A PagMOM1 gene and its application in improving wood

Abstract

The present invention relates to the field of genetic engineering technology, and specifically to a PagMOM1 Genes and their applications in wood improvement. PagMOM1 The nucleotide sequence of the gene is shown in SEQ ID No. 1. Populus alba×Populus glandular A gene in Populus argentatus (84K) PagMOM1 , knocked out using CRISPR / Cas9 gene editing technology PagMOM1 Genes can promote the thickening of secondary cell walls, inhibit cell expansion, and change the characteristics of wood cells, thereby obtaining improved forest varieties with thickened secondary cell walls and smaller cells. mom1 mutant.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and specifically to a PagMOM1 Genes and their applications in wood improvement. Background Art

[0002] Wood formation originates from the secondary growth process of plants, a process primarily driven by the continuous development of secondary xylem. Secondary xylem originates from the vascular cambium and is composed of fiber cells and vascular cells with significantly thickened cell walls. In woody plants, after the secondary xylem cells stop expanding, they deposit a thickened secondary wall (SCW) inside the primary cell wall. This secondary wall, primarily composed of cellulose, hemicellulose, and lignin, not only provides mechanical support for the plant but also serves as a water and nutrient transport mechanism within the vascular cells. The formation of the secondary wall involves a complex series of enzymes involved in biosynthetic pathways, and its development directly influences the structure and properties of wood. Therefore, studying the molecular mechanisms of secondary growth is crucial for understanding plant development, improving wood quality, and developing novel biomaterials.

[0003] MOM1 protein is an important non-classical epigenetic regulatory factor that plays a key role in plant genome stability, gene expression regulation, transposon silencing and environmental adaptability. Unlike classical epigenetic regulatory factors (such as DNA methylases or histone modifying enzymes), the function of MOM1 protein does not completely depend on DNA methylation, but regulates gene expression by affecting chromatin structure and dynamic changes. The study of MOM1 in plants originated from the screening of epigenetic mutants in Arabidopsis. In mom1 mutants, transposons and some silent repetitive sequence genes are abnormally activated, while the DNA methylation status does not change significantly. This phenomenon indicates that MOM1 may participate in epigenetic regulation through a mechanism independent of DNA methylation. In the study of Arabidopsis, it was found that the MOM1 complex participates in the RdDM pathway by interacting with the MORC6 protein, and plays an important role in DNA methylation and gene silencing. However, the current research on MOM1 in woody plants is still underway. MOM1 There is little research on this gene, and its functional mechanism in the formation and development of xylem still needs further exploration. Summary of the Invention

[0004] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a PagMOM1 Genes and their use in improving wood. Populus alba×Populus glandulosa A gene in Populus argentatus (84K) PagMOM1 , and determined its function in the wood formation process through CRISPR / Cas9 gene editing technology.

[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0006] On the one hand, there is provided a PagMOM1 The gene, whose nucleotide sequence is shown in SEQ ID No.1.

[0007] On the other hand, providing PagMOM1 Genetic applications in wood modification, missing PagMOM1 The gene can promote the thickening of secondary cell walls, inhibit cell expansion, and change the characteristics of wood cells, thereby obtaining improved forest varieties with thickened secondary cell walls and smaller cells. mom1 mutant.

[0008] Furthermore, PagMOM1 The method for genetically modifying wood specifically comprises the following steps:

[0009] Step 1. Clone PagMOM1 genes and designed target primers;

[0010] Step 2: Construct a gRNA expression cassette and connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector to construct PagMOM1 gene knockout vectors;

[0011] Step 3: Construct PagMOM1 The gene knockout vector was transferred into Agrobacterium GV3101, and the leaves of silver gland poplar tissue culture seedlings were infected, proliferated, differentiated, and rooted by Agrobacterium-mediated method to obtain forest tree varieties. mom1 mutant.

