Non-small cell lung cancer cis-platinum mild drug-resistant cell strain and application thereof

Abstract

The invention discloses a non-small cell lung cancer cis-platinum mild drug-resistant cell strain and application thereof. According to the invention, two cisplatin-resistant cell strains of NSCLC are constructed by adopting low-dose drug exposure and pulse type drug contact modes, so that the drug resistance progress of clinical patients can be better simulated. The construction time of the cell strain is 6 months, and the obtained drug resistance index is between 1.5 and 5. The method can be used for constructing a cell model for studying low-intensity drug resistance of cis-platinum, and providing detection of biomarkers related to drug resistance in the early stage of drug resistance occurrence and evaluation of signal channels. The method has good research prospect and application value for clinical multidrug resistance mechanism research, discovery of drug resistance targets and application evaluation of multidrug combined use.

Description

Technical Field

[0001] The invention relates to the technical field of biomedicine, and in particular to a non-small cell lung cancer cisplatin mildly resistant cell line and an application thereof. Background Art

[0002] Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, and early detection and diagnosis are particularly important for reducing cancer mortality. Factors such as tumor grade, size and location, lymph node status, overall health status of the patient and lung function jointly determine the treatment options for NSCLC, among which surgery, chemotherapy, radiotherapy and targeted therapy are approved treatments. Molecular targeted drugs designed for gene mutations with clear driver mutations (including EGFR, ALK, ROS1, BRAF, MEK, MET, RET, KRAS and HER2, etc.) have promoted the development of precise and personalized treatment of NSCLC. For metastatic NSCLC without driver gene mutations, tumor immunotherapy (ICI) targeting PD1 or PDL1 is a first-line treatment option. However, most patients still develop drug resistance and disease progression after treatment. Therefore, discovering tumor resistance mechanisms, improving molecular marker recognition patterns, and evaluating the potential mode of action of resistance are crucial for developing combination therapies and improving treatment outcomes.

[0003] The continuous mutation and amplification of target genes during tumor progression, as well as changes in the tumor microenvironment, can generate selection pressure and promote patients to develop tolerance to molecular targeted drugs. The cytotoxicity caused by the "off-target" of targeted drugs is the main cause of adverse events caused by treatment, and it limits the drug dosage and duration of action. Chemotherapy is an important way of drug treatment for many NSCLC patients. Common drugs include: cisplatin, carboplatin, paclitaxel, albumin paclitaxel, docetaxel, gemcitabine, vinorelbine, etoposide (VP-16) and pemetrexed. Cisplatin, as a DNA alkylating agent, causes DNA damage and hinders repair after cross-linking with DNA, triggering cell death. In the cytoplasm, water molecules replace the chlorinated ligands of cisplatin, and the hydrated cisplatin formed forms covalent bonds with endogenous nucleophiles such as methionine, reduced glutathione and metallothionein, consuming reducing equivalents in cells and increasing oxidative stress. However, compared with squamous cell carcinoma, patients with NSCLC are less sensitive to cisplatin. In the treatment of stage II and III NSCLC, the absolute 5-year survival rate of cisplatin-based adjuvant chemotherapy is 5.3%. Cisplatin resistance caused by multiple mechanisms is an important obstacle to NSCLC chemotherapy, so more reasonable and comprehensive cell models are needed to help deeply understand the targets of cisplatin resistance and accurately predict clinical response.

[0004] Cisplatin resistance may be caused by reduced drug uptake, increased metabolic turnover, inhibition of pro-apoptotic signals, and enhanced DNA repair capacity. Previous studies have shown that increased transcriptional levels of the transcription activator STAT3 are associated with the inhibition of apoptosis in chemotherapy-resistant NSCLC cells. ATP-binding cassette transporters and lung resistance-related proteins (LRPs) are involved in drug delivery and drug efflux and play an important role in the development of tumor multidrug resistance. Rapid degradation of the copper membrane transporter CTR1 causes a decrease in the influx of cisplatin, leading to tolerance to the drug. Cisplatin-DNA adducts block DNA replication and transcription, resulting in different types of DNA damage. Cancer cells with moderate resistance to cisplatin show increased levels of nucleotide excision repair factors. The transcription factor NRF2 mediates the transcription of genes that control cellular redox homeostasis to counteract the harmful effects of cisplatin. The dense extracellular matrix (ECM) surrounding tumors acts as a physiological barrier, limiting the diffusion rate of anticancer drugs into cancer cells. Therefore, cisplatin resistance in NSCLC is a complex biological phenomenon that requires cell models that are more consistent with physiological processes to study ideal biomarkers, thereby identifying responder populations, predicting treatment outcomes, and exploring combination therapies of multiple drugs.

