Rice high temperature tolerance gene osacx2 and application thereof
By using OsACX2 gene editing technology, the high-temperature resistance of rice has been enhanced, solving the problems of anther dehiscence and low seed setting rate in rice under high temperatures, and achieving a breakthrough in high survival rate and high seed setting rate of rice under high temperature conditions.
Patent Information
- Application Number
- CN202510099095.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2045-01-22
AI Technical Summary
In existing technologies, rice is sensitive to high temperature stress, which leads to anther dehiscence, reduced pollen quantity and activity, affects the pollination and fertilization process, and reduces the seed setting rate. There is a lack of effective high-temperature resistant gene resources.
By utilizing the OsACX2 gene and its inhibitors, combined with the CRISPR/Cas system, the OsACX2 gene can be knocked out or knocked down using gene editing technology to enhance the high-temperature resistance of rice and improve its high-temperature survival rate, pollen viability, and seed setting rate.
OsACX2 gene knockout mutant rice plants were successfully obtained, exhibiting strong high-temperature antioxidant capacity, high survival rate under high temperature, strong pollen viability, high pollen germination rate, and increased seed setting rate to 86.3%, providing new gene resources for rice molecular breeding.
Smart Images

Figure CN120041483B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of agricultural biotechnology, and particularly relates to a high-temperature-resistant rice gene OsACX2 and application thereof. BACKGROUND
[0002] Rice is one of the three major crops in the world, and more than half of the world's population takes rice as their staple food. China is the world's largest rice producer and consumer, and the rice sown area ranks second in the world, and the total output ranks first in the world. In recent years, with the global temperature rising year by year, the extreme high temperature weather in summer occurs frequently, which seriously threatens the planting and production of double-season early rice and medium rice in the southern region of China. Studies have shown that the developing anther is most sensitive to high temperature stress. When the daily average temperature is higher than 32 DEG C, and the daily maximum temperature is higher than 35 DEG C, it will lead to anther dehiscence obstruction, pollen quantity and activity reduction, even male sterility, and then affect the pollination and fertilization process, and finally lead to the decrease of seed setting rate. Accelerating the breeding of excellent varieties with strong heat resistance is an effective way to solve this problem. However, at present, there are few rice heat-resistant genes and germplasm resources that can be used, therefore, it is of great significance to mine heat-resistant related genes and breed excellent rice varieties with strong heat resistance to ensure national food security. SUMMARY
[0003] The first aspect of the present application aims to provide the application of the OsACX2 gene.
[0004] The second aspect of the present application aims to provide the application of the OsACX2 inhibitor.
[0005] The third aspect of the present application aims to provide a sgRNA.
[0006] The fourth aspect of the present application aims to provide a biological material related to the gRNA of the third aspect of the present application.
[0007] The fifth aspect of the present application aims to provide a CRISPR / Cas system.
[0008] The sixth aspect of the present application aims to provide the application of the gRNA of the third aspect of the present application, the biological material of the fourth aspect of the present application, the CRISPR / Cas system of the fifth aspect of the present application, or a reagent containing the gRNA of the third aspect of the present application, the biological material of the fourth aspect of the present application, or the CRISPR / Cas system of the fifth aspect of the present application.
[0009] The seventh aspect of the present application aims to provide a method.
[0010] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is:
[0011] In a first aspect, the present application provides use of OsACX2 gene in at least one of a1) to a14):
[0012] a1) modulating high temperature tolerance of rice;
[0013] a2) preparing a product for modulating high temperature tolerance of rice;
[0014] a3) breeding high temperature tolerant rice varieties;
[0015] a4) preparing a product for breeding high temperature tolerant rice varieties;
[0016] a5) improving high temperature survival rate of rice;
[0017] a6) preparing a product for improving high temperature survival rate of rice;
[0018] a7) improving high temperature antioxidant capacity of rice;
[0019] a8) preparing a product for improving high temperature antioxidant capacity of rice;
[0020] a9) enhancing viability of rice pollen under high temperature;
[0021] a10) preparing a product for enhancing viability of rice pollen under high temperature;
[0022] a11) preparing high temperature rice pollen germination rate;
[0023] a12) preparing a product for improving high temperature rice pollen germination rate;
[0024] a13) preparing high temperature rice seed setting rate;
[0025] a14) preparing a product for improving high temperature rice seed setting rate;
[0026] The nucleotide sequence of the OsACX2 gene is shown in SEQ ID NO: 2.
[0027] In some embodiments of the present application, the product includes but is not limited to reagents, kits and drugs.
[0028] In some embodiments of the present application, the product further includes a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, suspensions, emulsions, granules, capsules, excipients, fillers, binders, sprays, transdermal absorption agents, wetting agents, disintegrants, absorption promoters, surfactants, colorants, flavoring agents or adsorption carriers.
[0029] OsACX2 gene (LOC_Os11g39220) with a full-length coding region of 2100 bp and composed of seven exons, is an acyl (fatty acyl) CoA oxidase (ACX) encoding gene.
[0030] In a second aspect of the present application, an OsACX2 inhibitor is provided for use in at least one of b1) to b14):
[0031] b1) regulating high-temperature tolerance of rice;
[0032] b2) preparing a product for regulating high-temperature tolerance of rice;
[0033] b3) breeding high-temperature tolerant rice varieties;
[0034] b4) preparing a product for breeding high-temperature tolerant rice varieties;
[0035] b5) improving high-temperature survival rate of rice;
[0036] b6) preparing a product for improving high-temperature survival rate of rice;
[0037] b7) improving high-temperature antioxidant capacity of rice;
[0038] b8) preparing a product for improving high-temperature antioxidant capacity of rice;
[0039] b9) enhancing viability of rice pollen under high temperature;
[0040] b10) preparing a product for enhancing viability of rice pollen under high temperature;
[0041] b11) preparing high-temperature rice pollen germination rate;
[0042] b12) preparing a product for improving high-temperature rice pollen germination rate;
[0043] b13) preparing high-temperature rice seed setting rate;
[0044] b14) preparing a product for improving high-temperature rice seed setting rate;
[0045] The nucleotide sequence of the OsACX2 is shown in SEQ ID NO: 2.
[0046] In some embodiments of the present application, the OsACX2 inhibitor comprises at least one of substances for reducing expression level of OsACX2.
