Preparation method of SEBS / AgNWs nano composite film as well as product and application of SEBS / AgNWs nano composite film

Abstract

The invention discloses a preparation method of an SEBS / AgNWs nano-composite film as well as a product and application of the SEBS / AgNWs nano-composite film. The preparation method comprises the following steps: dissolving SEBS in a mixed solvent of chloroform and isopropanol to obtain an SEBS solution, adding a silver nanowire solution, uniformly mixing to obtain an SEBS / AgNWs mixed solution, coating a substrate with the SEBS / AgNWs mixed solution, and drying to obtain the SEBS / AgNWs nano composite film. The composite film can remarkably improve the wound healing effect, has a good antibacterial effect, provides a more effective treatment method for wound nursing management, and improves the treatment result of a patient.

Description

Technical Field

[0001] The present invention belongs to the technical field, and specifically relates to a preparation method, products and applications of SEBS / AgNWs nanocomposite films. Background Art

[0002] The thermoplastic elastomer styrene-ethylene-butene-styrene (SEBS) has excellent mechanical properties and biocompatibility. In addition, it can also be used as a substrate for drug-loaded particles and nanoparticles, and SEBS nanoparticles exhibit good drug loading capacity and controlled release characteristics in drug delivery.

[0003] Silver nanowires (AgNWs) are an effective antibacterial material that kills a variety of microorganisms by disrupting cell membranes and interfering with metabolic activities. AgNWs have good biocompatibility and persistent antibacterial properties, and they can be customized according to application requirements, so they are widely used in antibacterial dressings and coatings. Summary of the Invention

[0004] The purpose of this part is to outline some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments.

[0005] As one aspect of the present invention, the present invention provides a preparation method of SEBS / AgNWs nanocomposite films, wherein: SEBS is dissolved in a mixed solvent of chloroform and isopropanol to obtain a SEBS solution, and a silver nanowire solution is added and mixed evenly to obtain a SEBS / AgNWs mixed solution. The SEBS / AgNWs mixed solution is coated on a substrate and dried to obtain a SEBS / AgNWs nanocomposite film.

[0006] As a preferred scheme of the preparation method of the SEBS / AgNWs nanocomposite film described in the present invention: the concentration of SEBS in the SEBS solution is 60-100 mg / mL.

[0007] As a preferred scheme of the preparation method of the SEBS / AgNWs nanocomposite film described in the present invention: the volume ratio of chloroform to isopropanol is 5:2.

[0008] As a preferred scheme of the preparation method of the SEBS / AgNWs nanocomposite film described in the present invention: in the silver nanowire solution, the concentration of silver nanowires is 20-30 mg / ml.

[0009] As a preferred scheme of the preparation method of the SEBS / AgNWs nanocomposite film described in the present invention: the solvent of the silver nanowire solution includes isopropanol, and the average diameter of the silver nanowires is 20-30 nm.

[0010] As a preferred embodiment of the preparation method of the SEBS / AgNWs nanocomposite film of the present invention: the SEBS / AgNWs mixed solution is prepared by mixing the SEBS solution and the silver nanowire solution in a volume ratio of 5:1.

[0011] As a preferred embodiment of the preparation method of the SEBS / AgNWs nanocomposite film of the present invention: the step of adding the silver nanowire solution and mixing evenly includes ultrasonic treatment for even mixing.

[0012] As a preferred embodiment of the preparation method of the SEBS / AgNWs nanocomposite film of the present invention: the drying process includes drying at room temperature.

[0013] Advantages of the present invention: The present invention synthesizes a composite film through a phase separation technique and loads the surface of AgNWs on a porous matrix. Experimental results show that SEBS / AgNWs has good antibacterial effects against microbial infections, thereby enhancing tissue regeneration and reducing inflammation. Moreover, the composite film of the present invention can significantly improve the wound healing effect, provide a more effective treatment method for wound care management, and improve the treatment outcomes of patients. Description of the Drawings

[0014] To more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for the description of the embodiments. Among them:

[0015] Figure 1 For the preparation and characterization of SEBS / AgNWs.

[0016] Figure 2 For the ROS scavenging ability of SEBS / AgNWs.

[0017] Figure 3 For the in vitro antibacterial performance of SEBS / AgNWs.

