Construction and application of diosgenin and polyphyllin II synthetic strain

Abstract

The invention discloses a series of recombinant bacteria for expressing a steroid compound taking a cyclopentane multi-hydrogen phenanthrene structure as a structural mother nucleus, such as recombinant strains for expressing cholesterol, 22-hydroxycholesterol, diosgenin or polyphyllin II, and construction and application of the strains. The invention provides a recombinant bacterium which can efficiently express a steroid compound taking cyclopentane multi-hydrogen phenanthrene as a structural mother nucleus, for example, the yield of diosgenin can be increased to the level of 40 mg / L or above, heterologous synthesis of the polyphyllin II is also realized to obtain a polyphyllin II synthetic strain, the yield of the polyphyllin II in a shake flask reaches 0.13 mg / L, and the yield of the polyphyllin II in the shake flask reaches 0.13 mg / L. The strain is the first strain for heterologous synthesis of the polyphyllin II at present.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the construction and application of a diosgenin and paridis saponin II synthetic strain. Background Art

[0002] Diosgenin (or diosgenin) is a steroidal compound with a cyclopentane polyhydrophenanthrene structure as the structural nucleus. It has a common nucleus structure with cholesterol / 22-hydroxycholesterol. Diosgenin can be obtained through a series of chemical reactions or biological pathways using cholesterol / 22-hydroxycholesterol as the starting material. For example, cholesterol / 22-hydroxycholesterol is obtained by P450 enzyme catalysis. The structures of the three are shown in the figure below. As an important natural steroidal sapogenin, diosgenin has a wide range of sources and is an important raw material for the synthesis of steroid hormone drugs. It has a variety of significant pharmacological effects such as anti-tumor, anti-inflammatory, and antioxidant, and has high medicinal value.

[0003]

[0004] Paris saponins are a type of steroidal saponins with a cyclopentane polyhydrogen phenanthrene structure as the structural mother nucleus, mainly including isospirostane-type diosgenin and pentosan-type saponins. Studies have shown that Paris saponins not only have resistance to tumors and myocardial ischemia, but also have good effects in anti-oxidation, antibacterial and anti-inflammatory, sedative and analgesic, hemostatic, immunomodulatory and organ protection, so they have extremely high medicinal value. Paris saponins are the main active ingredients in Paris plants. Paris plants are mainly distributed in southwestern provinces such as Yunnan and Guizhou. According to studies, it can produce a variety of effects, such as clearing away heat and detoxification, dispersing stagnation and swelling, cooling the liver and extinguishing shock, etc., and are often used to relieve diseases such as sore throats and snake bites.

[0005] Among them, the monomer components of Paris polyphylla saponin I, II, III, etc. have good in vitro anti-tumor activity, and Paris polyphylla saponin I, II and III Dioscorea dioscorea type saponins can be synthesized by chemical or biological pathways from Diosgenin. Modern pharmacological studies have shown that it plays an important role in inhibiting cancer cell growth and metastasis, regulating cell apoptosis, etc. The content of saponin compounds in plants is not high, and the separation of monomer compounds is difficult, and it is difficult to achieve large-scale production, etc., which cannot meet the needs of the market, and Paris polyphylla saponin has a complex structure and is difficult to achieve chemical synthesis, which seriously restricts the development and application of this type of natural product.

[0006] In recent years, with the development of synthetic biology, the synthesis of natural products through synthetic biology is a new, environmentally friendly and sustainable method. At present, the biosynthetic pathway of Polyphyllin Ⅱ has been elucidated. The use of synthetic biology to achieve the transformation of the production mode of Polyphyllin Ⅱ from plant extraction to biosynthesis will greatly promote the development and application of Polyphyllin Ⅱ. Summary of the invention

[0007] An object of the present invention is to provide a recombinant bacterium.

[0008] In the first embodiment of the present invention, the recombinant bacteria provided are the following modifications made to the chassis Saccharomyces cerevisiae CEN.PK113-5D:

[0009] (1) Knockout the arginine transporter CAN1 gene, geranylgeranyl phosphate synthase gene BTS1 and GAL80 gene in the bottom fungus;

[0010] (2) Overexpression of 3-hydroxy-3-methylglutaryl-CoA reductase 1 gene tHMG1 (sequence reference SGD: S000004540), squalene synthase gene ERG9 (sequence reference SGD: S000001233), squalene epoxidase gene ERG1 (sequence reference SGD: S000003407), and farnesyl pyrophosphate synthase gene ERG20 (sequence reference SGD: S000003703), the sequences were obtained from the yeast genome database (https: / / www.yeastgenome.org / );

[0011] (3) Expression of CRISPR-related gene CAS9 (GeneBank: UFQ04583.1);

[0012] (4) expressing sterol 7 reductase gene St7SRopt (SEQ ID NO: 1) and sterol 24 reductase gene St24SRopt (SEQ ID NO: 2); and

[0013] (5) In the chassis bacteria, the promoter of ERG7 is used to replace the promoter of ERG6.