[0047] In some embodiments of the present application, the substance for reducing expression level of OsACX2 comprises at least one of c1) to c13):
[0048] c1 ) at least one of an siRNA, a dsRNA, a miRNA, a ribozyme, a shRNA, a CRISPR / Cas system targeting OsACX2;
[0049] c2) a nucleic acid molecule encoding c1 );
[0050] c3) an expression cassette comprising the nucleic acid molecule of c2);
[0051] c4) a recombinant vector comprising the nucleic acid molecule of c2);
[0052] c5) a recombinant vector comprising the expression cassette of c3);
[0053] c6) a recombinant cell comprising the nucleic acid molecule of c2);
[0054] c7) a recombinant cell comprising the expression cassette of c3);
[0055] c8) a recombinant cell comprising the recombinant vector of c4);
[0056] c9) a recombinant cell comprising the recombinant vector of c5);
[0057] c10) a recombinant microorganism comprising the nucleic acid molecule of c2);
[0058] c11 ) a recombinant microorganism comprising the expression cassette of c3);
[0059] c12) a recombinant microorganism comprising the vector of c4);
[0060] c13) a recombinant microorganism comprising the vector of c5).
[0061] In some embodiments of the present application, the CRISPR / Cas system comprises a sgRNA targeting OsACX2 or a biological material associated with a sgRNA;
[0062] The biological material associated with a sgRNA comprises at least one of d1 ) to d12):
[0063] d1 ) a nucleic acid molecule encoding a sgRNA;
[0064] d2) an expression cassette comprising the nucleic acid molecule of d1 );
[0065] d3) a recombinant vector comprising the nucleic acid molecule of d1 );
[0066] d4) a recombinant vector comprising the expression cassette of d2);
[0067] d5) a recombinant cell comprising the nucleic acid molecule of d1 );
[0068] d6) a recombinant cell comprising the expression cassette of d2);
[0069] d7) a recombinant cell comprising the recombinant vector of d3);
[0070] d8) a recombinant cell comprising the recombinant vector of d4);
[0071] d9) a recombinant microorganism comprising the nucleic acid molecule of d1);
[0072] d10) a recombinant microorganism comprising the expression cassette of d2);
[0073] d11) a recombinant microorganism comprising the recombinant vector of d3);
[0074] d12) a recombinant microorganism comprising the recombinant vector of d4).
[0075] In some embodiments of the present application, the nucleotide sequence of the sgRNA is as set forth in SEQ ID NO: 5.
[0076] In some embodiments of the present application, the CRISPR / Cas system further comprises a Cas protein and / or a biological material associated with a Cas protein;
[0077] The biological material associated with a Cas protein comprises at least one of d1) to d12):
[0078] d1) a nucleic acid molecule encoding a Cas protein;
[0079] d2) an expression cassette comprising the nucleic acid molecule of d1);
[0080] d3) a recombinant vector comprising the nucleic acid molecule of d1);
[0081] d4) a recombinant vector comprising the expression cassette of d2);
[0082] d5) a recombinant cell comprising the nucleic acid molecule of d1);
[0083] d6) a recombinant cell comprising the expression cassette of d2);
[0084] d7) a recombinant cell comprising the recombinant vector of d3);
[0085] d8) a recombinant cell comprising the recombinant vector of d4);
[0086] d9) a recombinant microorganism comprising the nucleic acid molecule of d1);
[0087] d10) a recombinant microorganism comprising the expression cassette of d2);
[0088] d11) a recombinant microorganism comprising the recombinant vector of d3);
[0089] d12) a recombinant microorganism comprising the recombinant vector of d4).
[0090] In some embodiments of the present application, the recombinant vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a phage, a cosmid, a fosmid, an artificial chromosome.
[0091] In some embodiments of the present application, the plasmid vector can be an optional plasmid, the viral vector can be an optional virus, and the cell vector does not include reproductive material.
[0092] In some embodiments of the present application, the Cas protein is selected from Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d and Cas14, including any recombinant variant thereof, in particular selected from Cas9, including any recombinant variant thereof.
[0093] In some embodiments of the present application, the product includes but is not limited to reagents, kits and drugs.
[0094] In some embodiments of the present application, the product further comprises a pharmaceutically acceptable carrier, which includes but is not limited to diluents, buffers, suspensions, emulsions, granules, encapsulations, excipients, fillers, binders, sprays, transdermal absorption agents, wetting agents, disintegrants, absorption promoters, surfactants, colorants, flavoring agents or adsorption carriers.
[0095] In a third aspect of the present application, an sgRNA is provided, the nucleotide sequence of which is shown in SEQ ID NO: 5. Wherein A, C, G and U are nucleotide components including modified nucleotide components.
[0096] In some embodiments of the present application, the modification is, for example, sugar modification, methylation modification, etc.
[0097] In some embodiments of the present application, the sgRNA targets OsACX2 and can be used to knockout / knockdown OsACX2 in cooperation with a Cas protein.
[0098] In some embodiments of the present application, the nucleotide sequence of OsACX2 is shown in SEQ ID NO: 2.
[0099] In a fourth aspect of the present application, a biological material related to the sgRNA of the third aspect of the present application is provided, wherein the biological material comprises at least one of e1) to e12):
[0100] e1) a nucleic acid molecule encoding the sgRNA of the third aspect of the present application;
[0101] e2) an expression cassette comprising the nucleic acid molecule of e1);
[0102] e3) a recombinant vector comprising the nucleic acid molecule of e1);
[0103] e4) a recombinant vector comprising the expression cassette of e2);
[0104] e5) a recombinant cell comprising the nucleic acid molecule of e1);
[0105] e6) a recombinant cell comprising the expression cassette of e2);
[0106] e7) a recombinant cell comprising the recombinant vector of e3);
[0107] e8) a recombinant cell comprising the recombinant vector of e4);
[0108] e9) a recombinant microorganism comprising the nucleic acid molecule of e1);
[0109] e10) a recombinant microorganism comprising the expression cassette of e2);
[0110] e11) a recombinant microorganism comprising the recombinant vector of e3);
[0111] e12) a recombinant microorganism comprising the recombinant vector of e4).
[0112] In some embodiments of the present application, the recombinant vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a phage, a cosmid, a fosmid, an artificial chromosome.
[0113] In some embodiments of the present application, the plasmid vector can be an optional plasmid, the viral vector can be an optional virus, and the cell vector does not include reproductive material.
