SNP (Single Nucleotide Polymorphism) molecular marker related to resistance of corn head smut and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker related to corn head smut resistance and application of the SNP molecular marker. The molecular marker is DNdCAPs837 and is located at the 837th site of a ZmMYB42 gene of a No.4 chromosome of corn, and a mutant basic group is G / C. The corn genome total DNA is used as a template, a dCAPS primer pair is used for PCR amplification, the size of an amplification product is 224bp, the 27th basic group is a mutation site, the site of a susceptible material is C and cannot be cut by KpnI restriction endonuclease, and the site of a disease-resistant material is G and can be cut into two fragments of 197bp and 27bp by KpnI restriction endonuclease. The head smut resistance identification of plants can be realized based on the detection result of the molecular marker. The molecular marker provided by the invention can be used for cultivating disease-resistant plants, provides a new technical means and method basis for screening and creating a head smut-resistant new material, and has important value in the field of plant breeding.

Description

Technical Field

[0001] The invention relates to the technical field of plant breeding, in particular to a SNP molecular marker associated with corn head smut resistance and an application thereof. Background Art

[0002] Corn is an important crop for food, feed and ethanol, and is of great significance to economic development. Corn head smut mainly harms the male and female ears of corn. Once the disease occurs, it can cause total crop failure, causing serious damage to corn yield. Therefore, it is of great significance to explore the genes related to corn head smut resistance, and then screen and create new corn varieties resistant to head smut to improve the resistance to corn head smut.

[0003] When plants are under stress, they undergo a series of physiological changes. During the evolution process, plants have formed complex adaptive mechanisms at the morphological, physiological and biochemical, cellular and molecular levels to protect themselves from harm. Among them, transcription factors such as MYB are involved in a variety of physiological and biochemical processes such as cell morphology, stress signal perception and transduction, and hormone response. This type of transcription factor binds to the cis-acting elements in the promoter region of downstream target genes through DBD, regulates the expression of downstream target genes, and thus transduces corresponding regulatory signals. There are not many reports on MYB genes in corn resistance to head smut. Summary of the invention

[0004] The purpose of the present invention is to provide a SNP molecular marker related to corn head smut resistance and application thereof.

[0005] The present invention has discovered the relevant ZmMYB42 Gene, analyze the sequence variation of its coding region in different maize inbred lines, and then conduct association analysis with the head smut resistance of the inbred lines, and then explore the associated sites and develop molecular markers, which will provide a way and reference for the future breeding of new maize varieties resistant to head smut, provide a basis for the study of the molecular regulatory mechanism of maize resistance to head smut, and have practical significance for further improving maize yield and quality. In the process of the study, a SNP molecular marker related to the ability to resist maize head smut was obtained, which can be used for molecular marker-assisted breeding of maize lines resistant to head smut.

[0006] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a SNP molecular marker associated with corn head smut resistance, the SNP molecular marker comprising corn ZmMYB42 The gene sequence as shown in SEQ ID NO: 1 is a nucleotide sequence with a polymorphism of G / C at the 27th position from the 3′ to 5′ end; the corn germplasm resources with the polymorphism of G have stronger resistance to head smut than the corn germplasm resources with the polymorphism of C.

[0007] Furthermore, the cornZmMYB42 The gene name in the Maize GDB database (https: / / maizegdb.org / ) is Zm00001d053220 .

[0008] In a second aspect, the present invention provides a primer pair for amplifying the SNP molecular marker, including an upstream primer shown in SEQ ID NO:2 and a downstream primer shown in SEQ ID NO:3.

[0009] In a third aspect, the present invention provides a detection reagent or kit containing the primer pair.

[0010] In a fourth aspect, the present invention provides any one of the following applications of the SNP molecular marker, or the primer pair, or the detection reagent or kit: 1) For identifying the head smut resistance ability of plants; 2) For identifying, improving or molecular marker-assisted breeding of head smut-resistant plant germplasm resources; 3) For early prediction of head smut-resistant plant materials.

[0011] Further, the plant is maize.

[0012] In a fifth aspect, the present invention provides a method for identifying the head smut resistance of maize, the method comprising: detecting the above SNP molecular marker in the maize to be tested, and judging the head smut resistance of the maize to be tested according to the detection result.

[0013] Further, genomic DNA of the maize to be tested is extracted, and PCR amplification is carried out using the primer pair shown in SEQ ID NO:2-3 or a detection reagent or kit containing the primer pair, and the head smut resistance of the maize to be tested is judged according to the amplification result.

[0014] Preferably, the PCR amplification reaction system is:

[0015] The PCR amplification program is:

[0016] Further, judging the head smut resistance of the maize to be tested according to the amplification result includes: carrying out KpnI restriction endonuclease digestion on the amplification product, and the maize to be tested with two characteristic bands of 197 bp and 27 bp in the digestion product has higher head smut resistance compared with the maize to be tested with one characteristic band in the digestion product.