[0014] In a preferred embodiment of the present invention, the overexpression of 3-hydroxy-3-methylglutaryl-CoA reductase 1 gene tHMG1, squalene synthase gene ERG9, squalene epoxidase gene ERG1 and farnesyl pyrophosphate synthase gene ERG20 is to insert the tHMG1 gene expression cassette, ERG9 gene expression cassette, ERG1 gene expression cassette and ERG20 gene expression cassette into the bottom plate fungus; the expression of CRISPR-associated gene CAS9 is to insert the CAS9 gene expression cassette into the bottom plate fungus; the expression of sterol 7-position reductase gene St7SRopt and sterol 24-position reductase gene St24SRopt gene expression cassette is to insert the St7SRopt and St24SRopt gene expression cassettes into the bottom plate fungus;

[0015] The tHMG1 expression cassette includes a TDH3p promoter, a tHMG1 gene derived from Saccharomyces cerevisiae and a FBA1t terminator;

[0016] The ERG9 expression cassette includes a PGK1p promoter, an ERG9 gene from Saccharomyces cerevisiae and a FBA1t terminator;

[0017] The ERG20 expression cassette includes a TDH3p promoter, an ERG20 gene from Saccharomyces cerevisiae, and a CYC1t terminator;

[0018] The ERG1 expression cassette includes a TEF1p promoter, an ERG1 gene from Saccharomyces cerevisiae and an IDP1t terminator;

[0019] The CAS9 expression cassette includes a TEF1p promoter, a CRISPR-associated protein CAS9 gene and a CYC1t terminator;

[0020] The St7SRopt expression cassette includes a GAL10p promoter, a St7SRopt gene derived from potato, and a CYC1t terminator;

[0021] The St24SRopt expression cassette includes a GAL1p promoter, a St24SRopt gene derived from potato, and an ADH1t terminator.

[0022] Through the above-mentioned transformation, an optimized recombinant chassis bacterium TZ14 can be obtained, which can efficiently express cholesterol.

[0023] In a second embodiment of the present invention, a recombinant bacterium is provided, which is obtained by further transforming the bottom plate bacterium TZ14 in any of the following ways, wherein the transformation is:

[0024] (1) expressing AtCPR1opt (SEQ ID NO: 3) and PpCYP90B27opt (SEQ ID NO: 4) genes at the V-1 site of the yeast genome to obtain the recombinant bacterium TZ15;

[0025] (2) The AtCPR1opt and PpCYP90B27opt genes were overexpressed at the III-1 site of the yeast genome to obtain the recombinant bacterium TZ18.

[0026] The recombinant bacteria TZ15 and TZ18 consumed the cholesterol of the chassis bacteria TZ14 and successively increased the production of 22-hydroxycholesterol.

[0027] In an exemplary embodiment of the present invention, the expression of AtCPR1opt and PpCYP90B27opt genes is to integrate the AtCPR1opt and PpCYP90B27opt expression cassettes into the corresponding sites of TZ14 of the bottom plate bacteria, and the overexpression of AtCPR1opt and PpCYP90B27opt genes is to integrate the AtCPR1opt and PpCYP90B27opt expression cassettes into the corresponding sites of TZ15 of the bottom plate bacteria;

[0028] The PpCYP90B27opt expression cassette includes a GAL10p promoter, a PpCYP90B27opt gene derived from Paris polyphylla and a PGK1t terminator;

[0029] The AtCPR1opt expression cassette includes a GAL1p and / or GAL10p promoter, an AtCPR1opt gene derived from Arabidopsis thaliana, and an ADH1t terminator.

[0030] In a third embodiment of the present invention, a recombinant bacterium is provided, which is obtained by further performing any of the following transformations on the basis of the bottom plate bacteria TZ18, wherein the transformation is to combine and connect the sterol 16,22-dihydroxylase gene and the sterol 26-hydroxylase gene PpCYP94D108opt (SEQ ID NO: 5) at the V-3 site of the bottom plate bacteria TZ18 genome, so that the corresponding bacteria express the sterol 16,22-dihydroxylase gene and the sterol 26-hydroxylase gene:

[0031] (1) combining and ligating the sterol 16,22-dihydroxylase gene DzCYP90G6 (SEQ ID NO: 6) from Dioscorea zingiberensis and the sterol 26-hydroxylase gene PpCYP94D108opt to obtain strain TZ23; or

[0032] (2) combining and ligating the sterol 16,22-dihydroxylase gene PpyCYP90G4 (SEQ ID NO: 7) from Paris polyphylla and the sterol 26-hydroxylase gene PpCYP94D108opt to obtain strain TZ24; or

[0033] (3) combining and ligating the sterol 16,22-dihydroxylase gene PpcCYP90G4 (SEQ ID NO: 8) from Paris polyphylla and the sterol 26-hydroxylase gene PpCYP94D108opt to obtain strain TZ26; or

[0034] (4) combining and ligating the sterol 16,22-dihydroxylase gene TtCYP90G4 (SEQ ID NO: 9) from Trillium sphaerocephala with the sterol 26-hydroxylase gene PpCYP94D108opt to obtain strain TZ27;

[0035] The expression of sterol 16,22-dihydroxylase gene and sterol 26-hydroxylase gene is to integrate the 16,22-dihydroxylase gene expression cassette and the sterol 26-hydroxylase gene expression cassette into the corresponding sites of the bottom plate fungus TZ18.

[0036] The sterol 16,22-dihydroxylase gene expression cassette includes a GAL10p promoter, a gene corresponding to the expression of 16,22-dihydroxylase, and a TEF1t terminator;

[0037] The sterol 26-hydroxylase gene expression box comprises a GAL1p promoter, a PpCYP94D108opt gene derived from Paris polyphylla and a HXT7t terminator.

[0038] By introducing sterol 16,22-dihydroxylase gene and sterol 26-hydroxylase gene, the corresponding strain obtained can efficiently express diosgenin and consume the amount of cholesterol and 22-hydroxycholesterol in the original chassis strain.