[0114] In a fifth aspect of the present application, a CRISPR / Cas system is provided, comprising the sgRNA of the third aspect of the present application and / or the biological material of the fourth aspect of the present application.
[0115] In some embodiments of the present application, the CRISPR / Cas system further comprises a Cas protein and / or a biological material related to the Cas protein;
[0116] The biological material related to the Cas protein comprises at least one of d1) to d12):
[0117] d1 ) a nucleic acid molecule encoding a Cas protein;
[0118] d2) an expression cassette comprising the nucleic acid molecule of d1 );
[0119] d3) a recombinant vector comprising the nucleic acid molecule of d1 );
[0120] d4) a recombinant vector comprising the expression cassette of d2);
[0121] d5) a recombinant cell comprising the nucleic acid molecule of d1 );
[0122] d6) a recombinant cell comprising the expression cassette of d2);
[0123] d7) a recombinant cell comprising the recombinant vector of d3);
[0124] d8) a recombinant cell comprising the recombinant vector of d4);
[0125] d9) a recombinant microorganism comprising the nucleic acid molecule of d1 );
[0126] d10) a recombinant microorganism comprising the expression cassette of d2);
[0127] d11 ) a recombinant microorganism comprising the recombinant vector of d3);
[0128] d12) a recombinant microorganism comprising the recombinant vector of d4).
[0129] In some embodiments of the application, the Cas protein is selected from the group consisting of Cas9, Cas12a, Cas12e, Cas12b, Cas12i, Cas12h, Cas12c, Cas12d, Cas12f, Cas12g, Cas12k, Cas12j, Cas13a, Cas13b, Cas13c, Cas13d and Cas14, including any recombinant variant thereof, in particular from Cas9, including any recombinant variant thereof.
[0130] In a sixth aspect of the application, there is provided the use of any one of f1 ) to f4) in any one of a1 ) to a14):
[0131] f1 ) an sgRNA according to the third aspect of the application;
[0132] f2) a biomaterial according to the fourth aspect of the application;
[0133] f3) a CRISPR / Cas system according to the fifth aspect of the application;
[0134] f4) a reagent comprising the sgRNA of the third aspect of the application, the biomaterial of the fourth aspect of the application, or the CRISPR / Cas system of the fifth aspect of the application;
[0135] a1) modulating heat tolerance in rice;
[0136] a2) preparing a product for modulating heat tolerance in rice;
[0137] a3) breeding heat tolerant rice varieties;
[0138] a4) preparing a product for breeding heat tolerant rice varieties;
[0139] a5) increasing heat survival rate in rice;
[0140] a6) preparing a product for increasing heat survival rate in rice;
[0141] a7) increasing heat antioxidant capacity in rice;
[0142] a8) preparing a product for increasing heat antioxidant capacity in rice;
[0143] a9) enhancing heat pollen viability in rice;
[0144] a10) preparing a product for enhancing heat pollen viability in rice;
[0145] a11) preparing heat pollen germination rate in rice;
[0146] a12) preparing a product for increasing heat pollen germination rate in rice;
[0147] a13) preparing heat seed setting rate in rice;
[0148] a14) preparing a product for increasing heat seed setting rate in rice.
[0149] In some embodiments of the present application, the product includes, but is not limited to, a reagent, a kit, and a medicament.
[0150] In some embodiments of the present application, the product further comprises a pharmaceutically acceptable carrier, which includes, but is not limited to, a diluent, a buffer, a suspending agent, an emulsifying agent, a granulating agent, a encapsulating agent, an excipient, a filler, a binder, a spray, a transdermal absorption agent, a wetting agent, a disintegrating agent, an absorption promoting agent, a surfactant, a coloring agent, a flavoring agent, or an adsorbing carrier.
[0151] In a seventh aspect of the present application, a method is provided, comprising the step of reducing the expression level of OsACX2 in rice:
[0152] The method is at least one of g1) to g7):
[0153] g1) modulating heat tolerance of rice;
[0154] g2) breeding heat tolerant rice varieties;
[0155] g3) increasing survival rate of rice under high temperature;
[0156] g4) increasing antioxidant capacity of rice under high temperature;
[0157] g5) enhancing viability of rice pollen under high temperature;
[0158] g6) preparing rice pollen with increased germination rate under high temperature;
[0159] g7) preparing rice with increased seed setting rate under high temperature;
[0160] The nucleotide sequence of the OsACX2 gene is shown in SEQ ID NO: 2.
[0161] In some embodiments of the present application, the step of reducing the expression level of OsACX2 in rice is introducing at least one of h1) to h4) into rice:
[0162] h1) the sgRNA of the third aspect of the present application;
[0163] h2) the biomaterial of the fourth aspect of the present application;
[0164] h3) the CRISPR / Cas system of the fifth aspect of the present application;
[0165] h4) a reagent containing the sgRNA of the third aspect of the present application, the biomaterial of the fourth aspect of the present application, or the CRISPR / Cas system of the fifth aspect of the present application.
[0166] In some embodiments of the present application, the method comprises a step of knocking out / knocking down OsACX2 in rice using a gene editing technology.
[0167] In some embodiments of the present application, the gene editing technology comprises ZFNs, TALENs, or CRISPR / Cas technology.
[0168] In some embodiments of the present application, the OsACX2 gene is knocked out / knocked down using CRISPR / Cas9 technology.
[0169] In some embodiments of the present application, knocking out / knocking down the OsACX2 gene using CRISPR / Cas9 technology comprises the following steps:
[0170] 1. Target selection. According to the target design website (http: / / skl.scau.edu.cn / ), the target is finally designed at 110-129 bp (AGACGACGAAGACGACCGGA) of the genomic sequence;
[0171] 2. Target primer design. The target uses U3 promoter, so the target primer is designed as: F-GGCAGACGACGAAGACGACCGGA; R-TCTGCTGCTTCTGCTGGCCTCAAA;
[0172] 3. Target and U3 promoter connection. The target primer is mixed with the vector containing the U3 promoter, BsaI and T4 ligase are added, and the target sequence is inserted into the vector by cutting and connecting;
[0173] 4. Amplification of promoter and target fusion product. The product in step 3 is used as a template, and F-CTCCGTTTTACCTGTGGAATCG and R-CGGAGGAAAATTCCATCCAC are used as amplification primers, respectively, to amplify the promoter and target fusion product;
[0174] 5. Target and editing vector connection. The PCR product in step 4 is mixed with the PYLCRISPR / Cas9 vector, and the target sequence is inserted into the editing vector by cutting and connecting;
[0175] 6. Rice callus transformation and induction of regenerated plants. The constructed vector in step 5 is transformed into Agrobacterium, and the rice callus is placed in the Agrobacterium liquid for infection, and the callus is taken out and placed on the differentiation medium for induction and differentiation of regenerated plants;
[0176] 7. Positive plant identification. Fresh leaves of regenerated plants are taken to extract DNA, primers are designed upstream and downstream of the genomic target design position for PCR amplification, and the amplification product is sequenced for detection. Compared with the wild type plant, the plant with different sequencing results at the target position is the positive plant with gene editing.