[0017] By means of the above technical solutions, the present invention has at least the following advantages and beneficial effects: The present invention is based on genes related to head smut resistance in maizeZmMYB42 , by analyzing the sequence variations in the CDS regions of genes in different maize inbred lines, conducting association analysis with the head smut resistance phenotype indicators of the inbred lines, mining associated loci, analyzing the restriction enzyme sites of the loci and selecting restriction endonucleases, a SNP molecular marker related to the head smut resistance gene ZmMYB42 of plants was developed. By detecting the polymorphisms of this SNP molecular marker in plants, the detection of head smut resistance in plants can be achieved. The SNP molecular marker provided by the present invention can be applied to improving the germplasm resources of maize, cultivating maize varieties resistant to head smut, increasing maize yield and quality, and has important value for the maize planting field. ZmMYB42 BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the ZmMYB42 gene nucleotide diversity provided in Example 1 of the present invention.

[0019] Figure 2 It is the genotype detection result of the molecular marker DNdCAPS837 provided in Example 2 of the present invention; wherein M: Trans 2k, and the PCR products of Huangzaosi, Chang 7-2, Dong 237, Diangu 11A, Dong 46, Hai 268, Liao 3162, PH09B, and Dan 6263 are in wells 1-9 respectively; the KpnI digestion products of Ji 1037, Qi 319, Shen 5003, L237, KW5G321, and H1208 are in wells 10-15 respectively.

[0020] Figure 3 It is the verification result of the molecular marker DNdCAPS837 in some inbred lines provided in Example 3 of the present invention; wherein note: M: Trans 2K; the remaining lanes are the DNA of the verification materials respectively. The materials that can be digested by the restriction enzyme into 27bp + 197bp are L237, Ji 1037, PH4CV, KX, T4312, Shen 5003, H1208, Qi 205, Lv 983, Jing 388, KW5G321, Liao 7990, Xin 444, Ji 818, Jia 33, He 604, Liao 2345, and Liao 3162. DETAILED DESCRIPTION OF THE INVENTION

[0021] The present invention provides a molecular marker related to the maize head smut resistance gene MYB and its application.

[0022] The present invention adopts the following technical solutions: In the first aspect, the molecular marker related to the maize head smut resistance gene MYB provided by the present invention refers to a SNP molecular marker related to maize head smut resistance, and the molecular marker is located on chromosome 4 of maize ZmMYB42At the 837th position of the gene, the mutated base is G / C, and the molecular marker is named DNdCAPs837.

[0023] Furthermore, the ZmMYB42 gene has the gene name Zm00001d053220 in the Maize GDB database.

[0024] Furthermore, the molecular marker includes a nucleic acid with the nucleotide sequence shown in SEQ ID NO:1, with a mutation at the 27th position from the 3'-5' end, and the mutated base is G / C (N is G or C).

[0025] Furthermore, for the molecular marker, plants with the G locus have stronger head smut resistance compared to plants with the C locus.

[0026] In a second aspect, the present invention provides a primer pair. The primer pair (dCAPS primer) includes the nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:3. When designing the primers, the 25th base in the sequence is replaced by T to conform to the restriction enzyme site GGTAC / C of KpnI. After PCR amplification, the base at the mutation site in the disease-resistant material is G, which conforms to the restriction enzyme site of the restriction endonuclease KpnI, and two characteristic bands will be generated after digestion. In the susceptible material, the base at the mutation site is C, and the restriction endonuclease KpnI cannot recognize the restriction enzyme site, and the digestion product is only one characteristic band.

[0027] Forward primer: 5’- CAACCTGGACCTCTGCATCAGC -3’ (SEQ ID NO:2); Reverse primer: 5’- TGGTCCTGAGCCCCAGGAAGTGGTA -3’ (SEQ ID NO:3).

[0028] In a third aspect, the present invention provides a kit, including the aforementioned molecular marker or the aforementioned primer pair.

[0029] In a fourth aspect, the present invention provides the use of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned kit in identifying the head smut resistance of plants.

[0030] The present invention further provides the use of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned kit in any of the following: (1) Cultivating transgenic plants resistant to head smut; (2) Molecular marker-assisted breeding of plants; (3) Improving the germplasm resources of plants.

[0031] Furthermore, the plant is maize.

[0032] Fifth aspect, the present invention provides a method for identifying the resistance of maize to head smut, the method comprising: detecting the polymorphism of the molecular marker in a plant sample to be tested, and judging the resistance of the plant sample to head smut according to the detection result.