[0018] Figure 4 For the in vitro antibacterial mechanism of SEBS / AgNWs.

[0019] Figure 5 For the study of SEBS / AgNWs promoting the healing of wound infections in vivo.

[0020] Figure 6 For the pathological analysis of SEBS / AgNWs promoting wound healing.

[0021] Figure 7 For the in vivo biosafety of SEBS / AgNWs. Detailed Embodiments

[0022] To make the above objects, features, and advantages of the present invention more apparent and understandable, the following specifically describes the specific embodiments of the present invention in detail in conjunction with specific embodiments.

[0023] Styrene-ethylene-butene-styrene (SEBS) was provided by Sigma-Aldrich (St. Louis, Missouri, USA). Silver nanowires (AgNWs) were purchased from XFNANO (Nanjing, China). The SOD / MDA / GSH / CAT (BC5165 / BC0025 / BCl175 / BC0205) assay kit was provided by Solarbio Science & Technology (Beijing, China). ELISA kits for pro-inflammatory cytokines (IL-1β, E-EL-M0037; IL-6, E-EL-M0044; TNF-α, E-EL-M3063) and (CD31, E-EL-R0761; TGF-β, E-EL-M1191; VEGF, E-EL-M1292) were purchased from Elabscience Biotechnology (Wuhan, China). Antibodies IL-1β (16806-1-AP), VEGFA (19003-1-AP), CD31 (11265-1-AP), and TGFβ1 (21898-1-AP) were provided by Proteintech Biotechnology (Wuhan, China). Antibodies IL-6 (TD6087), TNF-α (PY19810), and β-actin (T40104) were purchased from Abmart Biotechnology (Shanghai, China). Other general analytical grade chemicals were purchased from Aladdin (China).

[0024] Staphylococcus aureus (ATCC 25923), methicillin-resistant Staphylococcus aureus (MRSA, ATCC 43300), and Escherichia coli (ATCC25922) were provided by Fuxiang (Shanghai, China).

[0025] Example 1:

[0026] Preparation of SEBS / AgNWs: Dissolve styrene-ethylene-butene-styrene (SEBS) in a mixed solvent of chloroform and isopropanol. The volume ratio of chloroform to isopropanol is 5:2, and the concentration of SEBS is 60 mg / mL. Stir the solution on a rotary table for 20 hours to ensure uniform mixing to obtain an SEBS solution.

[0027] In the silver nanowire (AgNWs) solution, the diameter of AgNWs is 30 nm, the concentration is 20 mg / ml, and the solvent is isopropanol.

[0028] An AgNWs solution was added to the SEBS solution, and the volume ratio of the SEBS solution to the AgNWs solution was 5:1. Then, ultrasonic treatment was carried out at 80 kHz for 1 minute to mix them evenly, obtaining the SEBS / AgNWs mixed solution. Subsequently, the SEBS / AgNWs mixed solution was uniformly coated on the aluminum foil and dried at room temperature for 24 hours to remove all solvents. Due to the difference in the evaporation rates of chloroform and isopropanol during the drying process, the film underwent microphase separation, thus obtaining the SEBS / AgNWs elastic film with a hierarchical porous structure.

[0029] Characterization of SEBS / AqNWs: The morphologies of SEBS and the porous SEBS / AgNWs hybrid film were evaluated by scanning electron microscopy (SEM) and energy-dispersive spectroscopy (EDS) analysis.

[0030] In vitro ABTS+· and DPPH· assays: The antioxidant properties of the SEBS / AgNWs nanocomposite were determined by evaluating its ability to scavenge ABTS radical (ABTS+·), DPPH radical (DPPH·), and hydroxyl radical (·OH). The scavenging effects of SEBS / AgNWs on these radicals were measured according to the method described previously. First, 7.4 mM ABTS was mixed with 2.6 mM (NH 4 )2S 2 O 8 in a 1:1 ratio and stored overnight at 4 °C in the dark to generate ABTS+·. Next, 100 μL of the ABTS+· working solution (0.37 mM) was mixed with 100 μL of SEBS / AgNWs at different concentrations. Subsequently, the ability of SEBS / AgNWs to scavenge ABTS+· was evaluated by measuring the ultraviolet absorbance at 734 nm at different time intervals.