[0177] The beneficial effects of the present application are:
[0178] The present application first discloses the application of OsACX2 in regulating the high temperature tolerance of rice. By target gene screening and combining CRISPR / Cas9 technology to knock out / knock down OsACX2 and overexpress OsACX2 gene, the importance of OsACX2 in regulating the high temperature tolerance of rice is proved. At the same time, the knockout of the gene can be used to create rice germplasm resources with high temperature tolerance, which can be applied to the breeding of new rice varieties with high temperature tolerance.
[0179] The application successfully obtains an OsACX2 gene knockout mutant rice plant in rice by using a CRISPR / Cas9 technology, and the rice plant has a stronger high-temperature oxidation resistance at the seedling stage and a higher survival rate under high temperature. In addition, the rice plant has strong pollen vitality and a high pollen germination rate under high temperature, and the rice plant has a high high-temperature setting rate (the average setting rate can reach 86.3%). It is indicated that the gene can be used as a target gene for molecular breeding, and the high-temperature resistance of rice can be improved by gene knockout, thereby providing a new gene material and inspiration for rice molecular breeding. BRIEF DESCRIPTION OF DRAWINGS
[0180] Figure 1 For comparison of different high-temperature tolerance rice materials under high-temperature stress, wherein a is the phenotype of a high-temperature resistant material (HTR) and a high-temperature sensitive material (HTS) before high-temperature treatment at the seedling stage; b is the phenotype of the HTR and the HTS after 45 DEG C high-temperature treatment for 3 days and recovery for 7 days at the seedling stage; c is the 1% iodine-potassium iodide staining result of pollen of the HTS after high-temperature stress; d is the 1% iodine-potassium iodide staining result of pollen of the HTR after high-temperature stress; e is the influence of high-temperature stress on the setting rate of the HTS (significantly decreased); and f is the influence of high-temperature stress on the setting rate of the HTR (less affected).
[0181] Figure 2 For results of transcriptome sequencing and fatty acid content analysis, wherein a is a histogram of differentially expressed genes; b is a Venn diagram of differentially expressed genes; c is KEGG enrichment analysis of common differentially expressed genes, and the red histogram is a fatty acid metabolism related pathway; d is a comparison of the fatty acid content of anther of rice with different high-temperature tolerance before and after high-temperature stress; and e is the expression of OsACX2 in anther tissue of high-temperature resistant and high-temperature sensitive rice before and after high-temperature stress, wherein * indicates P<0.05, and *** indicates P<0.001.
[0182] Figure 3 For physiological and biochemical index detection of the transgenic plant, wherein a is the fluorescence quantitative analysis result of the OsACX2 gene; b is a comparison of DAB and NBT staining of the transgenic rice leaf before and after high-temperature treatment; c is an active oxygen burst curve of the transgenic rice in vitro leaf under high-temperature stress; and d is a comparison of the MDA, SOD, POD and CAT content of the transgenic rice leaf tissue before and after high-temperature treatment. In the figure, DAB: 3,3-diaminobenzidine; NBT: chloronitrotetrazolium blue; NT: normal temperature; HT: high temperature; * indicates P<0.05; ** indicates P<0.01; and *** indicates P<0.001.
[0183] Figure 4For transgenic rice seedling high temperature tolerance analysis; a is the performance of rice seedling under high temperature stress; b is the survival rate statistics of rice seedling under high temperature; c is the analysis result of JA content in seedling leaf; d is the effect of exogenous JA on seedling high temperature tolerance; e is the subcellular localization analysis result of OsACX2; f: GUS staining analysis result.
[0184] Figure 5 For anther fatty acid content analysis under high temperature stress; a is the number statistics of differential fatty acids; b is the heat map analysis of differential fatty acids; c is the KEGG enrichment analysis of differential fatty acids; d is the expression trend analysis of differential fatty acids; e is the radar chart analysis of TOP10 differential fatty acids; f is the box plot analysis of all-cis-7, 10, 13, 16, 19-Docosapentaenoic acid and Oleic acid.
[0185] Figure 6 For pollen PI-FDA staining result (200 μm).
[0186] Figure 7 For comparison of transgenic pollen viability and pollination under high temperature stress (200 μm).
[0187] Figure 8 For comparison of transgenic rice glume after high temperature stress; a is the panicle of wild type (WT) rice after high temperature stress; b is the panicle of OsACX2 overexpression (pACX2::ACX2) rice; c is the panicle of OsACX2 knockout (ko-acx2) rice; d is the glume of wild type (WT) rice after high temperature stress; e is the glume of OsACX2 overexpression (pACX2::ACX2) rice; f is the glume of OsACX2 knockout (ko-acx2) rice; g is the anther of wild type (WT) rice after high temperature stress; h is the anther of OsACX2 overexpression (pACX2::ACX2) rice; i is the anther of OsACX2 knockout (ko-acx2) rice; j is the pollen of wild type (WT) rice after high temperature stress; k is the pollen of OsACX2 overexpression (pACX2::ACX2) rice; l is the pollen of OsACX2 knockout (ko-acx2) rice.
[0188] Figure 9 For comparison of high temperature seed setting rate of transgenic plants; a is the comparison of anther JA content of transgenic plants; b is the comparison of glume number of transgenic plants; c is the statistics of high temperature seed setting rate of transgenic plants; d is the comparison of seed setting of transgenic plants and wild type under high temperature stress; e is the panicle seed setting of transgenic plants after high temperature treatment. DETAILED DESCRIPTION
[0189] The content of the present application will be further described in detail by specific examples.
[0190] It should be understood that these examples are only used to illustrate the present application and not used to limit the scope of the present application.