[0039] In order to further improve the yield of diosgenin in the recombinant bacteria, in the fourth embodiment of the present invention, a recombinant bacterium TZ30 is provided, which is further modified in the following manner on the basis of the bottom plate bacteria TZ18, wherein the codon-optimized sterol 16,22-dihydroxylase gene DzCYP90G6opt (SEQ ID NO: 10) and the sterol 26-hydroxylase gene PpCYP94D108opt are combined and connected at the V-3 site of the bottom plate bacteria TZ18 genome, and AtCPR1opt is overexpressed at the XII-2 site of the bottom plate bacteria genome to obtain the recombinant bacteria TZ30;

[0040] In order to better understand the meaning of adding the three letters "opt" after the gene sequence in the context of the present invention, it means that the corresponding gene is optimized, such as DzCYP90G6opt, which is a gene further optimized based on the gene DzCYP90G6.

[0041] In a further preferred embodiment, the recombinant bacterium TZ35 can be obtained by overexpressing the DzCYP90G6opt gene and the PpCYP94D108opt gene in the genome XI-5 based on the chassis bacterium TZ30;

[0042] The overexpression of DzCYP90G6opt and PpCYP94D108opt genes is to integrate the DzCYP90G6opt gene expression cassette and the PpCYP94D108opt gene expression cassette into the corresponding sites of the bottom bacteria.

[0043] The DzCYP90G6opt gene expression cassette includes a GAL10p promoter, a DzCYP90G6opt gene and a TEF1t terminator;

[0044] The PpCYP94D108opt gene expression box includes a GAL1p promoter, a PpCYP94D108opt gene and a HXT7t terminator.

[0045] The recombinant bacteria modified by the third and fourth embodiments of the present invention can express diosgenin, especially the modified recombinant bacteria TZ30. After the DzCYP90G6opt and PpCYP94D108opt expression genes are introduced and the AtCPR1opt gene is overexpressed, the diosgenin production reaches 32.39 mg / L. After the DzCYP90G6opt gene and the PpCYP94D108opt gene are further overexpressed to construct the strain TZ35, the diosgenin production is further increased to 40.10 mg / L, which is 1.81 times and 2.48 times higher than that of the TZ23 strain, respectively.

[0046] In a fifth embodiment of the present invention, a recombinant bacterium capable of biosynthesizing Paris polyphylla saponin II is provided, which is further modified as follows based on the bottom plate bacterium TZ35: (1) the PpcUGT4opt (SEQ ID NO: 11) gene is connected at the XI-2 site of the bottom plate bacterium genome, the PpyUGT16opt (SEQ ID NO: 12) gene and the RHM1opt (SEQ ID NO: 13) gene are connected at the XII-1 site, and the UGT93M3opt (SEQ ID NO: 14) gene and the UGT738A3opt mutant UGT738A3opt are connected at the XII-4 site. P101L / A158T (SEQ ID NO: 15) gene, and obtain the recombinant bacterium TZ42; or

[0047] (2) Connecting the PpcUGT4opt mutant PpcUGT4opt at the XI-2 site of the chassis bacteria genome F211Y / L302T (SEQ ID NO: 16) gene, XII-1 site connecting PpyUGT16opt gene and RHM1opt gene, and XII-4 site connecting UGT93M3opt gene and UGT738A3opt mutant UGT738A3opt P101L / A158T gene and obtained the recombinant bacterium TZ43.

[0048] In the above-mentioned recombinant bacteria TZ42 and TZ43, the recombinant bacteria express the steroid C3-OH glucosyltransferase gene PpcUGT4opt, the rhamnose synthase gene RHM1opt, the steroidal saponin C2′-OH rhamnosyltransferase gene PpyUGT16opt, the steroidal saponin C4′-OH rhamnosyltransferase gene UGT93M3opt and the steroidal saponin C4″-OH rhamnosyltransferase gene UGT738A3opt by integrating the corresponding gene expression cassettes into the corresponding positions of the bottom plate bacteria TZ35, and the corresponding gene expression cassettes all contain promoters, expression genes and terminators, such as:

[0049] The expression cassette of PpcUGT4opt includes the GAL10p promoter, the PpcUGT4opt gene from Paris polyphylla, and the ADH1t terminator;

[0050] The expression cassette of PpUGT16opt includes the GAL10p promoter, the PpUGT16opt gene from Paris polyphylla, and the TEF1t terminator;

[0051] The expression cassette of RHM1opt includes the GAL1p promoter, the RHM1opt gene from peach, and the ADH1t terminator;

[0052] The expression cassette of UGT93M3opt includes the GAL10p promoter, the UGT93M3opt gene from Solanum nigrum and the TEF1t terminator;

[0053] The expression cassette of UGT738A3opt includes the GAL1p promoter, the UGT738A3opt gene from Trillium and the ADH11t terminator.

[0054] In the sixth embodiment of the present invention, the use of the recombinant bacteria of the present invention in the production of cholesterol-related steroid compounds or in increasing the yield of cholesterol-related steroid compounds is provided. The "cholesterol-related steroid compounds" described in the present invention refer to steroid compounds having the same characteristics as cholesterol, for example, all of which have a cyclopentane polyhydrophenanthrene structure as a common nucleus. The related compounds are cholesterol, 22-hydroxycholesterol, diosgenin, diosgenin / Paridis saponin I or II, wherein diosgenin can be synthesized using cholesterol as a starting material, and it also has a cyclopentane polyhydrophenanthrene nucleus structure, while Paridis saponin I / II or diosgenin both have diosgenin as aglycone.

[0055] In the seventh embodiment of the present invention, a method for producing cholesterol, 22-hydroxycholesterol, diosgenin, and Paris saponin II is provided, and the recombinant bacteria obtained by the present invention are fermented to obtain the corresponding products.