[0031] Finally, different concentrations of SEBS / AgNWs were mixed with the DPPH· ethanol solution (200 μg / mL, 100 μL), and the scavenging efficiency of SEBS / AgNWs on DPPH· was evaluated by measuring the ultraviolet absorbance at 517 nm at different time intervals.

[0032] In vitro ·OH and H 2 O 2 assays: ·OH was generated through the Fenton reaction by mixing 100 μL of 32 mM FeCl 3 6H 2 O, 5% hydroxylamine hydrochloride, and 100 μL of 300 mM H 2 O 2Mixing. Methylene blue trihydrate (MB, 100 μL, 60 μg / mL) was used to collect the generated ·OH. Subsequently, different concentrations of SEBS / AgNWs were added to the solution containing ·OH, and the absorbance value at 664 nm was measured using a spectrophotometer to evaluate the ability of SEBS / AgNWs to scavenge ·OH. H 2 O 2 content was estimated by mixing the sample with 1 mL of PBS buffer and homogenizing it under low-temperature conditions. Subsequently, the supernatant left after centrifugation at 3500×g for ten minutes was used to determine the H 2 O 2 content.

[0033] Bacterial counting: The antibacterial activity of SEBS / AgNWs was evaluated by measuring their ability to inhibit the growth of Staphylococcus aureus (S. aureus), methicillin-resistant Staphylococcus aureus (MRSA), and Escherichia coli (E. coli). The diluted bacterial solution (1×10 8 CFU / mL) was added to the LB medium plate and incubated at 37 °C for 24 hours. Subsequently, 100 μL of different concentrations of SEBS / AgNWs was added and cultured for another 24 hours to promote colony expansion. The growth of the colonies was monitored by taking pictures and counted.

[0034] Minimum inhibitory concentration study (MIC): The minimum inhibitory concentration (MIC) of SEBS / AgNWs was determined by measuring the OD600 value and using the two-tube dilution broth method. Staphylococcus aureus (S. aureus), methicillin-resistant Staphylococcus aureus (MRSA), and Escherichia coli (E. coli) were inoculated in LB medium and incubated at 37 °C for 24 hours. After three PBS washes, 1 mL of the bacterial culture was centrifuged at 2000 rpm and incubated in 100 mL of LB medium until the logarithmic growth phase. Subsequently, the bacterial suspension was diluted to 1×10 8 CFU / mL and placed in a sterile test tube. Then, 1 mL of different doses of SEBS / AgNWs was added to the test tube and incubated for another 24 hours. The MIC was determined by colony counting, defined as the lowest concentration that inhibits 90% of bacterial growth.

[0035] Resazurin staining: Resazurin is an indicator used to measure bacterial activity. It is converted into the redox dye resorufin through the mitochondrial respiratory chain, and the amount of its generation is positively correlated with the number of viable cells. 100 μL of the bacterial suspension (1×10 8 CFU / mL) was added to a 96-well plate and incubated at 37 °C for 24 hours. Subsequently, different concentrations of SEBS / AgNWs were added and continued to be treated for 24 hours. Finally, resazurin reagent was added and incubated at 37 °C for 4 hours.

[0036] Bacterial biofilm removal experiment: A 100 μL diluted bacterial suspension (1×10 8 CFU / mL) was added to a 96-well plate and incubated at 37 °C for 24 h to obtain a bacterial biofilm. After incubation, the wells were washed three times with PBS, and then different concentrations of SEBS / AgNWs (100 μL per well) were added and treated for 24 h. After the samples were fixed with methanol, they were stained with crystal violet for 15 min. The obtained biofilms were treated with 95% ethanol, and then the OD600nm value was measured to evaluate the effect of SEBS / AgNWs on the biofilm.

[0037] Quantification of ROS produced in bacteria: A diluted bacterial solution (100 μL, 1×10 8 CFU / mL) was added to a 96-well plate and incubated at 37 °C for 24 h. After incubation, 100 μL of SEBS / AgNWs was added and incubated for another 4 h. Then the bacteria were centrifuged at 3000 rpm for 15 min and washed three times with PBS, and subsequently treated with DCFH-DA at a final concentration of 40 μg / mL in the dark for 30 min. Finally, the OD value of the bacteria was measured using a fluorescence microplate reader.