[0005] Cisplatin is widely used in combination with other drugs for a variety of solid tumors. Although models of high resistance help to understand the possible mechanisms of tumor resistance, resistance in clinical practice usually occurs at a lower level. Existing studies have shown that treatment in clinical settings is carried out in a pulsed manner, producing 2-3 times the resistance compared to parental cells. Existing technologies continuously expose cells to a high-concentration drug environment to produce a high level of resistance, but are not very suitable as a cell model for studying actual clinical needs. In addition, a variety of preclinical studies have found that cisplatin has cross-resistance with other chemotherapy drugs, and that the cross-resistance of multidrug resistance is larger only in low-level resistance models, while cross-resistance is smaller in high-level resistance models (more than 10 times). Summary of the invention

[0006] In view of the problems existing in the above prior art, the present invention has constructed two cell lines with low-level resistance to cisplatin, and has been preserved in the China Center for Type Culture Collection. Different from the prior art research, the present invention adopts low-dose, pulsed contact mode for drug exposure in the construction, which can better simulate the generation of clinical low-level drug resistance. On this basis, the present invention further explores the potential drug resistance pathways of cells with low-level resistance to cisplatin, and has good research prospects and application value for the study of the mechanism of clinical multidrug resistance, the discovery of drug resistance targets, and the application evaluation of multidrug combination use.

[0007] In view of this, the technical solution adopted by the present invention is a non-small cell lung cancer mildly resistant to cisplatin cell line, including cell line one, named as human non-small cell lung cancer cell line H1299-cisR Homo sapiens, whose preservation number is CCTCC NO: C202509, or / and cell line two, named as human non-small cell lung cancer cell line H358-cisR Homo sapiens, whose preservation number is CCTCC NO: C202508.

[0008] Furthermore, the cell line 1 contains 1044 up-regulated genes and 1859 down-regulated genes, and the cell line 2 contains 73 up-regulated genes and 96 down-regulated genes.

[0009] Furthermore, in the cell line one, the genes whose expression changes are concentrated in the PI3K-Akt signaling pathway, calcium signaling pathway, neuroactive ligand-receptor interaction, muscle cytoskeleton, focal adhesion and cytokine-cytokine receptor interaction; in the cell line two, the genes whose expression changes are concentrated in the muscle cytoskeleton, neuroactive ligand-receptor interaction, axon guidance, focal adhesion, cancer transcriptional dysregulation and cell adhesion molecule signaling pathway.

[0010] The present invention also provides the use of the non-small cell lung cancer cisplatin mildly resistant cell line in studying the drug resistance mechanism of non-small cell lung cancer.

[0011] Application of the non-small cell lung cancer cisplatin mildly resistant cell line in evaluating the activity of drugs against non-small cell lung cancer;

[0012] The non-small cell lung cancer cisplatin mildly resistant cell line is used in screening and developing drugs for treating non-small cell lung cancer.

[0013] The non-small cell lung cancer cisplatin mildly resistant cell line is used in preparing a non-small cell lung cancer cell model or a non-small cell lung cancer animal model.

[0014] The non-small cell lung cancer mildly cisplatin-resistant cell line is used in constructing a tumor model of human non-small cell lung cancer mildly resistant to cisplatin in vivo and in vitro.

[0015] The present invention uses low-dose drug exposure and pulsed drug exposure to construct two NSCLC cell lines resistant to cisplatin, which can better simulate the progression of clinical patient resistance. The cell line construction time is 6 months, and the obtained resistance index is between 1.5-5.

[0016] The present invention provides a construction method and application of two cell lines tolerant to low doses of cisplatin, aiming to solve the technical problem that the existing technical solutions cannot fully simulate the drug resistance generated in the cisplatin treatment of clinical lung cancer, provide a low-cost and short-cycle drug-resistant cell construction solution, provide a cell model for studying low-intensity drug resistance of cisplatin, and provide the detection of drug resistance-related biomarkers and the evaluation of signal pathways in the early stage of drug resistance. The two cell lines are preserved in the China Center for Type Culture Collection, located at Wuhan University, Wuhan, China, and the cell line name is: human non-small cell lung cancer cell line H1299-cisR Homosapiens, and the preservation number is CCTCC NO: C202509; the cell line name is: human non-small cell lung cancer cell line H358-cisRHomo sapiens, and the preservation number is CCTCC NO: C202508.