[0056] The experiment of the present invention proves that the present invention reconstructs the corresponding recombinant bacteria in the chassis of brewer's yeast, obtains the recombinant bacteria with high production of cholesterol, 22-hydroxycholesterol or diosgenin, and further reconstructs the engineering bacteria of Paris saponin, realizing the heterologous synthesis of Paris saponin II. In addition, the strain is transformed by metabolic engineering method to obtain Paris saponin II synthesis strain. Finally, the yield of Paris saponin II in the shake flask reaches 0.13 mg / L, which is the first strain for heterologous synthesis of Paris saponin II. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] The accompanying drawings are used to provide further understanding of the present invention and constitute a part of the specification. They are used to explain the present invention together with the embodiments of the present invention and do not constitute a limitation of the present invention.

[0058] Figure 1 It is the structural formula of cholesterol, 22-hydroxycholesterol, diosgenin and paridis saponin II.

[0059] Figure 2 It is the fermentation result of cholesterol-producing bacteria.

[0060] Figure 3 It is the fermentation result of 22-hydroxycholesterol substrate bacteria.

[0061] Figure 4 Fermentation results for CYP90G4 isozyme screening

[0062] Figure 5 It is the fermentation result of Dioscorea saponin base bacteria.

[0063] Figure 6 It is the fermentation result of Paris saponin II base bacteria.

[0064] Figure 7 This is the LC-MS spectrum of the fermentation results of Paris saponin II substrate bacteria. DETAILED DESCRIPTION

[0065] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0066] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0067] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0068] The Saccharomyces cerevisiae CEN.PK113-5D strain in the following examples is derived from the BioVector plasmid vector strain cell protein antibody gene collection center - NTCC type culture collection center.

[0069] Example 1 Construction and optimization of cholesterol-containing bacteria

[0070] Starting with the CEN.PK113-5D strain, the cholesterol-containing bacteria were constructed.

[0071] 1. Construction of gRNA plasmid for Saccharomyces cerevisiae CAN1 gene locus

[0072] First, plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t (purchased from Beijing Yingrun Jiahe Technology Co., Ltd., containing the CAS9 binding region) was used as a template and primers ΔCAN1-gRNA-F and gRNA-R (primers were synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.) were used for PCR amplification. The ΔCAN1-gRNA sequence was obtained by inputting the CAN1 gene sequence into the chopchop website ( https: / / chopchop.cbu.uib.no / )get.

[0073] The primers used to construct the ΔCAN1 site gRNA (gRNA N20: CGAGGATACGTTCTCTATGG) plasmid are as follows:

[0074]

[0075] The amplification system is as follows (20 μl):

[0076]

[0077] PCR program (20 cycles):

[0078]

[0079] 2×Phanta TM Master Mix high-fidelity enzyme was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0080] After amplification, 1 μL of DMT enzyme was added to the obtained PCR product for digestion, and the digestion condition was incubated at 37° C. for 1 h. DMT enzyme was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0081] The digested product was added to 50 μL Trans1-T1 (purchased from Beijing Quanshijin Biotechnology) competent cells, placed in ice for 30 min, heat-shocked at 42°C for 45 s, and immediately placed in ice for 2 min, added with 500 μL LB medium, revived at 37°C, 180 rpm for 1 h, and 100 μL was spread on LB solid medium containing 50 mg·L-1 Kana, inverted and cultured at 37°C overnight. Single colonies were selected and sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing.

[0082] The sequencing results showed that the ΔCAN1-gRNA plasmid was successfully constructed (N20: CGAGGATACGTTCTCTATGG). The cloning vector was named p426-ΔCAN1-gRNA plasmid and stored in a -80°C refrigerator.

[0083] 2. Construction of homologous recombination fragments

[0084] Cloning of the TEF1t-CAS9-CYC1t expression cassette: Primers ΔCAN1up-TEF1p-F and ΔCAN1down-CYC1t-R were used, with p414-TEF1p-CAS9-CYC1t plasmid (plasmid purchased from Beijing Yingrun Jiahe Technology Co., Ltd.) as template;

[0085] The amplification system is as follows:

[0086]

[0087] The PCR products were subjected to electrophoresis to observe their length and the fragments were purified by gel recovery.

[0088] Cloning of upstream and downstream homologous fragments of the ΔCAN1 region: Use primers ΔCAN1up-F and ΔCAN1up-R to clone the upstream homologous fragment, and use primers ΔCAN1down-F and ΔCAN1down-R to clone the downstream homologous fragment. Perform electrophoresis on the PCR products to observe the length and recover the purified fragments by gel.

[0089] The TEF1t-CAS9-CYC1t expression cassette was connected to the upstream and downstream homologous fragments of the ΔCAN1 region into a long fragment using the fusion PCR method.

[0090] The three short fragments are connected together to form a long fragment through the first PCR (the molar ratio of each fragment is 1:1 or 1:3:1 or 1:3:3:1, and the Tm of the primer extension overlapping part between the connected fragments is 58°C to 60°C).

[0091] The first PCR product was used as a template for the second PCR cloning, and finally the length was observed by electrophoresis and the fragments were purified by gel recovery.

[0092] First PCR system (20 μL, 20 cycles):

[0093]

[0094]

[0095] Second PCR system (50 μL, 35 cycles):

[0096]

[0097] The primers used to construct the homologous repair fragment upstream of the ΔCAN1 site are as follows:

[0098]

[0099] 3. Lithium acetate method to transform Saccharomyces cerevisiae cells

[0100] (1) Pick up a single SQ1 colony on the YPD solid plate with a sterile pipette tip, inoculate it into 1 mL of YPD liquid medium, and culture it in a shaker at 30°C for 16 h;

[0101] (2) inoculating all of the seed solution into 20 mL of synthetic defective liquid culture medium and culturing in a shaker at 30° C. for 5 to 6 h (the A600nm value is approximately between 0.8 and 2.0);

[0102] (3) Transfer all the bacterial solution in the shake flask into a 50 mL centrifuge tube in a clean bench and centrifuge at 3600 r / min at room temperature. -1 , collect the bacteria in a centrifuge for 5 minutes, and then discard the culture medium in a clean bench;

[0103] (4) Resuspend the cells in 10 mL of sterile water and centrifuge again to collect the cells. Repeat this process twice.

