A gene regulating the growth and development of common thrips and its application
By targeting the Mu10 gene of common thrips with RNA interference technology, and preparing a biological agent using dsRNA and the nanomaterial PDI-PAmAm, the expression of the Mu10 gene is interfered with. This solves the problems of unsatisfactory chemical control and resistance, and achieves efficient, safe and environmentally friendly control of common thrips.
Patent Information
- Application Number
- CN202510496012.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-21
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2045-04-21
AI Technical Summary
Existing chemical control methods are not effective against common thrips and lead to resistance and environmental pollution, necessitating a more precise and environmentally friendly control approach.
Using RNA interference technology, a biological agent was prepared by targeting the Mu10 gene of common thrips and using dsRNA and the nanomaterial PDI-PAmAm to interfere with the expression of the Mu10 gene and affect its growth and development.
It significantly reduces the survival rate and growth of common thrips, providing a more efficient, safe, and environmentally friendly control method and solving the problem of drug resistance.
Smart Images

Figure CN120118912B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological control of agricultural pests, and specifically relates to a gene for regulating the growth and development of Megalurothrips usitatus Bagnall and application thereof. BACKGROUND
[0002] Megalurothrips usitatus Bagnall is a global pest of economic crops such as leguminous plants and solanaceous plants, belonging to the order Thysanoptera and the family Thripidae. The nymphs and adults of the pest suck plant sap, causing silver spots on leaves and fruit deformity, and transmitting multiple plant viruses, which can cause a sharp reduction in crop yield. In recent years, with the expansion of facility agriculture and frequent cross-regional trade, the suitable area of the pest is continuously expanding, and the population density is explosively increasing in warm and humid areas. Due to the characteristics of the pest such as small body size, hidden damage, strong reproductive capacity, short development period, serious overlapping of generations, and pupation in soil, the chemical control effect is often unsatisfactory. However, high-frequency and high-dose application of chemical pesticides can cause the pest to develop resistance to various commonly used insecticides to different extents, and the negative impact of chemical pesticide residues on pollinating insects and ecological chains has caused widespread concern. Under this background, the RNA interference (RNAi) -based targeted gene interference technology has become an important research direction for green pest control due to its high species specificity and strong environmental compatibility.
[0003] The RNAi technology triggers sequence-specific mRNA degradation in insect cells by delivering double-stranded RNA (dsRNA) targeting genes, thereby blocking the synthesis of target proteins. Compared with traditional insecticides, dsRNA can be delivered by spraying, root application or transgenic crops, and its degradation products have no biological accumulation risk, which meets the sustainable development needs of "precision agriculture" and "pest control by reducing pesticides". Studies have shown that insect molting and body size development are regulated by a conserved hormone pathway and gene network, however, further research is still needed for RNAi based on the conserved gene network of insects for control. SUMMARY
[0004] The present inventors have found a regulatory gene Mu10 that plays a key role in the transformation from nymph to adult through research on the conserved gene network of Megalurothrips usitatus Bagnall. The expression peak of Mu10 is highly consistent with the initiation period of molting of 4th instar nymphs (pseudopupae). Interfering with the function of Mu10 can cause the body length and wing length of Megalurothrips usitatus Bagnall nymphs to be shortened and deformed, and eventually cause the development of adult insects to be arrested or deformed to death, which can be used for biological control of Megalurothrips usitatus Bagnall, thereby completing the present application.
[0005] In one aspect of the present application, a gene Mu10 for regulating the growth and development of common chrysanthemum stink bugs is disclosed, wherein the nucleotide sequence of the Mu10 gene is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2.
[0006] In one embodiment, the Mu10 gene is obtained by PCR amplification with the genome of common chrysanthemum stink bugs as a template.
[0007] In one embodiment, the primer set for PCR amplification of the Mu10 gene comprises an upstream primer Mu10 primer F and a downstream primer Mu10 primer R, wherein the sequences of the upstream primer and the downstream primer are shown as SEQ ID NO. 4 and SEQ ID NO. 5, respectively.
[0008] In one aspect of the present application, the application of the Mu10 gene is disclosed, wherein the application is to prepare a preparation for interfering with the Mu10 gene with the Mu10 gene or a fragment thereof as a template.