[0033] Further, the method comprises: extracting the genomic DNA of the plant sample to be tested, performing PCR amplification using the primer pair or the kit as described above, and judging the resistance of the plant to head smut according to the amplification result.

[0034] Further, the judging of the resistance of the plant to head smut according to the amplification result includes: performing digestion of the amplification product with KpnI restriction endonuclease, and plants obtaining two fragments of 197 bp and 27 bp have higher resistance to head smut.

[0035] The following examples are used to illustrate the present invention, but do not limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0036] Example 1 Maize ZmMYB42 Sequence variation analysis of the gene 1. ZmMYB42 The gene has the gene name Zm00001d053220 in the Maize GDB database, the genome is located on chromosome 4, with a full length of 898 bp, and its sequence is included in SEQ ID NO:4. Its CDS sequence is 783 bp in total, encoding 260 amino acids. ZmMYB42 The gene consists of 2 exons and 1 intron.

[0037] The present invention designed primers (Table 1) to amplify its DNA sequence in maize inbred lines with different resistances to head smut, used the Snap Gene software to extract the CDS region of the ZmMYB42 gene, and used the DNA SPv 6.0 software to perform sequence variation analysis on the CDS region of the ZmMYB42 gene. Taking 100 bp as the sliding window and 25 bp as the step length, the results showed that the maximum π value of nucleotide polymorphism in the sequence was 0.02191, in the range of 483-582 bp, indicating that this region had rich variation and higher polymorphism than other exon regions.

[0038] Table 1 ZmMYB42 Gene sequence primers

[0039] 2. ZmMYB42 Gene haplotype analysis A total of 16 SNPs were detected in the CDS regions of 124 inbred lines with different resistance levels in the Northeast China region. The SNPs were located at positions 200, 251, 286, 294, 322, 464, 496, 505, 545, 552, 569, 609, 631, 697, 725, and 837. The Indel sites were located at two positions, 271 - 276 and 711 - 713 (Tables 2 and 3). According to the nucleotide variation types and occurrence numbers, the polymorphic sites were typed. A total of 15 haplotypes were detected using DNA SPv6.0 software, and the haplotype polymorphism was 0.899. The main haplotypes were HAP1, HAP3, HAP4, HAP5, HAP8, HAP10, and HAP14, accounting for 72.8% of the tested materials, and the remaining haplotypes belonged to minor variations. Among them, HAP5 included 32 tested inbred lines, including 4 head smut-resistant inbred lines, namely W9706, 7884 - 7Ht, 7884, and A4 - 227; the remaining 28 tested materials included 6 moderately head smut-resistant inbred lines, namely K10, Jia 28, M60, Shen 8078, HR0110, and DN - 1 - 2; 17 susceptible inbred lines including KWS49, Jia 33, and D22; and 5 highly susceptible inbred lines consisting of 8902, Tie T0403, M502, Jing 724, and HD568. It was preliminarily considered that the HAP5 haplotype was an excellent haplotype (Table 4).

[0040] Table 2 ZmMYB42 SNP positions in the CDS region of the gene

[0041] Table 3 ZmMYB42 Indel positions in the CDS region of the gene

[0042] Table 4 ZmMYB42 Inbred lines corresponding to the haplotypes

[0043] 3、 ZmMYB42 Analysis of amino acid level changes in the gene In this invention, it was found in maize inbred lines with different resistance levels ZmMYB42 There was 1 non-synonymous mutation SNP in the CDS region of the gene. The mutation site was located at SNP837 (G > C), which caused an amino acid mutation in the second exon and might change the structure and physiological function of the protein.

[0044] 4、 ZmMYB42 Analysis of gene nucleotide diversity In this invention, DNA SPv 6.0 software was used for ZmMYB42Sequence variation analysis was performed on the CDS region of the gene. With a sliding window of 100 bp and a step size of 25 bp, the results showed that the maximum π value of nucleotide polymorphism in the sequence was 0.02191, within the range of 483 - 582 bp, indicating that this region had rich variation and higher polymorphism than other exon regions of the sequence ( Figure 1 ).

[0045] Example 2 ZmMYB42 Development of dCAPS functional markers for the gene 1、 ZmMYB42 Association analysis of candidate genes with head smut resistance in maize inbred lines Combined with the results of head smut resistance identification of maize inbred lines, the present invention used TASSEL 5.0 software to ZmMYB42 associate SNPs in the CDS region of the gene with the disease-resistant phenotype. The results are shown in Table 5. At the 0.05 level, SNPs 273, 276, 277, 402, 702, 703, 704, 716, 883, and 884 were significantly associated with disease resistance (P < 0.05), and the SNP837 locus was extremely significantly associated with disease resistance (P < 0.01). This locus had the largest phenotypic contribution rate, which was 18.11%.