[0104] (5) Then resuspend the cells with 600 μL of sterile water and transfer the culture solution to a 1.5 mL sterile centrifuge tube. Centrifuge the tube at 3600 rpm at 4 °C. -1 , collect the bacteria in a centrifuge for 3 minutes, and discard the supernatant in a clean bench;

[0105] (6) Resuspend the cells with 500 μL 1 M lithium acetate (LiAc) and dispense into 1.5 mL centrifuge tubes, 50 μL per tube, and centrifuge at 3600 r / min at 4 °C. -1 , collect the bacteria in a centrifuge for 3 minutes, and discard the supernatant in a clean bench;

[0106] (7) Add the transformation system (50% PEG3350, 1M LiAc, ssDNA, DNA, ddH2O) to the prepared competent cells. The ssDNA needs to be denatured in a boiling water bath for 5 min and immediately placed on an ice box for 2 min. The entire transformation process was carried out on an ice box at 4°C. If the prepared competent cells are not used for transformation immediately, add 100 μL of 20% sterile glycerol to resuspend the cells and store them at -80°C.

[0107] (8) After adding the transformation system, place in a 30°C incubator for 30 min;

[0108] (9) Then heat shock at 42°C for 15 min;

[0109] (10) At 3600 r / min -1 , collect the bacteria after centrifugation for 5 minutes, remove the upper transformation system in the super bench, resuspend with 100 μL sterile water and apply to SD-Ura, Trp double-deficient plates.

[0110] The lithium acetate method for transforming Saccharomyces cerevisiae cells is as follows:

[0111]

[0112] 4. Yeast liquid PCR verification and ΔCAN1-gRNA plasmid removal

[0113] (1) Pick the transformant and add it to 20 μL 20 mmol·L -1 NaOH solution.

[0114] (2) Heat and lyse the cells at 99°C for 15 min in a PCR instrument.

[0115] (3) Centrifuge for 2 min and take 1 μL of the supernatant as a PCR template.

[0116] (4) Add forward and reverse P verification primers and colony PCR verification enzyme 2×Phanta TM Master Mix, ddH2O.

[0117] (5) Observe the size of the bands by gel electrophoresis.

[0118] (6) The single colony verified by PCR was streaked onto SC-5-FOA plates for plasmid removal and cultured at 30°C for three days until colonies grew. Then a single colony was picked and streaked onto SD-Ura and YPD plates respectively. If the Saccharomyces cerevisiae cells can grow normally on YPD plates but not on SD-Ura plates, it means that the gRNA plasmid has been removed. Recombinant bacteria without gRNA plasmids were obtained.

[0119] 5. Knockout of GAL80 gene

[0120] The sequence of the GAL80 gene was uploaded to the Chopchop website, ΔGAL80-gRNA (gRNA N20: GCGGTTGGTACGGCTACGAA) was constructed by the method in 1.1, the homologous repair fragment of ΔGAL80 was constructed by the method in 1.2, and the Saccharomyces cerevisiae chassis cells were transformed by the method in 1.3;

[0121] The transformation system is as follows (the genome already contains the CAS9 gene expression cassette, so there is no need to transfer the CAS9 plasmid during transformation):

[0122]

[0123] The recombinant bacteria were verified by the methods in 1 and 4 and the ΔGAL80-gRNA plasmid was knocked out to obtain the recombinant bacteria without the ΔGAL80-gRNA plasmid.

[0124] 6. Overexpression of ERG9 and ERG20 genes

[0125] Construct X-3-gRNA (gRNA N20: CTAATGTGTCCGCGTTCTA) by the method in 1.1; construct the homologous repair fragment of the yeast genome X-3 site by the method in 1.2; transform the cerevisiae chassis cells by the method in 1.3; verify the recombinant bacteria by the method in 1.4 and knock out the X-3-gRNA plasmid to obtain the recombinant bacteria without the X-3-gRNA plasmid.

[0126] 7. Knockout of BTS1 gene and overexpression of tHMG1 and ERG1 genes

[0127] The sequence of the BTS1 gene was uploaded to the Chopchop website, and the ΔGAL80-gRNA (gRNA N20: AAGTTAAGGGCGTGGACGAT) was constructed by the method in 1.1; the homologous repair fragment of ΔBTS1 was constructed by the method in 1.2; the Saccharomyces cerevisiae chassis cells were transformed by the method in 1.3; the recombinant bacteria were verified by the method in 1.4 and the ΔBTS1-gRNA plasmid was knocked out to obtain the recombinant bacteria without the ΔBTS1-gRNA plasmid.

[0128] 8. Connection of sterol 7 reductase gene St7SRopt and sterol 24 reductase gene St24SRopt

[0129] Construct XI-3-gRNA (gRNA N20: ATATGTCTCTAATTTTGGAA) by the method in 1.1; construct a homologous repair fragment of the yeast genome XI-3 site by the method in 1.2; transform Saccharomyces cerevisiae chassis cells by the method in 1.3; verify the recombinant bacteria by the method in 1.4 and knock out the XI-3-gRNA plasmid to obtain a recombinant bacteria without the XI-3-gRNA plasmid.