[0009] In one aspect of the present application, a gene interfering fragment for affecting the growth and development of common chrysanthemum stink bugs is disclosed, wherein the interfering fragment can be used for preparing a dsRNA for interfering with the Mu10 gene.
[0010] In one embodiment, the sequence of the interfering fragment of the Mu10 gene is shown as SEQ ID NO. 3.
[0011] In one embodiment, the interfering fragment of the Mu10 gene is obtained by amplification with the Mu10 gene as a template, wherein the sequences of the upstream primer and the downstream primer in the primer combination used for amplification are shown as SEQ ID NO. 6 and SEQ ID NO. 7, respectively.
[0012] In one aspect of the present application, a dsRNA for affecting the growth and development of common chrysanthemum stink bugs is disclosed, wherein the dsRNA is synthesized by in vitro transcription with the interfering fragment of the Mu10 gene as a template. Preferably, the nucleotide sequence of the gene interfering fragment is shown as SEQ ID NO. 3.
[0013] In one aspect of the present application, a biological preparation for affecting the growth and development of common chrysanthemum stink bugs or even causing the death of common chrysanthemum stink bugs is disclosed, wherein the preparation comprises a dsRNA and a nanomaterial, the dsRNA is directed against the Mu10 gene disclosed in the present application, and the nanomaterial is a polyamide-amine dendrimer material.
[0014] In one embodiment, the dsRNA is transcribed from a gene interference fragment with nucleotide sequence as shown in SEQ ID NO. 3. Preferably, the nanomaterial is PDI-PAmAm, which is a highly water-soluble polyamidoamine with perylene diimide (PDI) as the core and amine groups on the periphery. The preparation method can refer to "Highly water-soluble perylenediimide-cored poly(amido amine) vector for efficient gene transfection", DOI: 10.1039 / x0xx00000x, Zejun Xu, et al; Journal of Materials Chemistry B, 2013.
[0015] In one embodiment, the use ratio of the dsRNA and the nanomaterial PDI-PAmAm is 1:1.
[0016] In one aspect of the present application, a method for preventing and treating Megalurothrips usitatus Bagnall is disclosed, which comprises treating Megalurothrips usitatus Bagnall with the biological agent.
[0017] Advantages
[0018] The present application provides a method for targeting and regulating the growth and development of Megalurothrips usitatus Bagnall based on RNA interference (RNAi), and related molecular biology methods, especially the interference technology of the pupal stage high expression gene Mu10 of Megalurothrips usitatus Bagnall, which inhibits the growth and development of Megalurothrips usitatus Bagnall and significantly reduces the survival rate of Megalurothrips usitatus Bagnall. The present application provides a new idea and technical support for inhibiting the growth and development of Megalurothrips usitatus Bagnall and solving the problem of drug resistance of Megalurothrips usitatus Bagnall in a more efficient, safe and environmentally friendly way. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 . Relative expression amount of Megalurothrips usitatus Bagnall Mu10 gene in different developmental stages. Among them, L1: first instar nymph; L2: second instar nymph; PP: pre-pupa; P: pupa; Ad: adult. The data in the figure are mean ± standard error, and different letters on the column indicate significant differences in Mu10 expression amount in different developmental stages (single factor ANOVA analysis, P<0.001).
[0020] Figure 2The relative mRNA expression levels of the Mu10 gene in third-instar nymphs (prepupae) of *Thrips simianus* were determined 48 hours after immersion in dsEGFP and dsMu10, respectively, on their pronotum. GAPDH and TUBA were used as internal control genes. The enhanced green fluorescent protein (EGFP) gene was used as a reporter gene in the control group, and the same dose of dsEGFP was used in the control group. * indicates a significant difference in Mu10 gene expression among different treatments at the same sampling time (Student's t-test, P<0.05).
[0021] Figure 3 Figure 1 shows the changes in body length of fourth instar nymphs (pupae) after immersing the pronotum in dsEGFP and dsMu10, respectively. A represents the phenotype between different treatments, and B represents the data analysis between different treatments. ** indicates a significant difference in Mu10 gene expression among different treatments at the same sampling time (Student's t-test, P<0.01).