[0038] Monitoring of bacterial growth curve: 200 μL of Mueller-Hinton broth (MHB) and 100 μL of bacterial dilution (1×10 8 CFU / mL) were added to a 96-well plate. Subsequently, SEBS / AgNWs were added to the wells in the experimental group, and PBS was added to the control group. The plate was incubated at 37 °C, and the bacterial growth curve was quantified by measuring the OD 600 value at specific time intervals.

[0039] In vivo wound healing assessment: Adult male KM mice, weighing 25 - 30 g and 6 - 8 weeks old, were housed in a controlled environment with well-regulated humidity and temperature (25 °C) and a 12-h light-dark cycle. The mice were randomly divided into three groups (n = 6 per group): control group, SEBS group, and SEBS / AgNWs group. A skin infection model was established by inoculating Staphylococcus aureus (S. aureus) on the wound for three days. SEBS and SEBS / AgNWs were applied to the wound once a day for 10 days, while the control group was given PBS treatment. The healing effect was evaluated by measuring the body weight and the size of the infected wound. After the treatment, all mice were euthanized, and the infected wound tissues and major organ tissues (heart, liver, spleen, lung, kidney) were collected and stored at -80 °C. Wound tissues from three randomly selected mice in each group were used for Western blotting, ELISA, and qPCR analysis, and the remaining tissues were used for histopathological analysis.

[0040] Bacterial survival rate in wounds: At the end of the treatment, wound skin tissue samples were obtained from multiple experimental groups. After homogenizing the samples in PBS, they were diluted and inoculated onto agar plates for bacterial culture. Subsequently, the colonies were counted to evaluate the effect of SEBS / AgNWs on the wound bacterial load.

[0041] Pathological analysis: The wound tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned to a thickness of 4 μm. The sections were stained with hematoxylin-eosin (H&E) and Masson's trichrome to observe the morphological changes of the wound tissues under a microscope (Olympus, Tokyo, Japan). H&E staining of the heart, liver, spleen, lungs, and kidneys was also performed using the same procedure as above to evaluate their safety.

[0042] In vivo antioxidant assessment: Proteins were extracted from the wound tissues of mice using RIPA lysis buffer, and their concentrations were measured using a BCA protein assay kit (P0010S, Beyotime Biotechnology, Shanghai, China). The contents of enzymes in the supernatant, including CAT (BC0205, Solarbio, China), SOD (BC5165, Solarbio, China), MDA (BC0025, Solarbio, China), and GSH (BC1175, Solarbio, China), were measured according to the manufacturer's instructions to evaluate the antioxidant performance of SEBS / AgNWs in vivo.

[0043] Enzyme-linked immunosorbent assay (ELISA): Protein concentrations were measured using a BCA protein assay kit (P0010S, Beyotime Biotechnology, Shanghai, China). Subsequently, the levels of IL-1β, IL-6, TNF-α, CD31, TGF-β, and VEGF in the extracted samples were measured using an ELISA kit according to the manufacturer's instructions.

[0044] Real-time fluorescence quantitative (RT-q) PCR:

[0045] Table 1 Primer sequences used in PCR analysis

[0046] Name Sequence(5′-3′) lL-1β-F ACATCAACAAGAGCTTCAGG lL-1β-R AGGTGGAGAGCTTTCAGCTC IL-6-F CACAAGTCCGGAGAGGAGAC IL-6-R TCATCGTTGTTCATACAATC TNF-α-F CTCTTAATAGCAGGTCTATG TNF-α-R GTCAGCGGAAAGATTAGGAT CD31-R GTCCTGCTCCGTCTCGGGCA CD31-F TGGGCTTCGAGAGCATTTCG TGF-β-F GCGTGCTAATGGTGGACCGC TGF-β-R GCCAGGAATTGTTGCTATAT VEGF-F TCCACCATGCCAAGTGGTCC VEGF-R GCCTGCACAGCGCATCAGCG

[0047] Statistical analysis method: The data were analyzed using SPSS statistical software (version 21.0), and the results were expressed as mean ± standard error of the mean (SEM). The charts were drawn using GraphPad Prism 8.3. Statistical significance was determined by one-way analysis of variance (ANOVA) and LSD post hoc test, and P < 0.05 was considered statistically significant.