[0191] In order to make the purpose, technical scheme and advantages of the embodiments of the present application more clear, the technical scheme in the embodiments of the present application will be clearly and completely described below. If the specific conditions are not specified in the embodiments, the conventional conditions or the conditions suggested by the manufacturer are adopted. If the reagents or instruments are not specified by the manufacturer, they are all the conventional products which can be purchased in the market.
[0192] The features and performances of the present application will be further described in detail below in combination with the examples.
[0193] Example 1 HTR and HTS high temperature tolerance phenotype identification
[0194] In the glass greenhouse, the rice plants in the heading and flowering stage were treated by artificial temperature control (high temperature 38℃ (9:00-17:00) / 30℃ (17:00-9:00) and suitable temperature 30℃ (9:00-17:00) / 25℃ (17:00-9:00)), and the seed setting rate was used as the evaluation index. After years of strict screening, two different tolerance rice materials (high temperature resistant (HTR) and high temperature sensitive (HTS)) with clear phenotype and genetic stability were obtained. Figure 1 a).
[0195] The normal 14-day-old rice seedlings were placed in a 45℃ artificial climate box for high temperature stress treatment, and the humidity was kept at 70% during the treatment. The light was set to 12 hours of light and dark alternation. After 3 days of high temperature treatment, the plants were transferred to room temperature for recovery culture. After 7 days, the survival rate was counted. The survival rate of THS was significantly lower than that of HTR. Figure 1 b). The rice plants developed to the flat pillow stage were treated by artificial temperature control (38℃ (9:00-17:00) / 30℃ (17:00-9:00)) in the glass greenhouse. After 5 days, they were transferred to normal temperature for normal growth. The opening awn flowers were taken for microscopic examination in the heading and flowering stage. It was found that the pollen stainability (i.e. the pollen grains could be colored by 1% iodine-potassium iodide) of HTS was significantly reduced Figure 1 c), while the pollen stainability of HTR did not change significantly Figure 1 d). After maturation, the seed setting rate was investigated. The average seed setting rate of HTS was only 38.7%, while the average seed setting rate of HTR was 70.3% Figure 1 e and f), which indicated that the high temperature tolerance of HTR at the booting stage was significantly higher than that of HTS.
[0196] Example 2 Screening of differentially expressed genes of HTR and HTS anthers after high temperature stress and detection of fatty acid content
[0197] The anthers of HTR and HTS at the flowering stage were taken after the appropriate temperature and high temperature stress, respectively, and the anther tissues were peeled off and subjected to transcriptome sequencing. The sequencing result analysis results are shown in Figure 2 As shown in the table. A total of 2146 differentially expressed genes (1258 up-regulated and 888 down-regulated) were screened before and after HTR high temperature, and a total of 1765 differentially expressed genes (759 up-regulated and 1006 down-regulated) were screened before and after HTS high temperature Figure 2 In a), Venn analysis showed that there were 29 common differentially expressed genes Figure 2 In b). KEGG enrichment analysis of common differentially expressed genes before and after HTR and HTS high temperature showed that a large number of differential genes were enriched in fatty acid metabolism related signal pathways, such as Fatty acid metabolism, Fatty acid biosynthesis, Fatty acid degradation and Fatty acid elongation signal pathways Figure 2 In c).
[0198] Targeted metabolomics technology was used to compare and analyze the lipids of anther tissues at different development stages of HTR and HTS before and after high temperature stress. The results showed that a large number of long-chain unsaturated fatty acids (such as Linoleic acid, Linolenic acid, Margaric acid and γ-Linoenic acid) were significantly differentially accumulated Figure 2 In d). Further analysis of differential genes enriched in fatty acid metabolism related signal pathways found that OsACX2 gene (LOC_Os11g39220) was significantly differentially expressed before and after high temperature Figure 2 In e), which implies the importance of OsACX2 gene in the high temperature stress response of rice anther. The coding region of OsACX2 gene is 2100 bp in length (nucleotide sequence as shown in SEQ ID NO: 1, nucleotide sequence as shown in SEQ ID NO: 2), which is composed of seven exons. It is an acyl (fatty acyl) CoA oxidase (ACX) encoding gene, which participates in the first step reaction of long-chain fatty acid β oxidation in peroxisome, and is also a key rate-limiting enzyme in fatty acid degradation reaction. In addition, OsACX2 gene is also involved in the biosynthesis of plant hormone JA.
[0199] Example 3 OsACX2 knockout can significantly enhance the high temperature antioxidant capacity of rice at seedling stage
[0200] Gene editing technology (CRISPR / Cas9) was used to construct OsACX2 knockout (denoted as ko-acx2) and OsACX2 overexpression (denoted as OE-ACX2) rice plants, and the construction method is as follows:
[0201] Method for obtaining OsACX2 overexpression rice:
[0202] 1. Primer design. According to the OsACX2 gene cDNA sequence, PCR amplification primers were designed, F-ATGGCCACCGCCGCCT (SEQ ID NO: 3); R-AAAACCAACATGCTGAGTATACTGAGC (SEQ ID NO: 4);
[0203] 2. Total RNA extraction and cDNA synthesis of rice glume. The newly emerged spike tissue was repeatedly ground in liquid nitrogen, and total RNA was extracted using TRIZOL reagent. A small amount of RNA was reverse transcribed into cDNA under the action of reverse transcriptase.
[0204] 3. OsACX2 gene amplification. The primers synthesized in step 1 were used to amplify the OsACX2 gene with the cDNA synthesized in step 2 as the template.
[0205] 4. OsACX2 gene sequencing verification. The PCR product in step 3 was sequenced, and the sequencing results were compared with the OsACX2 gene cDNA sequence to ensure the correctness of the amplified sequence;
[0206] 5. OsACX2 gene and plant expression vector connection. The correct sequence in step 4 was connected with the plant expression vector (pCAM1300-GFP);
[0207] 6. Rice callus transformation and induction of regenerated plants. The vector constructed in step 5 was transformed into Agrobacterium, and the rice callus was infected with Agrobacterium liquid. The callus was taken out and placed on differentiation medium for induction and differentiation of regenerated plants;
[0208] 7. Positive plant identification. Fresh leaves of regenerated plants were taken to extract total RNA, which was reverse transcribed into cDNA for fluorescence quantitative PCR detection of OsACX2 gene. The wild type plant was used as a control, and the OsACX2 gene expression was significantly higher than that of the wild type plant.