[0022] Figure 4 Graph showing the changes in wing length of fourth instar nymphs (pupae) after immersion in dsEGFP and dsMu10 on the pronotum, respectively. A represents the phenotype between different treatments, and B represents the data analysis between different treatments. *** indicates a significant difference in Mu10 gene expression among different treatments at the same sampling time (Student's t-test, P<0.001).
[0023] Figure 5 Morphological changes in third-instar nymphs (prepupae) of *Thrips simonii* 12 to 96 hours after immersion in dsEGFP and dsMu10 on the pronotum. AC represent 12 to 48 hours, 60 to 72 hours, and 84 to 96 hours after dsRNA treatment of third-instar nymphs (prepupae), respectively.
[0024] Figure 6 Survival curves of third instar nymphs (prepupae) of common thrips after immersion in dsEGFP and dsMu10 for 12 to 96 hours. Detailed Implementation
[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.
[0026] Example 1: Obtaining the full-length sequence of the common Stilt bug Mu10 gene.
[0027] The transcriptome of different age stages of the common Stilt bug was sequenced by the illumina NovaSeq 6000 (illumina, USA) sequencing platform. By comparing the sequencing results of the pupal stage (third instar, fourth instar nymphs) and non-pupal stage (first instar, second instar nymphs and adults), the genes highly expressed in the pupal stage relative to the non-pupal stage were selected, thereby obtaining the full-length sequence of the Mu10 gene, the nucleotide sequence is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2. The primer set for PCR amplification of the Mu10 gene was obtained by construction and screening, which includes the upstream primer Mu10 primer F and the downstream primer Mu10 primer R, the sequences are shown as SEQ ID NO. 4 and SEQ ID NO. 5, respectively.
[0028] Example 2: Verification of the high expression of the common Stilt bug Mu10 gene in the pupal stage.
[0029] The first instar, second instar, third instar, fourth instar nymphs and adults hatched at the same time were collected, total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) reagent, and reverse transcribed into cDNA using the reverse transcription kit TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Beijing Quanshi Gold Biology). The Ct value of the Mu10 gene of the common Stilt bug nymphs at different age stages was determined using RT-qPCR, GAPDH and TUBA were selected as internal reference genes, and the relative expression of the Mu10 gene was calculated using the 2 -ΔΔCt Method to calculate the relative expression of the gene, and the log 10 (2 -ΔΔCt ) analysis of the significant differences in Mu10 expression at different ages.
[0030] Referring to Figure 1 , the results show that Mu10 has a low expression in the first instar nymphs, and almost no expression in the second instar nymphs. The expression amount increases sharply in the third instar pre-pupal stage, which is about 447 times higher than that in the first instar nymphs, and reaches a peak in the fourth instar pupal stage, which is about 2.4 times higher than that in the third instar. The expression amount in the adult stage decreases, and there is no significant difference with the first and second instars.
[0031] Example 3: Obtaining the common Stilt bug Mu10 gene interference fragment and its dsRNA.
[0032] (1) The specific upstream primer dsMu10 primer F and downstream primer dsMu10 primer R for RNA interference were designed by SnapDragon online long dsRNA primer design software (https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl) based on the common cirsium moth Mu10 gene with nucleotide sequence as shown in SEQ ID NO. 1, and the T7 promoter sequence GGATCCTAATACGACTCACTATAGG was added before the primer.
[0033] (2) The upstream primer dsMu10 primer F (SEQ ID NO. 6) containing T7 promoter and the downstream primer dsMu10 primer R (SEQ ID NO. 7) containing T7 promoter were used to amplify the product (TMu10) by PCR with pEASY-Mu10 plasmid containing common cirsium moth Mu10 gene as template, and the product sequence was as shown in SEQ ID NO. 3. The product after purification of PCR product was used as template to synthesize dsMu10 by using T7 RiboMAX™ Express RNAi System (Promega Corporation). The in vitro transcription system was 20 μL: Express T7 2x Buffer 10 μL, Enzye Mix 2 μL, 1 μg of each system plasmid template, and RNase free water was added to 20 μL. Then the purity and integrity of dsMu10 were detected by 1.5% agarose gel electrophoresis, and the concentration of dsMu10 was measured at 260 nm by Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific Inc., Carlsbad, CA, USA), and then it was stored in -80℃ ultra-low temperature refrigerator for standby.