[0017] The present invention provides the use of the above-mentioned drug-resistant cell strain in the synthesis of new drugs and the screening of drug molecule libraries. Based on the signal pathways that change under low-dose drug resistance obtained by the present invention, specific targeted drugs are designed, drug toxicity is detected in the drug-resistant cell strain of the present invention, and effective candidate drugs are screened. The cell strain provided by the present invention is helpful to study the molecular mechanism of non-small cell lung cancer resistance to cisplatin, and provides experimental materials for optimizing drug combinations and establishing new treatment methods.

[0018] The present invention discloses abnormally expressed proteins and altered signal pathways under low-dose drug resistance conditions, and uses targeted drugs or inhibitors of differentially expressed proteins to treat drug-resistant cell lines, which can provide a cell model for drug screening in the early or advanced stages of clinical drug resistance. The present invention provides an application of drug-resistant cell lines in establishing drug-resistant animal models of non-small cell lung cancer.

[0019] The cell line established by the present invention can be stably passaged and revived, and still has stable drug resistance after multiple passages, and can be used for establishing a human non-small cell lung cancer animal model by subcutaneous tumor transplantation, tail vein injection or in situ implantation. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Figure 2 shows the IC50 measurements for H1299 and H358 cells;

[0021] Figure 2 The morphological detection diagrams of H1299 and H358 cells;

[0022] Figure 3 This is a graph of proliferation detection of H1299 and H358 cells;

[0023] Figure 4 This is the cycle detection diagram of H1299 and H358 cells;

[0024] Figure 5This is a picture showing apoptosis detection of H1299 and H358 cells;

[0025] Figure 6 The figure is the migration detection diagram of H1299 and H358 cells;

[0026] Figure 7 This is a colony formation detection diagram of H1299 and H358 cells;

[0027] Figure 8 This is a picture showing the clone formation of H1299 and H358 cells after exposure to cisplatin;

[0028] Fig. 9 DNA damage detection in drug-resistant cells and wild-type cells after treatment with cisplatin;

[0029] Fig.10 The signaling pathways that are altered in H1299 and H358 resistant cells;

[0030] Fig.11 These are genes with significantly different expression levels between H1299 and H358 drug-resistant cells. DETAILED DESCRIPTION

[0031] The present invention is further described below in conjunction with specific embodiments.

[0032] 1. Materials and methods of the present invention

[0033] 1.1 Cell culture

[0034] Human non-small cell carcinoma cell NCI-H1299 and NCI-H358 cells were purchased from Wuhan Pu Nuo Sai Life Science Co., Ltd. The cells were cultured in RPMI1640 basal medium (Wuhan Pu Nuo Sai Life Science Co., Ltd., Catalog No. PM150110), supplemented with 10% fetal bovine serum (Suzhou Yi Ke Sai Biotechnology Co., Ltd., Catalog No. FSP500) and 1% penicillin / streptomycin (Thermo Fisher Scientific, Catalog No. 15140122). Cell culture was carried out in a cell culture incubator at 37°C and 5% CO2. When the cell confluence reached 100%, trypsin was used for cell passage (Thermo Fisher Scientific, Catalog No. 25200056).

[0035] 1.2 Measurement of half inhibitory concentration (IC50) of cells

[0036] The cells were counted and divided into 96-well plates at a density of 3000 cells / well, and 6 replicate wells were used for control. After 24 hours of cell culture, cisplatin (Selleck, catalog number S1166) was added at final concentrations of 0μg / ml, 0.1μg / ml, 0.25μg / ml, 0.5μg / ml, 1.25μg / ml, 2.5μg / ml, 5.0μg / ml, 12.5μg / ml, 25.0μg / ml, and 50.0μg / ml. The 0μg / ml group was used as the drug control well, and the remaining wells were drug experimental groups. The cells were co-cultured with the drugs for 48 hours, the culture medium was removed, and a 10% concentration of CCK-8 reagent (MedChemExpress, catalog number HY-K0301) was added. Six wells without cells were selected and the same 10% concentration of CCK-8 reagent was added as a cell-free blank group. After the cells were cultured for 3 hours, the absorbance (OD value) of the cells was measured at 450 nm using a microplate reader. The cell IC50 was calculated using GraphPad Prism 9 software, and the fitting curve was nonlinear fitting-variable slope. The inhibitory rate of cisplatin on cells was calculated as follows:

[0037] Inhibition rate (%) = (OD of drug experimental group - average OD of cell-free blank group) / (average OD of drug control wells - average OD of cell-free blank group) * 100%.