[0048] Experimental results:

[0049] Preparation and Characterization of SEBS / AgNWs: The present invention provides a method for controlled phase separation synthesis to prepare a multifunctional SEBS matrix with a multi-scale porous structure. SEBS is selected because of its high ductility and good solution processability. The process first prepares a precursor solution of SEBS and isopropanol (IPA, a non-solvent) in chloroform (a solvent). Then the precursor solution is coated on an aluminum foil and dried in air. The rapid evaporation of chloroform causes phase separation between lPA and SEBS, forming nano / microscale droplets. Finally, the evaporation of the lPA droplets enables the SEBS matrix to form a hierarchical pore structure ( Figure 1 A).

[0050] Selecting an effective antibacterial agent is crucial for wound healing. To prepare a hierarchical porous SEBS / AgNWs hybrid film for antibacterial, antioxidant, and anti-inflammatory applications, we constructed AgNWs on a multi-scale porous SEBS matrix. The AgNWs have a diameter of 50 nanometers and a length of 100 to 200 micrometers. They were selected because of their excellent mechanical compliance and extensive functional applications in wound dressings and can be easily mass-produced. A co-solvent SEBS solution was prepared according to the above method, and a silver nanowire solution with a specific mass ratio was added. Then, a hybrid porous film was constructed using the same principle ( Figure 1 B).

[0051] Effect of the Solvent and Non-Solvent System Ratio on SEBS / AgNWs:

[0052] A SEBS / AgNWs film with multi-level pores is formed by a phase separation method, with chloroform and isopropanol used as the solvent and non-solvent, respectively. The controllable adjustment of the film thickness and pores is achieved by adjusting the volume ratio of the solvent to the non-solvent.

[0053] Table 2 Effect of the Solvent and Non-Solvent System Ratio on SEBS / AgNWs

[0054]

[0055]

[0056] The changes in the thickness, porosity, and pore size of the SEBS / AqNWs hybrid film will affect its antibacterial, antioxidant, and wound healing promotion effects. When the ratio of the solvent to the non-solvent is 5:2, the conditions of the film thickness, porosity, and pore size are optimal.

[0057] Scanning electron microscope (SEM) images of SEBS ( Figure 1 C) show that a completely connected hierarchical pore is formed, with a characteristic size of approximately 0.2 to 7 micrometers. Figure 1D and 1E show the characteristic spider-web layout of the AgNWs network on the porous SEBS. The porous morphology of the synthesized SEBS and the linear structure of AgNWs contribute to the antibacterial and wound-healing functions of SEBS / AqNWs. The composition and mapping of the SEBS / AgNWs components, including carbon (C) and silver (Ag), were further analyzed, as shown in Figure 1 F-1l. Element mapping and ratio analysis verified the hierarchical porous structure of SEBS / AqNWs, which is conducive to the slow release of drugs. The element mapping images show the coexistence and distribution of Ag and C elements.

[0058] ROS scavenging ability of SEBS / AgNWs: To study the ROS scavenging ability of SEBS / AgNWs, first, the 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid radical (ABTS·+) was used to evaluate its overall ROS scavenging ability. At a concentration of 120 μg / mL, SEBS / AgNWs almost completely scavenged ABTS·+ ( Figure 2 A). The present invention also used 1,1-diphenyl-2-picrylhydrazyl radical (DPPH·) to test the antioxidant performance of SEBS / AgNWs. As shown in Figure 2 B, at a concentration of 80 μg / mL, SEBS / AgNWs scavenged nearly 80% of DPPH·. For comparison, the present invention also tested the scavenging ability of SEBS alone against ABTS·+ and DPPH·. Figure 2 C and 2D show that SEBS / AgNWs exhibit stronger antioxidant activity than SEBS at the same concentration and the antioxidant activity increases over time.