[0130] The recombinant bacteria in which the sterol 7-position reductase gene St7SRopt and the sterol 24-position reductase gene St24SRopt were connected were named TZ13 strain.

[0131] 9. Optimization of cholesterol recombinant bacteria TZ13

[0132] By replacing the ERG6 promoter with the ERG7 promoter, the competition pathway of endogenous yeast sterol in Saccharomyces cerevisiae was weakened to increase the production of cholesterol; the gRNA (gRNA N20: GTCAAATCAACCAAACAGCT) (gRNA-R, pERG6-gRNA) of the pERG6 promoter site was constructed using the method in 1, and the homologous repair fragment of the ERG6 promoter (pERG6-up, pERG6-down) was constructed, and the primers used were as follows:

[0133]

[0134] Primers and methods are from [Xu L, Wang D, Chen J, Li B, Li Q, Liu P, Qin Y, Dai Z, Fan F, Zhang X. Metabolic engineering of Saccharomyces cerevisiae for gram-scalediosgenin production. Metab Eng. 2022, 70: 115-128.]

[0135] After PCR colony verification, the recombinant bacteria was named TZ14.

[0136] 10. Recombinant strain fermentation and metabolite detection

[0137] Pick the positive clone recombinant bacteria of the knockout URA vector, culture them in 2mL YPD (2% glucose) liquid medium for 12h, measure the OD600 value, take part of the bacterial solution and inoculate it in 100ml YPD (2% glucose) medium at 30℃, shake and culture for 120 at 200rpm, collect the bacteria by centrifugation, break the Saccharomyces cerevisiae cells, add 10ml of 20% potassium hydroxide solution (prepared with 50% ethanol), resuspend and place in boiling water for 10min to lyse the cells. Then extract with equal volume of ethyl acetate 3 times, centrifuge to take the supernatant, and add anhydrous sodium sulfate to remove water. After nitrogen blowing and concentration, add 1mL ethyl acetate to dissolve, transfer to a gas phase vial, and analyze the extracted fermentation products by gas chromatography-mass spectrometry.

[0138] Figure 2 This is the fermentation result of strains TZ13 and TZ14. It can be seen that the production of cholesterol has increased after optimization.

[0139] Example 2: Construction and Optimization of Diosgenin-Bottom Plate Bacteria

[0140] Construction and optimization of diosgenin-producing bacteria

[0141] 1. Construction of 22-hydroxycholesterol-containing bacteria

[0142] Based on the cholesterol-binding bacteria TZ14, the gRNA construction method and homologous repair fragment construction method in 1 were used to connect the AtCPR1opt and PpCYP90B27opt genes at the V-1 site of the yeast genome (gRNA N20: CGTTTATAGACGGCACTGTC) to construct the 22-hydroxycholesterol-binding bacteria and produce the recombinant bacteria TZ15.

[0143] 2. Optimization of 22-hydroxycholesterol-producing bacteria

[0144] Based on the cholesterol-containing bacteria TZ15, the gRNA construction method and homologous repair fragment construction method in 1 were used to overexpress the AtCPR1opt and PpCYP90B27opt genes at the III-1 (gRNA N20: TTAGCAACGCTCAGGGACTC) site of the yeast genome to produce the recombinant bacteria TZ18.

[0145] The recombinant strains TZ15 and TZ18 were fermented and their metabolites were detected using the method described above.

[0146] Figure 3 This is the fermentation result of TZ15 and TZ18 strains. It can be seen that the production of 22-hydroxycholesterol was significantly improved after overexpression of AtCPR1opt and PpCYP90B27opt genes. The production of 22-hydroxycholesterol reached 133.81 mg / L, which was 4.4 times higher than that of TZ15 strain.

[0147] 3. Screening of the Diosgenin Biosynthesis Gene CYP90G4

[0148] Based on the 22-hydroxycholesterol chassis bacteria TZ18, the gRNA construction method and homologous repair fragment construction method in 1 were used to merge and connect the non-codon-optimized DzCYP90G6 from Dioscorea zingiberensis (sequence 6, resulting in TZ23), PpyCYP90G4 from Paris polyphylla (sequence 7, resulting in TZ24), PpcCYP90G4 from Paris polyphylla (sequence 8, resulting in TZ26), and TtCYP90G4 from Trillium sphaerocephalum (sequence 9, resulting in TZ27) with the PpCYP94D108opt genome at the V-3 site of the yeast genome (gRNA N20: CGTCTAGAAGAACAGCACAT) to construct chassis bacteria TZ23, TZ24, TZ26, and TZ27 capable of producing diosgenin.

[0149] The recombinant strains TZ23, TZ24, TZ26 and TZ27 were fermented and their metabolites were detected using the method described in (1).

[0150] Figure 4 These are the fermentation results of strains TZ23, TZ24, TZ26 and TZ27 (results of CYP90G4 isozyme screening). The production of diosgenin can be seen. The production of the four strains is 11.49 mg / L, 5.14 mg / L, 3.89 mg / L and 6.29 mg / L, respectively. The best effect is the TZ23 strain constructed with DzCYP90G6 from Dioscorea zingiberensis.

[0151] 4. Construction and optimization of diosgenin-producing bacteria

[0152] Based on the Diosgenin-based bacteria TZ18, the gRNA construction method and homology repair fragment construction method in 1 were used to overexpress AtCPR1opt at the XII-2 site of the yeast genome (gRNA N20:TGAAACTCTAATCCTACTAT) to ensure that P450 fully functions. The codon-optimized DzCYP90G6opt (sequence 10) and PpCYP94D108opt genes were connected at the V-3 site of the yeast genome using the gRNA construction method and homology repair fragment construction method in 1 to generate the recombinant strain TZ30. Based on the TZ30 strain, the gRNA construction method and homology repair fragment construction method in 1 were used to overexpress the DzCYP90G6opt and PpCYP94D108opt genes at the XI-5 site of the yeast genome (gRNA N20:TGAGAATACTGTTGTAAAAC) to generate the recombinant bacteria TZ35.

