrations of Y34, Y35, Y40, and SD in this bacterial solution are all 1.2×10 7 CFU / mL.

[0126] Weigh an appropriate amount of Bacillus subtilis product (the viable bacteria count is 100 billion / g), dissolve it in tap water and mix well to prepare a bacterial solution with a concentration of 5×10 7 CFU / mL, and thus a bacterial solution containing commercial Bacillus subtilis is prepared.

[0127] Treatment A is the treatment with adding a bacterial group, and the treatment solution of Treatment A is the previously prepared bacterial solution containing strains Y34, Y35, Y40, and SD.

[0128] Treatment B is the treatment with adding a commercial bacterium, and the treatment solution of Treatment B is the previously prepared bacterial solution containing commercial Bacillus subtilis.

[0129] During the treatment, use the prepared treatment solution of Treatment A or B to perform root irrigation on the mature Pogostemon cablin plants, and irrigate 500 mL of the treatment solution per plant, and repeat the treatment again after an interval of 20 days.

[0130] 3. Determination of plant physiological indexes

[0131] One month after the root irrigation treatment, the disease incidence of Pogostemon cablin plants was counted. The results ( Figure 14 ) showed that compared with the commercial bacteria in treatment B, treatment A could significantly improve the disease resistance of Pogostemon cablin.

Claims

1. A composite microbial community, characterized in that, Contains Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens )Y34, Serratia marcescens ( Serratia marcescens )Y35, Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens )Y40 and Streptomyces ( Streptomyces sp.) SD; the Bacillus amyloliquefaciens Y34 has a deposit number of GDMCC NO. 65312; the Serratia marcescens Y35 has a deposit number of GDMCC NO. 65313; the Bacillus amyloliquefaciens Y40 has a deposit number of GDMCC NO. 65314; the Streptomyces SD has a deposit number of GDMCC NO. 65311.

2. A compound microbial agent, characterized in that, Containing the composite flora and bacterial agent adjuvant described in claim 1.

3. The composite microbial agent according to claim 2, wherein In the described composite bacterial agent, the cell number ratio of Bacillus amyloliquefaciens Y34∶Serratia marcescens Y35∶Bacillus amyloliquefaciens Y40∶Streptomyces SD is 1∶1∶1∶1.

4. A biological bacterial fertilizer, characterized in that, Containing the composite bacterial agent and fertilizer described in claim 2 or 3.

5. Use of the composite flora described in claim 1, the composite bacterial agent described in claim 2 or 3, or the biological bacterial fertilizer described in claim 4 in at least one of the following (1)-(4): (1) Improving soil; (2) Antagonizing Fusarium oxysporum, Ralstonia solanacearum and / or Fusarium solani; (3) Alleviating the continuous cropping obstacles of Polygonatum odoratum and / or Pogostemon cablin; (4) Promoting the growth of Polygonatum odoratum and / or Pogostemon cablin.

6. The application according to claim 5, wherein It includes the step of applying the described composite flora, composite bacterial agent or biological bacterial fertilizer to the roots or rhizosphere soil of Polygonatum odoratum and / or Pogostemon cablin.

7. The application according to claim 6, wherein The described application method is irrigation or spraying.

Images