[0046] Table 5 ZmMYB42 Results of correlation analysis between gene sequence variation and head smut resistance in maize inbred lines

[0047] 2、 ZmMYB42 Design of dCAPS functional markers for the gene Based on the results of the association analysis of the CDS region of the ZmMYB42 gene and the results of amino acid level changes, the SNP837 (G / C) locus, which was extremely significantly associated with head smut resistance in maize inbred lines (P < 0.01) and had the largest phenotypic contribution rate, was selected for dCAPS marker development. The online website dCAPS Finder was used to analyze the best restriction enzyme cleavage site and restriction enzyme to develop functional markers. The marker transformed from the SNP837 (G / C) locus was named DNdCAPs837. The full length of the PCR amplification was 224 bp, and the 27th base was the mutation site. At this site, the susceptible material was C and could not be cut by the KpnI restriction enzyme, while the resistant material was G and could be cut into two fragments of 197 bp and 27 bp by the KpnI restriction enzyme ( Figure 2 ).

[0048] Example 3 Verification of the DNdCAPS837 functional marker In the present invention, 254 maize inbred lines with different disease resistance levels were selected to verify the DNdCAPs837 marker. The specific enzyme digestion results are shown in Figure 3 , and the genotypes of the materials that can be cut into 197 and 27 bp bands by restriction endonucleases showed disease resistance, while the genotypes that could not be cut showed susceptibility. Among them, there were 5 inbred lines, namely Ji 1037, Xin 444, T4312, H1208, and KX, which showed high resistance (HR) in the resistance identification; there were 4 materials, namely L237, KW5G321, Liao 7990, and Liao 3162, which showed disease resistance in the resistance identification; there were 5 materials, namely PH4CV, Qi 205, Lv 983, Jing 388, and Ji 818, which showed medium disease resistance in the resistance identification; Jia 33, He 604, and Liao 2345 reached the susceptible level in the resistance identification; Shen 5003 showed high susceptibility in the resistance identification. In summary, among the 254 inbred lines, 18 materials showed the genotype of resistance to head smut, and among them, 14 families had the phenotype of resistance to head smut at the medium resistance level or above. The coincidence rate of genotype and phenotype was 77.78%. In conclusion, DNdCAPs837 can effectively identify the SNP837 (G / C) locus.

[0049] In summary, it is shown that the molecular marker DNdCAPs837 developed based on the maize ZmMYB42 gene can be used to screen maize inbred lines resistant to head smut. In view of the current lack of disease-resistant germplasm resources, disease-resistant varieties can be more accurately screened in different groups, which helps in the selection of maize disease-resistant varieties. In addition, by using the DNdCAPs837 marker in combination with the previously developed maize head smut resistance markers, the screening accuracy can be improved, the error rate of disease-resistant germplasm screening can be reduced, and the screening time can be shortened.

[0050] Although the present invention has been described in detail with general descriptions and specific embodiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. A SNP molecular marker associated with corn head smut resistance, characterized in that: The SNP molecular marker contains corn ZmMYB42 The gene sequence as shown in SEQ ID NO: 1 is a nucleotide sequence with a polymorphism of G / C at the 27th position from the 3′ to 5′ end; the corn germplasm resources with the polymorphism of G have stronger resistance to head smut than the corn germplasm resources with the polymorphism of C.

2. A primer pair for amplifying the SNP molecular marker according to claim 1, characterized in that: It includes an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:

3.

3. A detection reagent or kit containing the primer pair according to claim 2.

4. Any of the following uses of the SNP molecular marker according to claim 1, or the primer pair according to claim 2, or the detection reagent or kit according to claim 4: 1) Used to identify the resistance of plants to head smut; 2) Used for identification and improvement of plant germplasm resources resistant to head smut or molecular marker-assisted breeding; 3) Used for early prediction of plant materials resistant to head smut.

5. The use according to claim 4, characterized in that: The plant is corn.

6. A method for identifying resistance to corn head smut, characterized in that: The method comprises: detecting the SNP molecular marker as claimed in claim 1 on the tested corn, and judging the head smut resistance of the tested corn according to the detection result.

7. The method according to claim 6, characterized in that Extract the genomic DNA of the corn to be tested, perform PCR amplification using the primer pair described in claim 2 or the detection reagent or kit described in claim 3, and determine the head smut resistance of the corn to be tested based on the amplification result.

8. The method according to claim 6 or 7, characterized in that: Judging the head smut resistance of the tested corn according to the amplification results includes: digesting the amplified product with KpnI restriction enzyme, and the tested corn with two characteristic bands of 197 bp and 27 bp in the digestion product has higher head smut resistance than the tested corn with one characteristic band in the digestion product.

Images