[0038] 1.3 Exposure of resistant cells to gradient cisplatin

[0039] The cells were treated with 1 / 10 of the measured IC50 concentration of cisplatin, and the medium was changed every 48 hours during the treatment, and the non-adherent cells were washed with PBS until the cell confluence reached 100%, and then the cells were passaged at 1:4, and 1 / 4 of the cells were taken to continue culturing without adding drugs. When the cell confluence reached 100% again, the cells were passaged at 1:4, 1 / 4 of the cells were taken to continue culturing, and 1 / 5 of the IC50 concentration of cisplatin was added for treatment. The medium was changed every 48 hours during the treatment, and the non-adherent cells were washed with PBS until the cell confluence reached 100%, and then the cells were passaged at 1:4, and 1 / 4 of the cells were taken to continue culturing without adding drugs. When the cell confluence reaches 100% again, the cells are passaged at 1:4, 1 / 4 of the cells are taken for continued culture, and 1 / 2 IC50 concentration of cisplatin is added for treatment. During the treatment, the medium is changed every 48 hours, and the non-adherent cells are washed with PBS until the cell confluence reaches 100%, and the cells are passaged at 1:4, and 1 / 4 of the cells are taken for continued culture without the addition of drugs. When the cell confluence reaches 100% again, the cells are passaged at 1:4, 1 / 4 of the cells are taken for continued culture, and 1 times IC50 concentration of cisplatin is added for treatment. During the treatment, the medium is changed every 48 hours, and the non-adherent cells are washed with PBS until the cell confluence reaches 100%, and the cells are passaged at 1:4, and 1 / 4 of the cells are taken for continued culture without the addition of drugs. After the drug-resistant cells were cultured until 1 times the IC50 drug was added, the cell state was observed, and then the drug was added in the same way, but each time the drug concentration was increased to 0.5 times the IC50 concentration of cisplatin, until the cells still could not reach 100% confluence after the drug was removed, and the cells treated in the previous round were used as candidate drug-resistant cells. The entire drug-resistant cell establishment period was 5-6 months. Human non-small cell lung cancer cell line H1299-cisR Homo sapiens and human non-small cell lung cancer cell line H358-cisR Homo sapiens were obtained.

[0040] 1.4 Western Blot

[0041] After the cultured cells were collected, they were rinsed twice with pre-cooled PBS, PBS was removed, cell lysis buffer (Biyuntian Biological Co., Ltd., Catalog No. P0013) was added, and appropriate protease inhibitors (Biyuntian Biological Co., Ltd., Catalog No. P1005) and phosphatase inhibitors (Biyuntian Biological Co., Ltd., Catalog No. P1045) were added. The cells were placed on ice and blown several times until the cells were completely lysed. Centrifuge at 12000rpm for 30 minutes at 4°C. The supernatant protein sample was aspirated, an equal volume of protein loading buffer (Biyuntian Biological Co., Ltd., Catalog No. P0015B) was added, and the mixture was boiled at 95°C for 10 minutes. After the sample was separated by SDS-PAGE gel, it was transferred to a 0.45μm PVDF hybridization membrane. The membrane band corresponding to the protein position was cut off, soaked in 5% skim milk powder, and slowly shaken at room temperature for 1 hour. After the membrane was washed with TBST solution for 5 minutes, it was transferred to the diluted primary antibody and incubated at 4°C for 14 hours. After incubation, the membrane was washed with TBST, oscillating at room temperature for 5 minutes each time, for a total of three washes, and then the membrane was transferred to the diluted secondary antibody and incubated at room temperature for 2 hours. After incubation, the membrane was washed with TBST, oscillating at room temperature for 5 minutes each time, for a total of three washes. After washing, the membrane was covered with a persistent chemiluminescent substrate (Yisheng Biotechnology Co., Ltd., Cat. No. 36223ES10) and detected in an imager.