[0059] Natural enzymes usually have inherent limitations, such as low operational stability, sensitivity to temperature and pH, and difficulty in recycling. However, the synthesized SEBS / AgNWs in the present invention can maintain almost the same catalytic activity as the original dispersion even during long-term storage, highlighting its potential as an effective antioxidant. To further evaluate the ROS scavenging ability of SEBS / AgNWs, the present invention tested their activities against two representative ROS (H202 and ·OH). Figure 2E and 2F showed that the scavenging activity of SEBS / AqNWs was concentration-dependent (10 - 100 μg / mL). At 100 μg / mL, SEBS / AgNWs decomposed approximately 80% of H2O2, showing catalase-like (CAT-like) activity. Similarly, at 120 μg / mL, SEBS / AgNWs eliminated approximately 73% of ·OH, showing superoxide dismutase-like (SOD-like) activity. These findings together indicate that SEBS / AgNWs have excellent ROS scavenging ability, may induce anti-inflammatory effects, and prevent various oxidative damages.

[0060] In vitro antibacterial properties of SEBS / AgNWs: According to Figure 3 A-3C and Table 3, it can be seen that the minimum inhibitory concentrations (MICs) of SEBS / AgNWs against S. aureus, MRSA, and E. coli were 512 ppm ( Figure 3 A), 256 ppm ( Figure 3 B), and 256 ppm ( Figure 3 C), respectively, while the MICs of SEBS alone against S. aureus, MRSA, and E. coli were 2048 ppm ( Figure 3 A), 2048 ppm ( Figure 3 B), and 4096 ppm ( Figure 3 C), respectively, showing that the MIC values of SEBS / AgNWs against S. aureus, MRSA, and E. coli were lower than those of SEBS alone. The agar plate experiment verified the dose-dependent bacterial growth inhibition effect of SEBS / AgNWs, which showed significant antibacterial effects even at lower concentrations, with significant bacteriostatic rates against S. aureus, E. coli, and MRSA ( Figure 3 D-3I). The application of resazurin staining further showed that after incubation with SEBS and SEBS / AgNWs for 24 hours, S. aureus, MRSA, and E. coli all showed dose-dependent growth inhibition ( Figure 3 J-3L). These results indicate that the antibacterial effect of SEBS / AgNWs is better than that of SEBS alone.

[0061] Table 3 Antibacterial MIC of SEBS / AgNWs

[0062] Strains SEBS(ppm) SEBS / AgNWs(ppm) S.aureus 2048 512 MRSA 2048 256 E.coli 4096 256

[0063] The antibacterial activity was further quantified by analyzing the bacterial growth curves, and the results showed that SEBS / AgNWs could more effectively eliminate Staphylococcus aureus (S. aureus), methicillin-resistant Staphylococcus aureus (MRSA), and Escherichia coli (E. coli) compared to SEBS alone ( Figure 4 A-4C). This progress in antibacterial activity indicates that SEBS / AgNWs have higher bioavailability and efficacy, and highlights the strong synergistic effect achieved by combining AgNWs, significantly enhancing the antibacterial performance. Biofilms pose a major obstacle to effective antibacterial treatment by preventing drug penetration into bacterial cells, thereby reducing their bactericidal effect. Disrupting and removing biofilms is crucial for improving the effectiveness of bactericides. Figure 4 The quantitative analysis results in D-4F showed that SEBS / AqNWs had a significant effect on biofilm clearance. At a concentration of 256 ppm, the clearance rates of S. aureus, MRSA, and E. coli biofilms were 76.52%, 77.42%, and 78.74%, respectively. In addition, the quantitative results of bacterial ROS showed that SEBS / AgNWs exhibited higher efficacy in scavenging ROS compared to SEBS alone (P<0.01)( Figure 4 G-I). These findings confirm that SEBS / AgNWs have excellent antibacterial and synergistic antioxidant effects against refractory pathogens such as S. aureus, MRSA, and E. coli. The data indicate that SEBS / AgNWs have great potential in combating bacterial infections and biofilm-related problems, providing a promising approach for the development of advanced antibacterial therapies.

[0064] Pathological analysis of SEBS / AgNWs promoting wound healing: After the administration was completed (day 10), H&E staining analysis was performed on the wound tissues of the mice. The results showed that by day 10, the wounds in the SEBS / AgNWs group had completely healed, accompanied by the formation of a new and intact epidermis, and there was no obvious gap between the epidermis and the dermis. In contrast, although a new epidermal layer was also formed in the SEBS group, the wound between the epidermis and the dermis was not completely healed. Notably, damaged epidermis was observed in the control group, indicating that its wound healing was affected( Figure 6 A).