[0209] Knocking out OsACX2 gene using CRISPR / Cas9 technology includes the following steps:
[0210] 1. Target selection. The target was selected according to the target design website (http: / / skl.scau.edu.cn / ), and finally the target was designed at 110-129 bp (AGACGACGAAGACGACCGGA (SEQ ID NO: 5)) of the genomic sequence;
[0211] 2. Target primer design. The target uses U3 promoter, so the target primer is designed as: F-GGCAGACGACGAAGACGACCGGA (SEQ ID NO: 6); R-TCTGCTGCTTCTGCTGGCCTCAAA (SEQ ID NO: 7);
[0212] 3. Target and U3 promoter connection. The target primer is mixed with the vector containing the U3 promoter, BsaI and T4 ligase are added, and the target sequence is inserted into the vector by cutting and connecting;
[0213] 4. Promoter and target fusion product amplification. The product in step 3 is used as a template, and F-CTCCGTTTTACCTGTGGAATCG (SEQ ID NO: 8) and R-CGGAGGAAAATTCCATCCAC (SEQ ID NO: 9) are used as amplification primers, respectively, to amplify the promoter and target fusion product;
[0214] 5. Target and editing vector connection. The PCR product in step 4 is mixed with the PYLCRISPR / Cas9 vector, and the target sequence is inserted into the editing vector by cutting and connecting;
[0215] 6. Rice callus transformation and induction of regenerated plants. The vector constructed in step 5 is transformed into Agrobacterium, and the rice callus is placed in the Agrobacterium liquid for infection. The callus is taken out and placed on the differentiation medium for induction and differentiation of regenerated plants;
[0216] 7. Positive plant identification. Fresh leaves of regenerated plants are taken to extract DNA, primers are designed upstream and downstream of the genomic target site for PCR amplification, and the amplification product is sequenced for detection. The wild type plant is used as a control. The plant with different sequencing results at the target site from the wild type is a positive plant with gene editing.
[0217] The expression amount of OsACX2 in the gene knockout and overexpression rice plants was detected by fluorescence quantitative PCR, wherein the OsACX2 amplification primer sequences are shown as SEQ ID NOs: 10-11. The results are shown in Table 1. Figure 3 As shown in Table 1, the expression amount of OsACX2 in the overexpression (OE-ACX2) rice plant is significantly increased, and the expression amount of OsACX2 in the gene knockout (ko-acx2) rice plant is significantly reduced, indicating that the ko-acx2 and OE-ACX2 rice plants are successfully constructed.
[0218] Seeds harvested from the above rice plants were incubated at room temperature, and the normally germinated seeds were transferred to 96-well plates (without bottom) and cultured in Yoshida solution (pH = 5.8) nutrient solution, which was replaced every 3 days. The culture conditions were: 28°C / 22°C (day / night), 16 hours of light / 8 hours of darkness cycle, and 70% relative humidity. When the seedlings grew to three leaves and one heart, high-temperature stress treatment at 45°C was performed. After 3 hours, samples were taken for DAB (3,3-diaminobenzidine, Solarbio, D7050) and NBT (nitro blue tetrazolium chloride, Solarbio, N8140) staining. The results of leaf staining showed that the contents of hydrogen peroxide (H2O2) and superoxide anion (O 2- ) were significantly increased in OE-ACX2 after high-temperature treatment (b in the middle). Figure 3 Further sampling was performed to monitor the real-time content of active oxygen in each rice in vitro leaf tissue under high-temperature stress (using a 5mm diameter puncher to collect leaf discs on fully expanded leaves, and placing the leaf discs in 100uL of reaction solution (the reaction solution consisted of L-012 (active oxygen probe): 4*10 -5 mM; horseradish peroxidase: 0.01mg; 100uL of 50mM Tris-HCl buffer with pH 7.5)). The results showed that OE-ACX2 had a higher peak of active oxygen burst than wild type (9522), while the overall trend of the ROS dynamic curve of ko-acx2 was flat (c in the middle). Figure 3 In addition, spectrophotometry was used to detect the contents of MDA (malondialdehyde (MDA) content detection kit, Solarbio, BC0025), SOD (superoxide dismutase (SOD) activity detection kit, Solarbio, BC0175), POD (peroxidase (POD) activity detection kit, Solarbio, BC0095), and CAT (catalase (CAT) activity detection kit, Solarbio, BC0205) in the leaves of each rice plant. The detection results showed that there was no significant difference in the above indicators except that SOD was significantly reduced in OE-ACX2 before high-temperature treatment. After high-temperature treatment, MDA was significantly increased in the overexpression material (OE-ACX2), and CAT content was significantly reduced (d in the middle). Figure 3 POD and CAT contents were significantly increased in ko-acx2 (d in the middle). Figure 3 The above results showed that the active oxygen generated by ko-acx2 rice plants under high-temperature stress was less, the integrity of the biological membrane system was higher, and the high-temperature tolerance was stronger.
[0219] Example 4 OsACX2 knockout can significantly improve the survival rate of rice seedlings under high temperature
[0220] OsACX2 knock-out and over-expression rice seeds constructed in Example 3 were vernalized at room temperature, and the normally germinated seeds were transferred to 96-well plates (without bottom) and cultured with Yoshida solution (pH = 5.8) nutrient solution, which was replaced every 3 days. The culture conditions were: 28℃ / 22℃ (day / night), 16 hours of light / 8 hours of darkness cycle, and 70% relative humidity. When the seedlings grew to three leaves and one heart, they were subjected to high temperature stress at 45℃ for 3 days, and then transferred to normal temperature for normal growth. After 7 days of recovery culture, the survival rate of each rice seedling was counted. The results showed that under high temperature stress, over-expression of OsACX2 gene increased the high temperature sensitivity of rice seedlings in the seedling stage, and the high temperature survival rate was only 5.7%, while OsACX2 knockout significantly reduced the high temperature sensitivity of rice seedlings in the seedling stage, and the high temperature survival rate was 81.2%, which had good high temperature resistance. The high temperature survival rate of wild type plants was 66.9% Figure 4 In the middle a and b).
[0221] The JA (jasmonic acid) content in the seedling leaves of each rice was detected by liquid chromatography. The detection results showed that compared with the wild type, over-expression of OsACX2 gene could induce a significant increase in JA content in the seedling leaves, while gene knockout led to a decrease in content Figure 4 In the middle c).