[0034] (3) dsEGFP of enhanced green fluorescent protein EGFP gene was prepared by the same method (the nucleotide sequence of EGFP gene refers to NCBI accession number KR072508).
[0035] Example 4 Biological preparation affecting the growth and development of common cirsium moth
[0036] 4.1 Preparation of biological preparation
[0037] Take 600 ng / μL of dsMu10 and 1 mg / mL of nanomaterial PDI-PAmAm (a highly water-soluble polyamide amine with an amine group on the periphery, with perylene diimide (PDI) as the core, and its preparation method can be referred to in "Highly water-soluble perylenediimide-cored poly(amido amine) vector for efficient gene transfection", DOI: 10.1039 / x0xx00000x, Zejun Xu, et al; Journal of Materials Chemistry B, 2013.) 1:1 uniformly mixed to make a biological preparation. As a control, take 600 ng / μL of dsEGFP and 1 mg / mL of nanomaterial (PDI-PAmAm) 1:1 uniformly mixed to make a control preparation.
[0038] 4.2Mu10 gene interference fragment dsMu10 soaking:
[0039] 480 common thrips 3rd instar nymphs (pre-pupae) of the same period and similar morphology were selected, and a control group of dsEGFP (i.e. control preparation) and an experimental group of dsMu10 (i.e. biological preparation of the application) were set up. Each nymph was soaked in 0.3 μL of treatment solution for 10 min, and observation under a body microscope ensured that each nymph was completely soaked in the droplet, so that the interference fragment entered the body cavity of the nymph. Each group had 240 heads, and 3 biological replicates (n = 80) were set up.
[0040] 4.3Mu10 gene interference efficiency detection
[0041] Forty nymphs were randomly collected from each biological replicate in each group at 48 hours after soaking interference. TRIzol (Invitrogen, Carlsbad, CA, USA) reagent was used to extract total RNA, and a reverse transcription kit TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (Beijing Quanshi Gold Biology) was used to reverse transcribe it into cDNA. The Ct value of the Mu10 gene of the common thrips nymph after interference was determined using RT-qPCR, GAPDH and TUBA were selected as internal reference genes, and 2 -ΔΔCt Method for calculating gene relative expression and interference efficiency.
[0042] See Figure 2 The results show that compared with the control group soaked in dsEGFP, the experimental group soaked in dsMu10 has an interference efficiency of 31.1% after 48 hours, and the difference is significant (P = 0.0254).
[0043] 4.4 Changes in body length of common bug nymphs
[0044] After 48h of soaking, 30 live nymphs were randomly collected from each group and observed under an electric zoom microscope (AxioZoom.V16, Zeiss, Germany) to measure the body length of the nymphs in the experimental and control groups. See Figure 3 After comparing with the control group, it was found that the wing length of the 4th instar nymphs (pupae) of common bugs was significantly reduced after interfering with the Mu10 gene. The average body length of the dsEGFP and dsMu10 soaking groups was 1191.989 μm and 1097.185 μm, respectively, and there was a significant difference (P = 0.0012).
[0045] 4.5 Changes in wing length of common bug nymphs
[0046] After 48h of soaking, 30 live nymphs were randomly collected from each group and observed under an electric zoom microscope (AxioZoom.V16, Zeiss, Germany) to measure the wing length of the nymphs in the experimental and control groups. See Figure 4 After comparing with the control group, it was found that the wing length of the 4th instar nymphs (pupae) of common bugs was significantly reduced after interfering with the Mu10 gene. The average wing length of the dsEGFP and dsMu10 soaking groups was 584.475 μm and 523.972 μm, respectively, and there was a significant difference (P = 0.0002).