[0012] Furthermore, in step 1, the target primers are MOM1-AtU3dT1F, MOM1-AtU3dT1R, MOM1-AtU3bT2F, and MOM1-AtU3bT2R, and their nucleotide sequences are as follows:

[0013] MOM1-AtU3dT1F GTCATAGTCGCAAAGCTAAGGCTG;

[0014] MOM1-AtU3dT1R AAACCAGCCTAGCTTTGCGACTA;

[0015] MOM1-AtU3bT2F GTCATGCACTCCATCTGATAAGTC;

[0016] MOM1-AtU3bT2RAAACGACTTATCAGATGGAGTGCA.

[0017] The beneficial effects of the present invention are:

[0018] This study identified a gene in Populus alba × Populus glandulosa (Silver Gland Poplar, 84K) PagMOM1 , knocked out using CRISPR / Cas9 gene editing technology PagMOM1 Genes can promote the thickening of secondary cell walls, inhibit cell expansion, and change the characteristics of wood cells, thereby obtaining improved forest varieties with thickened secondary cell walls and smaller cells. mom1 mutant. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 for PagMOM1 gene knockout strains mom1-6 、 mom1-9 、 mom1-10 Sequencing identification diagram;

[0020] Figure 2 Wild-type Populus argentatus and mom1 Phenotype of mutant silver gland poplar plant;

[0021] Figure 3 Wild-type Populus argentatus and mom1 Schematic diagram comparing the plant height and stem diameter at the base of the mutant silver gland poplar;

[0022] Figure 4 Wild-type Populus argentatus and mom1 Optical image of a section of a mutant silver gland poplar;

[0023] Figure 5 Wild-type Populus argentatus and mom1 Schematic diagram of the xylem width comparison of mutant Populus argentatus;

[0024] Figure 6 Wild-type Populus argentatus and mom1 Scanning electron micrograph of mutant silver gland poplar;

[0025] Figure 7 Wild-type Populus argentatus and mom1 Schematic diagram comparing the sizes of ducts and fiber cells in mutant silver gland poplar;

[0026] Figure 8 Wild-type Populus argentatus and mom1 Schematic diagram comparing the wall thickness of ducts and fiber cells in mutant silver gland poplar. DETAILED DESCRIPTION

[0027] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.

[0028] Example 1

[0029] PagMOM1 Construction of gene knockout vector:

[0030] (1) Target primer design:

[0031] Using the genome sequence of Populus albicans as a template, primers MOM1-F and MOM1-R were designed to clone the first 1700 bp of the gene. PagMOM1 Gene. PagMOM1 The nucleotide sequence of the gene is shown in SEQ ID No. 1. Taking into account the GC content, target primers MOM1-AtU3dT1F, MOM1-AtU3dT1R, MOM1-AtU3bT2F, and MOM1-AtU3bT2R were designed in the first coding region of the non-SNP single nucleotide polymorphism site. Their nucleotide sequences are shown below:

[0032] MOM1-F: TACAGTATGGGAAATGATGCTAAAG;

[0033] MOM1-R:CAGTAGACCCCAACAGGTAAAGAG;

[0034] MOM1-AtU3dT1F:GTCATAGTCGCAAAGCTAAGGCTG;

[0035] MOM1-AtU3dT1R: AAACCCAGCCTTAGCTTTGCGACTA;

[0036] MOM1-AtU3bT2F:GTCATGCACTCCATCTGATAAGTC;

[0037] MOM1-AtU3bT2R:AAACGACTTATCAGATGGAGTGCA.

[0038] (2) Target linker preparation:

[0039] The target primer was diluted to 10 μM with double-distilled water, and 10 μl of the forward and reverse adapters were taken. After mixing, the mixture was denatured at 94°C for 30 seconds and then cooled to room temperature by gradient cooling to form a double-stranded structure.

[0040] (3) Connecting the target primer to the gRNA expression cassette (cutting and connecting method):

[0041]

[0042] Reaction conditions: 37°C for 5 min, 20°C for 5 min, 8 cycles.