[0153] The recombinant strains TZ30 and TZ35 were fermented and their metabolites were detected using the method described above.

[0154] Figure 5 The fermentation results of strains TZ30 and TZ35 show that after codon optimization of DzCYP90G6, the diosgenin production reached 32.39 mg / L, which was significantly higher than the 11.49 mg / L production of strain TZ23 (increased by 1.81 times). After overexpression of DzCYP90G6opt and PpCYP94D108opt genes, the diosgenin production was further increased to 40.10 mg / L (increased by 2.48 times compared to strain TZ23).

[0155] Example 3: Construction of Paris polyphylla saponin II base strain

[0156] Based on the Dioscorea saponin-based bacteria TZ35, the gRNA construction method and homologous repair fragment construction method in 1 were used to connect the PpcUGT4opt gene and its mutant, the PpyUGT16opt gene and the RHM1opt gene, and the UGT93M3opt gene and the UGT738A3opt gene at the XI-2 (gRNA N20: GCTTTACTTGTGGAAGTTCA) site, XII-1 (gRNA N20: GGTATGTGCAGTTGATTCAC) site and XII-4 (gRNA N20: GCTTCAAGAATTGAGTAAAC) site of the yeast genome for expression to produce recombinant bacteria TZ42 and TZ43.

[0157] The recombinant strains TZ42 and TZ43 were fermented and their metabolites were detected by the following method.

[0158] Pick the positive clone recombinant bacteria of the knockout URA vector, culture them in 2mL YPD (2% glucose) liquid medium for 12h, measure the OD600 value, take part of the bacterial solution and inoculate it in 100ml YPD (2% glucose) medium at 30℃, shake and culture for 120 at 200rpm, collect 10ml fermentation liquid, and ultrasonically disrupt the Saccharomyces cerevisiae cells in the fermentation liquid. Then extract with equal volume of n-butanol 3 times, centrifuge and take the supernatant. After nitrogen blowing and concentration, add 1mL methanol to dissolve, transfer to a liquid phase vial, and analyze the extracted fermentation product by liquid chromatography-mass spectrometry.

[0159] Figure 6 These are the fermentation results of strains TZ42 and TZ43. It can be seen that the yield of Parisopsis saponin II of TZ42 is 0.04 mg / L, and the yield of Parisopsis saponin II of TZ43 is 0.13 mg / L.

[0160] Figure 7 LC-MS spectrum of the fermentation results of Paris polyphylla saponin II

[0161] The present invention relates to the genotype of the strain:

[0162]

Claims

1. A recombinant bacterium TZ14, which is a recombinant bacterium of the following modifications on the chassis of Saccharomyces cerevisiae CEN.PK113-5D: (1) Knockout the arginine transporter CAN1 gene, geranylgeranyl phosphate synthase gene BTS1 and GAL80 gene in the bottom fungus; (2) overexpression of 3-hydroxy-3-methylglutaryl-CoA reductase 1 gene tHMG1, squalene synthase gene ERG9, squalene epoxidase gene ERG1, and farnesyl pyrophosphate synthase gene ERG20; (3) Expression of CRISPR-related gene CAS9; (4) expressing the sterol 7-reductase gene St7SRopt and the sterol 24-reductase gene St24SRopt; and (5) In the chassis bacteria, the promoter of ERG7 is used to replace the promoter of ERG6.

2. The recombinant bacteria according to claim 1, wherein the overexpression of 3-hydroxy-3-methylglutaryl-CoA reductase 1 gene tHMG1, squalene synthase gene ERG9, squalene epoxidase gene ERG1 and farnesyl pyrophosphate synthase gene ERG20 is achieved by inserting the tHMG1 expression cassette, ERG9 expression cassette, ERG1 expression cassette and ERG20 expression cassette into the bottom plate bacteria; the expression of CRISPR-associated gene CAS9 is achieved by inserting the CAS9 expression cassette into the bottom plate bacteria; the expression of sterol 7-position reductase gene St7SRopt and sterol 24-position reductase gene St24SRopt is achieved by inserting the St7SR and St24SR expression cassettes into the bottom plate bacteria; The tHMG1 gene expression cassette includes a TDH3p promoter, a tHMG1 gene derived from Saccharomyces cerevisiae and a FBA1t terminator; The ERG9 expression cassette includes a PGK1p promoter, an ERG9 gene from Saccharomyces cerevisiae and a FBA1t terminator; The ERG20 expression cassette includes a TDH3p promoter, an ERG20 gene from Saccharomyces cerevisiae, and a CYC1t terminator; The ERG1 expression cassette includes a TEF1p promoter, an ERG1 gene from Saccharomyces cerevisiae and an IDP1t terminator; The CAS9 expression cassette includes a TEF1p promoter, a CRISPR-associated protein CAS9 gene and a CYC1t terminator; The St7SRopt expression cassette includes a GAL10p promoter, a St7SRopt gene derived from potato, and a CYC1t terminator; The St24SRopt expression cassette includes a GAL1p promoter, a St24SRopt gene derived from potato, and an ADH1t terminator.

3. A recombinant bacterium, which is further modified in any of the following ways based on the chassis bacterium TZ14, wherein the modification is: (1) expressing the AtCPR1opt and PpCYP90B27opt genes at the V-1 site of the yeast genome to obtain the recombinant bacterium TZ15; or (2) The AtCPR1opt and PpCYP90B27opt genes were overexpressed at the III-1 site of the yeast genome to obtain the recombinant bacterium TZ18.