[0047] 4.6 Changes in the morphology of common bug nymphs
[0048] After soaking, 40 live nymphs were randomly collected from each group, and an electric zoom microscope (AxioZoom.V16, Zeiss, Germany) was used to take pictures every 12 hours to record the lethal and teratogenic phenotypes of dsMu10, for a total of 96 hours of observation. See Figure 5 The results showed that, compared with the dsEGFP control group, the dsMu10 treatment group exhibited significant phenotypic abnormalities at three developmental stages: from 12h to 48h after interference, the nymphs (pupal stage) remained straight and plump, with good wing bud development; however, the nymphs after dsMu10 interference had abnormal body wall development, with body axis bending and segment atrophy, and the wing primordium development was blocked, forming irregular wrinkle structures. (See Figure 5 from 60h to 72h, some common bugs at the eclosion stage exhibited eclosion disorders, leading to developmental arrest and death. (See Figure 5(Medium B). Continued observation of the adult stage from 72 to 96 hours after treatment revealed that adults successfully emerging after dsMu10 interference exhibited significantly reduced body size and abnormal wing development, including misaligned wing veins, asymmetry between the left and right wings, and reduced wing area. The control group of common thrips adults showed uniform body color and intact wing shape. (See...) Figure 5 (C)
[0049] 4.7 Changes in the survival rate of common thrips
[0050] After immersion disturbance, 40 live nymphs were randomly collected from each group. The number of surviving and dead nymphs was recorded every 12 hours until molting was complete, for a total observation period of 96 hours. See also Figure 6 The results showed that in the control group, starting from hour 0, the number of deaths every 12 hours was 0, 2, 2, 4, 0, 3, 0, 1, 1, for a total of 13 deaths, with a survival rate of 66.9%. In the experimental group, starting from hour 0, the number of deaths every 12 hours was 0, 7, 5, 2, 1, 3, 2, 1, 1, for a total of 22 deaths, with a survival rate of 45%. There was a significant difference in survival rate between the dsMu10 treatment group and the dsEGFP control group (P = 0.0365).
[0051] In summary, the dsRNA (dsMu10) targeting the Mu10 gene of the common thrips provided by this invention can significantly reduce the body length, wing length, and survival rate of the common thrips. This results in a more efficient, safe, and environmentally friendly control of the common thrips, providing new ideas and technical support for solving the problem of herbicide resistance in the common thrips.
[0052] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.
Claims
1. A gene for regulating the growth and development of common chrysanthemum stink bugs Mu10 characterized in that, The Mu10 The nucleotide sequence of the gene is shown as SEQ ID NO. 1 and the amino acid sequence is shown as SEQ ID NO.
2.
2. A method as claimed in claim 1 Mu10 application of a gene, characterized in that The application is to use Mu10 The dsRNA is prepared by using a gene fragment as a template Mu10 The nucleotide sequence of the fragment is shown as SEQ ID NO.
3.
3. A gene interference fragment affecting the growth and development of a common chrysanthemum stink bug, characterized in that, The interfering fragments can be used to prepare dsRNA that interferes with the expression of a gene as defined in claim 1 Mu10 The sequence of the interfering fragment is shown in SEQ ID NO.
3.
4. A dsRNA affecting the growth and development of a common chinch bug, characterized in that, The dsRNA is synthesized in vitro by transcription using as a template a gene interfering fragment whose nucleotide sequence is shown in SEQ ID NO.
3. Mu10 The dsRNA is synthesized in vitro by transcription using as a template a gene interfering fragment whose nucleotide sequence is shown in SEQ ID NO.
3.
5. A biological agent affecting the growth and development of Frankliniella occidentalis even to death, characterized in that, The biological agent comprises dsRNA and nanomaterial, the dsRNA is transcribed by taking the gene interference fragment as a template, and the nanomaterial is polyamide-amine dendrimer material PDI-PAmAm.
6. The biological preparation of claim 5, wherein, The use ratio of the dsRNA and the nanomaterial PDI-PAmAm is 1:
1.
7. A method for controlling Chaetocnema pennata, characterized by, The method comprises treating the common chrysanthemum beetle by using the biological agent in any one of claims 5-6.
Citation Information
Patent Citations
Primer group dsFoTOF / Rs, DNA, dsRNA and kit for preventing and controlling thrips as well as application and method
CN116606851A
Synthesis method and application of dsRNA (double-stranded ribonucleic acid) of occidentalis occidentalis larva cuticle protein 1 gene
CN117866961A