[0043] (3) 2-round nested PCR amplification:

[0044] The first round of PCR uses a universal UF / gRNA-R reaction, and the second round of PCR uses specific primers for amplification. This protocol provides good and stable amplification results.

[0045] The universal primers for the first round of amplification are:

[0046] UF: CTCCGTTTTACCTGTGGAATCG;

[0047] gRNA-R: CGGAGGAAAATTCCATCCAC.

[0048] The specific primers for the second round of amplification are:

[0049] B1':TTCAGAGGTCTCTCTCGACTAGTGGAATCGGCAGCAAAGG;

[0050] B2: AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC;

[0051] B2':TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG;

[0052] BL: AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC.

[0053] First round PCR amplification system:

[0054]

[0055] Reaction conditions: 95°C for 1 min; 98°C for 15 s, 55°C for 15 s, 68°C for 10 s, 10 cycles; 98°C for 10 s, 65°C for 15 s, 68°C for 10 s, 20 cycles.

[0056] Take 5 μl of PCR product and perform 1% agarose gel electrophoresis detection; and take 1 μl of PCR product, dilute it 10 times with ddH2O, and then take 1 μl from it as the template for the second round of PCR reaction.

[0057] Second round PCR amplification system:

[0058]

[0059] Reaction conditions: 98°C for 10 s, 60°C for 15 s, 68°C for 30 s, 25 cycles.

[0060] 5 μl of PCR product was taken and detected by 1% agarose gel electrophoresis, and the remaining product was purified and recovered.

[0061] (5) gRNA expression cassette is connected to the pYLCRISPR / Cas9 vector:

[0062]

[0063] Reaction conditions: 37°C, 10 min; 37°C 5 min, 10°C 5 min, 20°C 5 min, 15 cycles.

[0064] The ligation product was used to transform E. coli, spread on solid LB medium with kanamycin resistance, and waited for single clones to grow overnight for identification.

[0065] (6) Identification of vectors:

[0066] Plasmids were extracted from the colonies and sequenced using SP-DL primers to verify the correctness of the constructed vector.

[0067] SP-DL:GTCGTGTCCACATGTTGACCG.

[0068] Example 2

[0069] Genetic transformation of Populus argentatus:

[0070] The constructed vector plasmid was transformed into Agrobacterium GV3101 by heat shock method, and the silver gland poplar was genetically transformed by Agrobacterium-mediated method. Agrobacterium cells were picked and placed in 5 mL LB (50 mg / L rifampicin + 50 mg / L kanamycin) liquid medium, cultured in a shaking incubator at 28°C overnight until the OD600 value reached 0.8, and 1 mL was aspirated and added to 100 mL LB (50 mg / L rifampicin + 50 mg / L kanamycin) liquid medium for subculture until OD600 = 0.4-0.5. The leaves used for infection were selected from well-grown tissue culture seedlings of Populus argentatus (approximately 4 weeks old). The leaves were transversely cut at the veins with a scalpel and infected with Agrobacterium for 12 minutes. The leaves were then transferred to co-cultivation medium and incubated in the dark for 2-3 days. The leaves were then transferred to selective medium (3 mg / L hygromycin) and incubated in the dark until callus formed. Once the callus reached approximately 0.5 cm, the callus was transferred to differentiation medium (3 mg / L hygromycin). When the buds reached a height of 1 cm, the buds were transferred to rooting medium to induce rooting. The leaves were then subcultured in the rooting medium.

[0071] Example 3

[0072] PagMOM1 Identification of gene knockout lines:

[0073] Extract wild-type and transgenic genomic DNA, use as template, and amplify with gene sequencing primers MOM1-F and MOM1-R. Connect the amplified product to T vector and transform into E. coli. Pick single clones and send them to the company for sequencing. The sequencing results are as follows: Figure 1 As shown, three different types of mutants were identified and named mom1-6 、 mom1-9 as well as mom1-10 , three mutants PagMOM1 The gene has base insertions or deletions on both chromosomes, and the location is close to the transcription start site.