[0065] The levels of IL-1β, IL-6, and TNF-α after treatment in each group were detected by ELISA, RT-qPCR, and Western blotting. The ELISA results showed that compared with the control group, the SEBS and SEBS / AgNWs treatment groups exhibited significant anti-inflammatory effects, confirming the excellent anti-inflammatory activity of SEBS and SEBS / AgNWs and indicating that the modification of AgNWs did not affect their efficacy. Interestingly, the anti-inflammatory effect of SEBS / AgNWs was observed to be better than that of SEBS alone, which may be attributed to the enhanced and inherent anti-inflammatory properties of AgNWs( Figure 6 C-6E). The RT-qPCR and Western blotting results also confirmed this conclusion( Figure 6 G-6I and F). These findings highlight the significant synergistic inhibitory effect of SEBS / AgNWs on inflammatory factors, thus providing an ideal environment for wound healing and revealing the potential mechanism by which SEBS / AgNWs promote this process.

[0066] In this invention, Masson staining was used to evaluate the changes in collagen fibers in the wounds. As Figure 6 shown in B, a large number of proliferating fibroblasts were observed in the wounds of all groups, including the control group, indicating that the self-healing process of the wounds stimulated the generation of collagen fibers. However, it is worth noting that compared with other groups, the SEBS / AgNWs group showed more uniform, dense, and ordered subcutaneous collagen fibers and a higher content level. This indicates that the SEBS / AgNWs treatment not only supports the generation of collagen but also promotes the formation of a more structured and robust extracellular matrix, highlighting its efficacy in enhancing wound healing by improving tissue structure and strength.

[0067] We successfully evaluated the ROS scavenging ability of SEBS / AgNWs in vitro and obtained positive results, laying a foundation for further study of its ROS scavenging ability in vivo. This function is crucial for its comprehensive antibacterial and wound healing effects. We used the corresponding biochemical detection kits to analyze the effects of different treatments on the levels of CAT, GSH, MDA, and SOD, which are all important factors for neutralizing ROS and protecting the body from oxidative stress damage. The results showed that SEBS and SEBS / AgNWs significantly increased the levels of CAT, GSH, and SOD, while decreasing the level of MDA, highlighting their strong ROS scavenging activity in vivo( Figure 6K-6N). These results indicate that SEBS / AgNWs can regulate the levels of CAT, GSH, MDA, and SOD, thereby exerting an important antioxidant effect. This mechanism may help to explain the observed synergistic antibacterial and wound-healing-promoting efficacy of SEBS / AgNWs, providing a promising avenue for further research and potential therapeutic applications.

[0068] The transforming growth factor-β (TGF-β) signaling pathway is widely recognized as a mechanism that plays a key role in wound healing and repair due to its close association with myofibrogenesis. Therefore, we analyzed the expression of TGF-β after different treatments by RT-qPCR, ELISA, and Western blotting. The results showed that the TGF-β level was the highest in the SEBS / AgNWs group ( Figure 6 O-6P and 6J), indicating that this pathway was strongly stimulated. This suggests that SEBS / AgNWs may enhance the production of collagen fibers by upregulating the expression of TGF-β protein.

[0069] Another crucial aspect of wound healing is angiogenesis, which provides nutrients and oxygen for the regeneration and repair of surrounding tissues, clears wound metabolites, and reduces inflammation, thereby accelerating the healing process. Vascular endothelial growth factor (VEGF) plays a key role in neovascularization by stimulating endothelial cell proliferation and migration and enhancing vascular permeability. Meanwhile, CD31 promotes angiogenesis and facilitates the interconnection between vascular endothelial cells by regulating cell adhesion and signal transduction. To evaluate the effect on angiogenesis, we analyzed the expression levels of VEGF and CD31 in wound tissues by RT-qPCR and ELISA. The results of these analyses showed that the expression levels of VEGF and CD31 were significantly increased in the SEBS and SEBS / AgNWs groups compared with the control group, and the treatment effect of SEBS / AgNWs was the best, in line with the expected results. These findings indicate that SEBS / AgNWs may enhance angiogenesis by upregulating the expression of VEGF and CD31, thereby promoting the supply of nutrients and oxygen to metabolically active wounds, facilitating granulation tissue formation, and ultimately accelerating wound healing ( Figure 6 Q-6T and 6J). This reveals the mechanism by which SEBS / AgNWs promote wound healing and highlights its role as a potential therapeutic agent for improving wound management and treatment.