[0042] 1.5 Protein immunofluorescence

[0043] The cells were planted on the slides in the well plate. When the cell confluence reached about 70%, the culture medium was removed, and the cells were rinsed twice with pre-cooled PBS, fixed with 4% paraformaldehyde at room temperature for 15 minutes, then rinsed with PBS, and placed in 0.5% Triton X-100 and permeabilized at room temperature for 15 minutes. The cells were then rinsed with PBS. The cells were placed in 5% bovine serum albumin, blocked at room temperature for 1 hour, and then transferred to the diluted primary antibody and incubated at 4°C for 14 hours. After incubation, the cells were washed with PBST, oscillated at room temperature for 5 minutes each time, and washed three times in total. After that, the membrane was transferred to the diluted secondary antibody and incubated at room temperature for 1 hour. After incubation, the membrane was washed with TBST, oscillated at room temperature for 5 minutes each time, and washed three times in total. After washing, the cells were incubated with DAPI for 10 minutes, then sealed, and laser confocal microscopy was performed.

[0044] 1.6 Cell proliferation assay

[0045] Cells were plated in a 96-well plate at a density of 1000 cells / well, with 6 replicate wells. Cell viability was tested every 24 hours. After discarding the culture medium, the cells were incubated with 10% CCK-8 reagent and cultured at 37°C, 5% CO2 for 3 hours. The OD value of the cells was measured at 450nm using an enzyme reader. The measurement was continued for 5 days, and the OD value of the first day was used for normalization to draw the cell proliferation curve.

[0046] 1.7 Cell apoptosis detection

[0047] The cells were digested and collected with trypsin, washed twice with pre-cooled PBS, and the PBS was discarded and the cells were resuspended in binding buffer. 5 μL Annexin V-FITC and 10 μL PI staining solution were added to every 100 μL binding buffer, mixed and reacted at room temperature for 15 minutes in the dark. 100 μL binding buffer was added, and FITC and PI signals were detected by flow cytometry. The above reagents were all from Yisheng Biotechnology Co., Ltd., with the catalog number 40302ES20.

[0048] 1.8 Cell cycle detection

[0049] The cells were digested and collected with trypsin, and then resuspended and washed in pre-cooled PBS. After removing PBS, pre-cooled 70% ethanol was added to the cells. After mixing, they were fixed at 4°C for 12 hours. The ethanol was then removed by centrifugation, and the cells were resuspended in pre-cooled PBS. The PBS was removed by centrifugation, and the cells were resuspended in staining buffer. After adding PI staining solution, the cells were incubated at 37°C in the dark for 30 minutes. Then, red fluorescence was detected by flow cytometry at an excitation wavelength of 488nm to analyze the cell DNA content.

[0050] 1.9 Cell migration assay

[0051] The cells were digested with trypsin and counted. 2*104 cells were added to the upper chamber of the Transwell chamber, and cell culture medium was added to the lower chamber. After 24 hours of cell culture, the cells in the upper and lower chambers were rinsed once with PBS and fixed with 4% paraformaldehyde for 15 minutes. They were then stained with crystal violet, and the residual cells in the upper chamber were gently wiped with cotton wool. The cells in the lower chamber were imaged and counted.

[0052] 1.10 Detection of clone formation ability

[0053] After digesting the cells with trypsin, count them, take 100 cells and add them to a six-well plate, and culture them at 37°C, 5% CO2 until visible cell clones are formed (about 7-10 days). Remove the culture medium, rinse the cells with PBS, and fix them with 4% paraformaldehyde for 15 minutes. Then discard the paraformaldehyde and stain the cells with crystal violet. After the well plate is dried, image and count the cell clones.

[0054] 1.11 RNA-seq sample preparation

[0055] The cells were scraped and collected, washed with PBS, and RNA was extracted using a Trizol kit (Thermo Fisher Scientific, Cat. No. 15596026CN). TM One / OneC detects RNA purity and accurately quantifies RNA. After the sample is qualified, magnetic beads with Oligo (DT) are used to capture mRNA with polyA structure, and random oligonucleotides are used as primers to construct the sample library. Finally, Illumina PE150 sequencing is performed on different libraries. The above library construction and sequencing are all carried out at Hypros Biotechnology Co., Ltd.

[0056] 1.12 Reverse transcription and fluorescence quantitative PCR experiments

[0057] After the cells were collected, RNA was extracted using the same method as above. 2 μg of total RNA was taken and AdvanceFast1st Strand cDNA Synthesis SuperMix (Yisheng Biotechnology Co., Ltd., catalog number 11156ES60) was used for reverse transcription. qPCR SYBR Green Master Mix (Yisheng Biotechnology Co., Ltd., catalog number 11201ES03) was used for real-time quantitative PCR amplification to calculate the relative levels of cell-specific gene transcription in different treatment groups. The detection primers used were:

[0058] GAPDH-F GTCTCCTCTGACTTCAACAGCG GAPDH-R ACCACCCTGTTGCTGTAGCCAA ABCA5-F GCTTGCCTTTCAAGGACATGGAC ABCA5-R CCAAAGTCGTCATGGAAACACCA ABCF2-F GAGGTTTCACTGGGAGCAAGATC ABCF2-R CTGTAGCGTCTTCTCCTTGCTC IGFBP3-F CGCTACAAAGTTGACTACGAGTC IGFBP3-R GTCTTCCATTTCTCTACGGCAGG MSH5-F CGAACCAAGGAGCTGGATGCAT MSH5-R GGAGGCAAGGTCCAATACTCGG ABCB6-F GTTCTTCAACGCCTGGTTTGGC ABCB6-R AGCACGACGAAACTTGGTTCTCC CTCFL-F AGTGAGAAGCCTCACCTGTGTC CTCFL-R GACGAGTTCTCCACTGGTGACA

[0059] 1.13 Bioinformatics analysis

[0060] The transcriptome sequencing data of cells were aligned to the reference genome using HISAT2 software. The gene expression analysis was performed by calculating the Reads Count values ​​of different genes in HTSeq and using the union model for statistics.

[0061] 1.14 Statistical analysis

[0062] The data of the present invention were analyzed using GraphPad Prism 9 software. The experiments were repeated at least three times independently under the same conditions. The data were analyzed using Student's t test and expressed as mean ± standard deviation. Statistical significance was determined as follows: ***p<0.001**p<0.01*p<0.05; not significant (ns) p>0.05.

[0063] 2. Verification results of the present invention

[0064] 2.1 The constructed cells have significantly enhanced cisplatin resistance compared with wild-type cells

[0065] After drug sensitivity testing, the constructed resistant cells had significantly higher IC50 values ​​for cisplatin than wild-type cells (WT). The IC50 of H1299-cisR resistant cells increased from 2.106μg / ml to 7.453μg / ml, with a resistance index of 3.54; the IC50 of H358-cisR resistant cells increased from 1.60μg / ml to 2.46μg / ml, with a resistance index of 1.54 (e.g. Figure 1 shown).

[0066] 2.2 Morphological changes of drug-resistant cells

[0067] Compared with wild-type cells, the morphology of H1299-resistant cells H1299-cisR has significant changes, the cells change from oval to spindle-shaped, the pseudopodia of cells are elongated and the number increases; while the morphology of H358-resistant cells H358-cisR has little change compared with wild-type cells (such as Figure 2 shown).

[0068] 2.3 Changes in proliferation ability of drug-resistant cells

[0069] Compared with wild-type cells, the proliferation ability of H1299-resistant cells H1299-cisR was weakened, while the proliferation ability of H358-resistant cells H358-cisR was not significantly different from that of wild-type cells (e.g. Figure 3 shown).

[0070] 2.4 Changes in the cell cycle of drug-resistant cells

[0071] Compared with wild-type cells, the proportion of G1 phase cells and S phase cells of H1299-cisR resistant cells were not significantly different, while the proportion of G2 / M phase cells decreased. Compared with wild-type cells, the proportion of G1 phase cells of H358-cisR resistant cells was significantly increased, while the proportion of G2 / M phase and S phase cells was significantly decreased (e.g. Figure 4 Cisplatin-resistant cells of both lung cancers showed a decrease in the proportion of cells in the G2 / M phase.

[0072] 2.5 Changes in the proportion of apoptosis in drug-resistant cells

[0073] Compared with wild-type cells, the apoptosis rate of H1299-cisR resistant cells decreased from 1.15% to 0.38%, while the apoptosis rate of H358-cisR resistant cells increased from 0.91% to 1.82% (Fig. Figure 5 shown).

[0074] 2.6 Changes in migration of drug-resistant cells

[0075] Compared with wild-type cells, the migration ability of H1299-resistant cells H1299-cisR was weakened, while the migration ability of H358-resistant cells H358-cisR was not significantly different from that of wild-type cells (e.g. Figure 6 shown).

[0076] 2.7 Changes in the clone-forming ability of drug-resistant cells

[0077] Compared with wild-type cells, the clone-forming ability of H1299-resistant cells H1299-cisR was weakened, while the clone-forming ability of H358-resistant cells H358-cisR was not significantly different from that of wild-type cells (e.g. Figure 7 shown).

[0078] 2.8 Changes in the cloning ability of resistant cells after cisplatin treatment.