[0222] JA was sprayed on each rice seedling plant in vitro (JA concentration was 30 mmol / L, 3 days of high temperature treatment, once a day in the morning), and the high temperature resistance of each rice plant after spraying JA was investigated. The in vitro spraying test results showed that external spraying of JA did not significantly improve the high temperature resistance of each transgenic rice seedling Figure 4 In the middle d).
[0223] The recombinant plasmid of OsACX2 gene and eGFP was transformed into Agrobacterium, and the positive bacterial plaque was expanded and the bacterial body was collected. The bacterial body was diluted with an infection solution (10 mM MES; 10 mM MgCl2; 200 μM acetyl-syringone) (OD 600 = 0.8-1.0), and a syringe was used to inject tobacco leaves from the back of the leaves. It was found under a laser confocal microscope that OsACX2 was located in the peroxisome Figure 4 In the middle e). GUS staining results showed that OsACX2 was mainly expressed in the husk and anther Figure 4 In the middle f).
[0224] Example 5 Analysis of anther fatty acid content of transgenic rice under high temperature stress
[0225] Rice plants were sown and transplanted normally in the field, with normal field management during the period. Once the rice reached the eurythema stage, they were transferred to a Percival artificial climate chamber and treated with 38℃ (7:00-19:00) / 30℃ (19:00-7:00 the next day) for 3 days. Anther tissue was then isolated for long-chain fatty acid-targeted metabolomics analysis. The results are as follows: Figure 5 As shown in Figure a, OsACX2 overexpressing rice plants showed upregulation of 7 long-chain fatty acids and downregulation of 19. OsACX2 knockout rice plants showed upregulation of 25 and downregulation of 1. A total of 26 long-chain fatty acids showed significant differences between overexpressing and knockout rice, with 25 upregulated and 1 downregulated. The hierarchical clustering analysis results of the differential fatty acids are shown below. Figure 5 As shown in Figure b, OsACX2 knockout significantly increased fatty acid content in rice compared to overexpression. Differential fatty acid KEGG enrichment analysis revealed that a large number of fatty acids were enriched in the Biosynthesis of unsaturated fatty acids, Metabolic pathways, and Fatty acid biosynthesis signaling pathway. Figure 5 c). Expression trend analysis showed that the content of a large number of fatty acids decreased in OsACX2 overexpressing rice, while they accumulated in large quantities in OsACX2 knockout rice, such as in Cluster 3, Cluster 4, and Cluster 5. Figure 5 (d). Radar chart analysis of the top 10 differentially expressed fatty acids showed that oleic acid had the most significant difference (0.39-fold), followed by all-cis-7,10,13,16,19-docosapentaenoic acid and elaidic acid. Figure 5 (e and f).
[0226] Example 6: Increased reactive oxygen species content in pollen of gene knockout rice plants under high temperature stress
[0227] High-temperature stress was applied to all rice plants as in Example 5. After treatment, the plants were transferred to normal temperature for growth. Mature pollen was collected at the heading and flowering stage, and its reactive oxygen species (ROS) content was measured (PI-FDA staining). PI (propidium benzoate) induced red fluorescence in inactive microspores, while FDA (fluorescein diacetate) induced green fluorescence in active microspores. PI-FDA staining results showed that OsACX2 overexpression induced a significant decrease in the number of active pollen in transgenic plants, while OsACX2 knockout further increased the number of active pollen compared to the wild type. Figure 6 ).
[0228] Example 7: Increased pollen viability in OsACX2 knockout rice plants under high temperature stress
[0229] High-temperature stress was applied to all rice plants, as in Example 5. After treatment, the plants were transferred to normal temperature for growth. Mature pollen was collected at the heading and flowering stage and stained with I2-KI. The I2-KI staining results showed that overexpression of the OsACX2 gene led to a decrease in pollen stainability. Figure 7 In vitro pollen germination studies showed that, compared to the wild type, OsACX2 knockout plants exhibited significantly higher pollen germination rates, while overexpression plants showed significantly lower pollen germination rates. Figure 7 Comparison of stigma pollen counts revealed that overexpression plants had almost no pollen on their stigmas, while knockout plants had significantly more stigma pollen than wild-type plants. Figure 7 ).
[0230] Example 8: OsACX2 participates in the regulation of high temperature tolerance in rice during the booting stage.
[0231] Rice plants were sown and transplanted normally in the field, with normal field management during this period. Once the rice reached the booting stage, they were transferred to a Percival artificial climate chamber. The panicles were tagged and marked as being in the flattened stage on the day of transplanting. After 3 days of high-temperature treatment at 38℃ (7:00-19:00) / 30℃ (19:00-7:00 the next day), they were transferred to normal temperature for normal growth. The results were significant; the young panicles of OsACX2-overexpressing plants showed obvious whitening. Figure 8 (b) Anthers relative to wild type ( Figure 8 (a, d, and g) decreased significantly ( Figure 8 (e and h). OsACX2 knockout plants showed no significant changes compared to wild-type plants ( Figure 8 (c, f, and i). Pollen microscopy showed that pollen grains in wild-type and OsACX2 knockout plants developed normally. Figure 8 (j and l), while overexpression of pollen grains in plants showed morphological abnormalities (j and l). Figure 8 (k). This indicates that overexpression of OsACX2 induces a decrease in high-temperature tolerance in rice during the booting stage, while OsACX2 knockout plants are unaffected by high-temperature tolerance.
[0232] Example 9: OsACX2 negatively regulates the high-temperature tolerance of rice pollen
[0233] High-temperature stress was applied to all rice plants, as in Example 5, and the JA content in the rice anther tissue was measured. Results showed that the JA content in OsACX2 overexpressing plants was significantly higher than that in wild-type plants, while the content in gene knockout plants was significantly lower. Figure 9 (a) Compared to the wild type, there was no significant difference in the number of spikelets in the transgenic plants. Figure 9In the middle b), each rice is further cultivated to rice ear ripening, and the rice ear ripening rate of each rice is counted, and the results show that the average ripening rate of the gene knockout plants under high temperature stress is 86.3%, the wild type ripening rate is 84.3%, and the overexpression plant ripening rate is extremely significantly reduced, only 39.03% Figure 9 In the middle c, d and e).
[0234] The embodiments of the application are described in detail above with reference to the drawings, but the application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the application. In addition, the embodiments of the application and the features in the embodiments can be combined with each other without conflict.