[0070] In vivo biosafety of SEBS / AgNWs: Nanomaterials have many advantages as drug delivery systems but still face challenges in terms of compatibility in practical applications. In this study, by monitoring the body weights of mice throughout the experiment, no significant differences were found among the body weights of each group, thus confirming the excellent biocompatibility of SEBS / AgNWs. Figure 5E). Histological changes in the major organs (heart, liver, spleen, lung, and kidney) of each group of mice also confirmed this finding, and the H&E staining results showed no obvious organ damage ( Figure 7 ). This comprehensive evaluation across multiple models highlights the good biocompatibility and safety of SEBS / AgNWs.

[0071] The present invention develops a multifunctional nanomaterial based on SEBS / AgNWs, which has antibacterial, antioxidant, and anti-inflammatory properties and can promote angiogenesis and the healing of infected wounds. The multi-scale porous SEBS / AgNWs composite film is synthesized by a phase separation technique, and AgNWs are loaded on the surface of the multi-scale porous SEBS matrix. The composite material is characterized by scanning electron microscopy (SEM) and energy-dispersive spectroscopy (EDS). In vivo and in vitro experiments evaluate the antibacterial, anti-inflammatory, and antioxidant properties of the composite material, as well as its wound healing effect, mechanism of action, and biocompatibility. The results show that SEBS / AgNWs promotes tissue regeneration and reduces inflammation while effectively combating infection. The integration of these multifunctional properties can significantly accelerate the healing process of infected wounds and provide a more comprehensive and effective treatment strategy. This method not only addresses the limitations of current treatments but also opens up new avenues for improving patient prognosis in wound care management.

[0072] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.

Claims

1. A method for preparing a SEBS / AgNWs nanocomposite film, characterized in that: SEBS is dissolved in a mixed solvent of chloroform and isopropanol to obtain a SEBS solution, and the silver nanowire solution is added and mixed evenly to obtain a SEBS / AgNWs mixed solution. The SEBS / AgNWs mixed solution is coated on a substrate and dried to obtain a SEBS / AgNWs nanocomposite film.

2. The method for preparing the SEBS / AgNWs nanocomposite film according to claim 1, characterized in that: The concentration of SEBS in the SEBS solution is 60-100 mg / mL.

3. The method for preparing the SEBS / AgNWs nanocomposite film according to claim 1 or 2, characterized in that: The volume ratio of chloroform to isopropanol is 5:

2.

4. The method for preparing the SEBS / AgNWs nanocomposite film according to claim 1 or 2, characterized in that: In the silver nanowire solution, the concentration of silver nanowires is 20-30 mg / ml.

5. The method for preparing the SEBS / AgNWs nanocomposite film according to claim 4, characterized in that: The solvent in which the silver nanowires are dissolved includes isopropyl alcohol, and the average diameter of the silver nanowires is 20 to 30 nm.

6. The method for preparing the SEBS / AgNWs nanocomposite film according to claim 1 or 2, characterized in that: The SEBS / AgNWs mixed solution is prepared by mixing the SEBS solution with the silver nanowire solution in a volume ratio of 5:

1.

7. The method for preparing the SEBS / AgNWs nanocomposite film according to claim 1 or 2, characterized in that: The adding of the silver nanowire solution and mixing uniformly includes mixing uniformly by ultrasonic treatment.

8. The method for preparing the SEBS / AgNWs nanocomposite film according to claim 1 or 2, characterized in that: The drying includes drying at room temperature.

9. The SEBS / AgNWs nanocomposite film prepared by the method for preparing the SEBS / AgNWs nanocomposite film according to claim 1 is characterized in that: The SEBS / AgNWs nanocomposite film has a thickness of 90 to 160 μm.

10. Use of the SEBS / AgNWs nanocomposite film prepared by the method for preparing the SEBS / AgNWs nanocomposite film according to claim 1 in preparing nanomaterials having antibacterial, antioxidant, anti-inflammatory and wound healing properties.

Images