[0079] H1299 wild-type and drug-resistant cells were treated with 1ug / ml cisplatin for 10 days, and the number of cell clones was calculated. The results showed that the number of clones formed by drug-resistant cells after exposure to cisplatin increased significantly. H358 wild-type and drug-resistant cells were treated with 0.5ug / ml cisplatin for 10 days, and the number of cell clones was calculated. The results showed that there was no significant difference in the number of clones formed by drug-resistant cells after exposure to cisplatin (such as Figure 8 shown).

[0080] 2.9 DNA damage in drug-resistant cells after cisplatin treatment

[0081] The H1299 and H358 drug-resistant cells were subjected to immunofluorescence experiments with wild-type cells to detect the expression of the DNA damage marker γH2AX. Without any treatment, the spontaneous DNA damage in H1299 drug-resistant cells increased slightly compared with wild-type cells, while the DNA damage in H358 drug-resistant cells was significantly reduced compared with wild-type cells ( Fig. 9 A). H1299 cells were treated with 2ug / ml cisplatin for 12 hours and 24 hours, and H358 cells were treated with 1ug / ml cisplatin for 12 hours and 24 hours, and the expression of γH2AX, a DNA damage marker, was detected after drug exposure. After 12 hours of cisplatin treatment, the DNA damage in H1299 resistant cells was not much different from that in wild-type cells, while the DNA damage in H358 resistant cells was significantly reduced ( Fig. 9 B). After 24 hours of cisplatin treatment, the DNA damage in H1299 resistant cells was significantly lower than that in wild-type cells, and the DNA damage in H358 resistant cells was also lower than that in wild-type cells ( Fig. 9C). DNA damage repair was detected by Western blotting. H1299 wild-type and drug-resistant cells were exposed to 5ug / ml and 10ug / ml cisplatin, and cells were collected at 12 hours, 24 hours and 48 hours after drug treatment to detect protein expression. The results showed that at both drug concentrations, there was no significant effect on the expression of γH2AX in wild-type and drug-resistant cells after 12 hours of treatment, while the remaining γH2AX in wild-type cells increased significantly after 24 hours and 48 hours of drug treatment ( Fig. 9 D), that is, DNA damage in drug-resistant cells is repaired faster. This suggests that the DNA repair ability of the two drug-resistant cells is significantly enhanced, which may be the reason why drug-resistant cells resist drugs.

[0082] 2.10 Changes in signaling pathways in drug-resistant cells

[0083] The mRNA of H1299 and H358 resistant cells and wild-type cells was extracted for transcriptome sequencing, and the test results were analyzed by bioinformatics. The difference multiple log2FC was selected as 1.0, and the difference p value was less than 0.05. Compared with wild-type cells, 1044 upregulated genes and 1859 downregulated genes were identified in H1299 resistant cells, while 73 upregulated genes and 96 downregulated genes were identified in H358 resistant cells ( Fig.10 A). Compared with wild-type cells, drug-resistant cells in the two cell lines have 5 common up-regulated genes and 22 common down-regulated genes ( Fig.10 B). In H1299 drug-resistant cells, genes with changed expression were mainly concentrated in the PI3K-Akt signaling pathway, calcium signaling pathway, neuroactive ligand-receptor interaction, muscle cytoskeleton, focal adhesion, and cytokine-cytokine receptor interaction ( Fig.10 C); in H358 resistant cells, the genes with changed expression were mainly concentrated in signaling pathways such as muscle cytoskeleton, neuroactive ligand-receptor interaction, axon guidance, focal adhesion, cancer transcriptional dysregulation, and cell adhesion molecules ( Fig.10 D).

[0084] 2.11 Detection of genes with significant expression differences in drug-resistant cells