Claims
1. Knockout OsACX2 Application of genes in a1) or a2): a1) Improve the high-temperature resistance of rice; a2) Breeding of high-temperature resistant rice varieties; The OsACX2 The nucleotide sequence of the gene is shown in SEQ ID NO:
2.
2. The application according to claim 1, characterized in that, The improvement of rice's high-temperature resistance includes increasing the rice's high-temperature survival rate, increasing its high-temperature antioxidant capacity, enhancing the vitality of rice pollen under high temperatures, increasing the rice pollen germination rate under high temperatures, and increasing the rice seed setting rate under high temperatures.
3. OsACX2 The use of inhibitors in at least one of b1) to b4): b1) Improve the high-temperature resistance of rice; b2) Prepare products that improve the high-temperature resistance of rice; b3) Breeding of high-temperature resistant rice varieties; b4) Prepare products for the breeding of heat-resistant rice varieties; The OsACX2 The nucleotide sequence is shown in SEQ ID NO:2; The OsACX2 Inhibitors include at least one of c1) to c9): c1) Target OsACX2 The CRISPR / Cas system; c2) encodes the nucleic acid molecule of c1); c3) An expression cassette containing the nucleic acid molecule described in c2); c4) A recombinant vector containing the nucleic acid molecule described in c2); c5) A recombinant vector containing the expression cassette described in c3); c6) Recombinant cells containing the nucleic acid molecules described in c2); c7) Recombinant cells containing the expression cassette described in c3); c8) Recombinant cells containing the recombinant vector described in c4); c9) Recombinant cells containing the recombinant vector described in c5); The CRISPR / Cas system includes a target OsACX2 sgRNA or sgRNA-related biological materials; The nucleotide sequence of the sgRNA is shown in SEQ ID NO:5; Biological materials associated with sgRNA include at least one of d1) to d8): d1) Nucleic acid molecules encoding sgRNA; d2) An expression cassette containing the nucleic acid molecule described in d1); d3) A recombinant vector containing the nucleic acid molecule described in d1); d4) A recombinant vector containing the expression cassette described in d2); d5) Recombinant cells containing the nucleic acid molecules described in d1); d6) Recombinant cells containing the expression cassette described in d2); d7) Recombinant cells containing the recombinant vector described in d3); d8) Recombinant cells containing the recombinant vector described in d4).
4. The application according to claim 3, characterized in that, The sgRNA-associated biological material also includes at least one of d9) to d12): d9) Recombinant microorganisms containing the nucleic acid molecules described in d1); d10) Recombinant microorganisms containing the expression cassette described in d2); d11) Recombinant microorganisms containing the recombinant vector described in d3); d12) Recombinant microorganisms containing the recombinant vector described in d4); and / or The OsACX2 Inhibitors also include at least one of c10 to c13: c10) Recombinant microorganisms containing the nucleic acid molecules described in c2); c11) Recombinant microorganisms containing the expression cassette described in c3); c12) Recombinant microorganisms containing the vector described in c4); c13) Recombinant microorganisms containing the vector described in c5).
5. The application according to claim 3, characterized in that, The improvement of rice's high-temperature resistance includes increasing the rice's high-temperature survival rate, increasing its high-temperature antioxidant capacity, enhancing the vitality of rice pollen under high temperatures, increasing the rice pollen germination rate under high temperatures, and increasing the rice seed setting rate under high temperatures.
6. An sgRNA, the nucleotide sequence of which is shown in SEQ ID NO:
5.
7. A biomaterial relating to the sgRNA of claim 6, characterized in that, The biomaterial comprises at least one of e1) to e8): e1) A nucleic acid molecule encoding the sgRNA of claim 6; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1); e4) A recombinant vector containing the expression cassette described in e2); e5) Recombinant cells containing the nucleic acid molecules described in e1); e6) Recombinant cells containing the expression cassette described in e2); e7) Recombinant cells containing the recombinant vector described in e3); e8) Recombinant cells containing the recombinant vector described in e4).
8. The application according to claim 7, characterized in that, The biomaterial further comprises at least one of e9) to e12): e9) Recombinant microorganisms containing the nucleic acid molecules described in e1); e10) Recombinant microorganisms containing the expression cassette described in e2); e11) Recombinant microorganisms containing the recombinant vector described in e3); e12) Recombinant microorganisms containing the recombinant vector described in e4).
9. A CRISPR / Cas system comprising the sgRNA of claim 6 and / or the biological material of claim 7 or 8.
10. Application of any term from f1) to f4) in any term from a1) to a4): f1) The sgRNA according to claim 6; f2) The biomaterial as described in claim 7 or 8; f3) The CRISPR / Cas system as described in claim 9; f4) Reagents containing the sgRNA of claim 6, the biological material of claim 7 or 8, or the CRISPR / Cas system of claim 9; a1) Improve the high-temperature resistance of rice; a2) Prepare products that improve the high-temperature resistance of rice; a3) Breeding of high-temperature resistant rice varieties; a4) Prepare products for the breeding of high-temperature resistant rice varieties.
11. The application according to claim 10, characterized in that, The improvement of rice's high-temperature resistance includes increasing the rice's high-temperature survival rate, increasing its high-temperature antioxidant capacity, enhancing the vitality of rice pollen under high temperatures, increasing the rice pollen germination rate under high temperatures, and increasing the rice seed setting rate under high temperatures.
12. A method comprising knocking out rice OsACX2 Steps: The method is either g1 or g2). g1) Improve the high-temperature resistance of rice; g2) Breeding of high-temperature resistant rice varieties; The OsACX2 The nucleotide sequence of the gene is shown in SEQ ID NO:
2.
13. The method according to claim 12, characterized in that, The improvement of rice's high-temperature resistance includes increasing the rice's high-temperature survival rate, increasing its high-temperature antioxidant capacity, enhancing the vitality of rice pollen under high temperatures, increasing the rice pollen germination rate under high temperatures, and increasing the rice seed setting rate under high temperatures.
14. The method according to claim 13, characterized in that, The knockout rice OsACX2 The step involves introducing a reagent containing the sgRNA of claim 6, the biological material of claim 7 or 8, or the CRISPR / Cas system of claim 9 into rice.
Citation Information
Patent Citations
Application of HTA1 gene or encoded protein thereof in regulation and control of heat resistance of rice
CN118240873A
Application of OsSAP3 gene in regulation and control of high-temperature resistance of rice in seedling stage
CN119144650A