[0074] Example 4

[0075] PagMOM1 Phenotypic observation of gene knockout strains:

[0076] Will PagMOM1 The knockout plants and wild-type plants were planted in a climate chamber at the same time. Three batches were planted. After about 45 days of growth, the plants in different batches were observed for phenotype, photographed, sliced ​​and observed by microscopy and scanning electron microscopy, and statistics were collected. Figure 2 Shown are wild-type Populus argentatus (WT) and mom1 Phenotype of mutant silver gland poplar plant, compared with the wild type, PagMOM1 The height of gene knockout plants decreased ( Figure 3To observe the changes in its secondary growth, the stem segments at the base of the plant were vibrated and sliced ​​to a thickness of 50 μm. After cutting, they were immediately stained with TBO (toluidine blue). After washing away the floating color, ordinary optical photography was performed for observation. Figure 4 As shown, compared with WT, PagMOM1 The secondary growth of the gene knockout strains was significantly slowed down, and the xylem width was narrowed ( Figure 5 Compared with WT, its ducts and fibroblasts were significantly smaller, and the statistical results are as follows. Figure 7 As shown. Scanning electron microscopy of the 14th internode revealed that ( Figure 6 ), PagMOM1 The thickness of vessel and fiber cell walls in gene knockout plants was significantly thicker ( Figure 8 The above results show that PagMOM1 The gene plays a certain regulatory role in xylem development, and its loss can promote secondary wall thickening and inhibit cell expansion.

[0077] In summary, the present invention identified a gene in Populus alba × Populus glandulosa (Silver Gland Poplar, 84K) PagMOM1 , knocked out using CRISPR / Cas9 gene editing technology PagMOM1 Genes can promote the thickening of secondary cell walls, inhibit cell expansion, and change the characteristics of wood cells, thereby obtaining improved forest varieties with thickened secondary cell walls and smaller cells. mom1 mutant.

[0078] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be embodied in other specific forms without departing from the spirit or essential characteristics of the present invention. Therefore, the embodiments should be considered in all respects as illustrative and non-restrictive, and the scope of the present invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations that come within the meaning and range of equivalents of the claims be embraced therein.

[0079] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. Knockout PagMOM1 The application of genes in improving wood is characterized by: The wood is Populus argentatus, which is missing PagMOM1 The gene promotes the thickening of secondary cell walls and inhibits cell expansion, changing the characteristics of wood cells, thereby obtaining forest tree mutants with thickened secondary cell walls and smaller cells; PagMOM1 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that PagMOM1 The method for genetically improving silver gland poplar specifically comprises the following steps: Step 1. Clone PagMOM1 genes and designed target primers; Step 2: Construct a gRNA expression cassette and connect the gRNA expression cassette to the pYLCRISPR / Cas9 vector to construct PagMOM1 gene knockout vectors; Step 3: Construct PagMOM1 The gene knockout vector was transferred into Agrobacterium GV3101, and the leaves of silver gland poplar tissue culture seedlings were infected, proliferated, differentiated and rooted by Agrobacterium-mediated method to obtain silver gland poplar improved varieties. pagmom1 mutant.

3. The use according to claim 2, characterized in that In step 1, the target primers are MOM1-AtU3dT1F, MOM1-AtU3dT1R, MOM1-AtU3bT2F, and MOM1-AtU3bT2R, and their nucleotide sequences are as follows: MOM1-AtU3dT1F GTCATAGTCGCAAAGCTAAGGCTG; MOM1-AtU3dT1R AAACCAGCCTAGCTTTGCGACTA; MOM1-AtU3bT2F GTCATGCACTCCATCTGATAAGTC; MOM1-AtU3bT2RAAACGACTTATCAGATGGAGTGCA.

Images