[0085] According to the above signal pathway detection, some genes related to drug resistance were selected for verification. ABCA5 in the ATP-binding cassette transporter family is involved in the transport of substances inside and outside the cell, especially in the removal of intracellular metabolites, and has been reported as a biomarker for a variety of tumors. The inventors detected that the expression of ABCA5 was significantly upregulated in the drug-resistant cells of H1299 and H358 ( Fig.11A). The same family transporter ABCB6 is involved in the porphyrin energy-dependent transport of heme biosynthesis, maintains intracellular redox levels, promotes tumor growth and proliferation, and is associated with resistance to toxic metals and drugs. The inventors detected that the expression of ABCB6 was upregulated in H1299 resistant cells, while the expression in H358 resistant cells was not much changed ( Fig.11 B). Another transporter protein in the same family, ABCF2, can regulate protein translation, stress response and apoptosis, and is reported to play an important role in tumor chemotherapy resistance, tumor progression and chronic inflammatory diseases. The inventors detected that the expression of ABCF2 was significantly upregulated in both H1299 and H358 resistant cells ( Fig.11 C). MSH5 protein, a member of the MutS homolog DNA mismatch repair protein family, has been reported to be a DNA damage repair factor required for homologous chromosome recombination, involved in the signal transduction of DNA damage checkpoints, and regulating cell cycle progression. It may reduce the cytotoxicity of chemotherapeutic drugs by enhancing DNA repair ability. The inventors detected that the expression of MSH5 was significantly upregulated in both H1299 and H358 resistant cells ( Fig.11 D). The zinc finger transcription factor CTCFL (also known as BORIS) regulates the methylation state and chromatin structure of genes and has been shown to promote invasion, apoptosis, cell proliferation and immortalization by activating pluripotency and testis-specific genes. In addition, CTCFL has also been shown to be a factor of therapeutic resistance and a major target for tumor immunotherapy. The inventors detected that the expression of CTCFL was significantly upregulated in H1299 resistant cells, but not significantly upregulated in H358 resistant cells ( Fig.11 E). Insulin-like growth factor binding protein IGFBP3 is a multifunctional protein that regulates cell proliferation, differentiation and apoptosis by binding to growth factors IGF-1 and IGF-2, inhibiting their binding to IGF receptor (IGF1R). Studies on various tumors (such as breast cancer, lung cancer, and colorectal cancer) have shown that decreased expression of IGFBP3 is associated with poor prognosis. The inventors detected that the expression of IGFBP3 was significantly downregulated in both H1299 and H358 resistant cells ( Fig.11 F). The above results suggest that in mildly drug-resistant lung cancer cells, the drug efflux, DNA damage repair and anti-apoptosis pathways involved in the above genes may be activated, promoting cell resistance to cisplatin.

[0086] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0087] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A non-small cell lung cancer cell line with mild cisplatin resistance, characterized in that: The invention comprises a cell line 1 named as human non-small cell lung cancer cell line H1299-cisR Homo sapiens, whose deposit number is CCTCC NO: C202509, or / and a cell line 2 named as human non-small cell lung cancer cell line H358-cisR Homo sapiens, whose deposit number is CCTCC NO: C202508.

2. The non-small cell lung cancer cisplatin mildly resistant cell line according to claim 1, characterized in that: The cell line 1 contains 1044 up-regulated genes and 1859 down-regulated genes, and the cell line 2 contains 73 up-regulated genes and 96 down-regulated genes.

3. The non-small cell lung cancer mildly cisplatin-resistant cell line according to claim 2, characterized in that: The upregulated genes in the cell line 1 include ABCA5, ABCB6, ABCF2, MSH5 and CTCFL, and the downregulated genes include IGFBP3; the upregulated genes in the cell line 2 include ABCA5, ABCF2 and MSH5, and the downregulated genes include IGFBP3.

4. The non-small cell lung cancer mildly cisplatin-resistant cell line according to claim 1, characterized in that: In the cell line one, the genes whose expression changes are concentrated in the PI3K-Akt signaling pathway, calcium signaling pathway, neuroactive ligand-receptor interaction, muscle cytoskeleton, focal adhesion and cytokine-cytokine receptor interaction; in the cell line two, the genes whose expression changes are concentrated in the muscle cytoskeleton, neuroactive ligand-receptor interaction, axon guidance, focal adhesion, cancer transcriptional dysregulation and cell adhesion molecule signaling pathway.

5. Use of the mildly cisplatin-resistant non-small cell lung cancer cell line according to claim 1 in studying the drug resistance mechanism of non-small cell lung cancer.

6. Use of the non-small cell lung cancer cisplatin mildly resistant cell line according to claim 1 in evaluating the activity of drugs against non-small cell lung cancer.

7. Use of the non-small cell lung cancer cisplatin mildly resistant cell line according to claim 1 in screening and developing drugs for treating non-small cell lung cancer.

8. Use of the non-small cell lung cancer cisplatin mildly resistant cell line according to claim 1 in preparing a non-small cell lung cancer cell model or a non-small cell lung cancer animal model.

9. Use of the non-small cell lung cancer mildly cisplatin-resistant cell line according to claim 1 in constructing a mildly cisplatin-resistant tumor model of human non-small cell lung cancer in vivo and in vitro.

Images