4. The recombinant bacteria according to claim 3, wherein the expression of AtCPR1opt and PpCYP90B27opt genes is to integrate the AtCPR1opt and PpCYP90B27opt expression cassettes into the corresponding sites of TZ14 of the bottom plate bacteria, and the overexpression of AtCPR1opt and PpCYP90B27opt genes is to integrate the AtCPR1opt and PpCYP90B27opt expression cassettes into the corresponding sites of TZ15 of the bottom plate bacteria; The PpCYP90B27opt expression cassette includes a GAL10p promoter, a PpCYP90B27opt gene derived from Paris polyphylla and a PGK1t terminator; The AtCPR1opt expression cassette includes a GAL1p and / or GAL10p promoter, an AtCPR1opt gene derived from Arabidopsis thaliana, and an ADH1t terminator.

5. A recombinant bacterium, which is further modified in any of the following ways based on the bottom plate bacterium TZ18, wherein the modification is to combine and connect the sterol 16,22-dihydroxylase gene and the sterol 26-hydroxylase gene PpCYP94D108opt at the V-3 site of the bottom plate bacterium TZ18 genome, so that the corresponding bacterium expresses the sterol 16,22-dihydroxylase gene and the sterol 26-hydroxylase gene: (1) combining and ligating the sterol 16,22-dihydroxylase gene DzCYP90G6 from Dioscorea zingiberensis and the sterol 26-hydroxylase gene PpCYP94D108opt to obtain strain TZ23; or (2) combining and connecting the sterol 16,22-dihydroxylase gene PpyCYP90G4 and the sterol 26-hydroxylase gene PpCYP94D108opt from Paris polyphylla to obtain strain TZ24; or (3) combining and connecting the sterol 16,22-dihydroxylase gene PpcCYP90G4 and the sterol 26-hydroxylase gene PpCYP94D108opt from Paris polyphylla to obtain strain TZ26; or (4) combining and ligating the sterol 16,22-dihydroxylase gene TtCYP90G4 and the sterol 26-hydroxylase gene PpCYP94D108opt from Trillium to obtain strain TZ27; in, The expression of sterol 16,22-dihydroxylase gene and sterol 26-hydroxylase gene is to integrate the 16,22-dihydroxylase gene expression cassette and the sterol 26-hydroxylase gene expression cassette into the corresponding sites of the bottom plate fungus TZ18, The sterol 16,22-dihydroxylase gene expression cassette includes a GAL10p promoter, a gene corresponding to the expression of 16,22-dihydroxylase, and a TEF1t terminator; The sterol 26-hydroxylase gene expression box comprises a GAL1p promoter, a PpCYP94D108opt gene derived from Paris polyphylla and a HXT7t terminator.

6. A recombinant bacterium, which is further modified on the basis of the bottom plate bacterium TZ18 in the following manner, wherein the modification is to combine and connect the codon-optimized sterol 16,22-dihydroxylase gene DzCYP90G6opt and the sterol 26-hydroxylase gene PpCYP94D108opt at the V-3 site of the bottom plate bacterium TZ18 genome, and overexpress AtCPR1opt at the XII-2 site of the bottom plate bacterium genome to obtain the recombinant bacterium TZ30; The overexpression of AtCPR1opt is to integrate the AtCPR1opt expression cassette into the corresponding site of the bottom plate bacteria TZ18; The AtCPR1opt expression cassette includes a GAL1p and / or GAL10p promoter, an AtCPR1opt gene derived from Arabidopsis thaliana, and an ADH1t terminator.

7. The recombinant bacterium according to claim 6, comprising the following transformation, overexpressing the optimized DzCYP90G6opt gene and PpCYP94D108opt gene in the genome XI-5 of the chassis bacterium TZ30 to obtain the recombinant bacterium TZ35; The overexpression of DzCYP90G6opt and PpCYP94D108opt genes is to integrate the DzCYP90G6opt gene expression cassette and the PpCYP94D108opt gene expression cassette into the corresponding sites of the bottom bacteria. The DzCYP90G6opt gene expression cassette includes a GAL10p promoter, an optimized DzCYP90G6opt gene and a TEF1t terminator; The PpCYP94D108opt gene expression box includes a GAL1p promoter, a PpCYP94D108opt gene and a HXT7t terminator.

8. A recombinant bacterium, which is further modified as follows based on the chassis bacterium TZ35: (1) The PpcUGT4opt gene was connected at the XI-2 locus of the base bacteria genome, the PpyUGT16opt gene and the RHM1opt gene were connected at the XII-1 locus, and the UGT93M3opt gene and the UGT738A3opt mutant UGT738A3opt were connected at the XII-4 locus. P101L / A158T Gene, to obtain recombinant bacteria TZ42; or (2) Connecting the PpcUGT4opt mutant PpcUGT4opt at the XI-2 site of the chassis bacteria genome F211Y / L302T The XII-1 site connects the PpyUGT16opt gene with the RHM1opt gene, and the XII-4 site connects the UGT93M3opt gene with the UGT738A3opt mutant UGT738A3opt P101L / A158T gene and obtained the recombinant bacterium TZ43.

9. Use of the recombinant bacterium according to any one of claims 1 to 8 in producing cholesterol-related steroid compounds or increasing the yield of cholesterol-related steroid compounds.

10. The use according to claim 9, wherein the cholesterol-related compound is cholesterol, 22-hydroxycholesterol, diosgenin, dioscin or paridis saponin.

Images