Plasma miR-9 and miR-106a as diagnostic markers for peritoneal carcinomatosis in gastric cancer patients and related products

By screening and verifying the expression of miR-9 and miR-106a in plasma, an efficient diagnostic product for peritoneal carcinomatosis in gastric cancer patients was developed, which solved the problems of insufficient sensitivity and specificity of existing diagnostic methods and achieved high accuracy and early diagnosis.

CN120118996BActive Publication Date: 2025-09-053201 HOSPITAL
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510263691.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-06
Publication Date
2025-09-05
Estimated Expiration
2045-03-06

AI Technical Summary

Technical Problem

Existing diagnostic methods for peritoneal carcinomatosis in gastric cancer patients lack sensitivity and specificity, making it difficult to detect small and local lesions early, leading to incomplete surgical resection and early recurrence.

Method used

qPCR detection technology was used to screen out differentially expressed miR-9 and miR-106a, and these miRNAs were detected in plasma samples using specific primers and probes. High-throughput sequencing and probe hybridization methods were combined to develop diagnostic products.

Benefits of technology

It achieves high accuracy, sensitivity and specificity in the diagnosis of peritoneal carcinomatosis in gastric cancer patients, provides important significance for early diagnosis and improves diagnostic efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118996B_ABST
    Figure CN120118996B_ABST
Patent Text Reader

Abstract

The present invention discloses plasma miR-9 and miR-106a as diagnostic markers for peritoneal carcinomatosis in gastric cancer patients and related products thereof. The miR-9 and miR-106a have good diagnostic efficacy for the diagnosis of peritoneal carcinomatosis in gastric cancer patients, with high accuracy, sensitivity and specificity, and can be used for the effective diagnosis of peritoneal carcinomatosis in gastric cancer patients. The present invention provides a new idea and strategy for the research and development of diagnostic products related to peritoneal carcinomatosis in gastric cancer patients, and has broad application prospects and important translational significance in the technical field of peritoneal carcinomatosis diagnosis in gastric cancer patients.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular, relates to plasma miR-9 and miR-106a as diagnostic markers for peritoneal carcinomatosis in gastric cancer patients and related products. Background Art

[0002] Despite a recent decline in the incidence of gastric cancer (GC), it remains a common malignancy worldwide, affecting millions of people and carrying a high mortality rate. While surgical resection is the preferred treatment for GC, many patients with advanced GC have already developed peritoneal metastasis (PC) at the time of diagnosis, often leading to incomplete surgical resection and early recurrence. The median survival for these patients is only 5.2-12.6 months. Early diagnosis of peritoneal metastasis (i.e., peritoneal carcinomatosis in GC patients) and the initiation of necessary treatment measures can prevent many GC patients from developing serious complications such as malignant ascites, intestinal obstruction, and cachexia. Therefore, early diagnosis of PC in GC patients is crucial for effective treatment.

[0003] Currently, the diagnosis of peritoneal carcinomatosis in gastric cancer patients relies primarily on computed tomography (CT) and detection of tumor-associated antigens (such as CEA and CA125). However, these methods have limited sensitivity and specificity for peritoneal carcinomatosis in gastric cancer patients, particularly for the diagnosis of small and localized lesions. Furthermore, 18F-FDG-based positron emission tomography (PET) has been used to diagnose peritoneal carcinomatosis in gastric cancer patients, but its clinical value remains controversial. Therefore, there is an urgent need to identify new biomarkers that can achieve sensitive and specific diagnosis of peritoneal carcinomatosis in gastric cancer patients. miRNAs are a class of noncoding RNAs, only 18-25 nucleotides in length, that regulate gene expression at the posttranscriptional level by binding to the 3' untranslated regions (3'-UTRs) of target genes. Differentially expressed miRNAs are associated with the development of various tumors.

[0004] To date, there have been no studies or reports on the use of plasma miR-9 and miR-106a as diagnostic markers for peritoneal carcinogenesis in gastric cancer patients. Summary of the Invention

[0005] In view of this, in order to make up for the deficiencies in the existing technology, the purpose of the present invention is to provide plasma miR-9 and miR-106a as diagnostic markers for peritoneal carcinomatosis in gastric cancer patients and related products, in order to provide biomarkers with high sensitivity and specificity for the diagnosis of peritoneal carcinomatosis in gastric cancer patients.

[0006] The present invention uses qPCR detection technology to screen out miRNAs (miR-9, miR-106a) that are significantly differentially expressed in peritoneal carcinomatosis in gastric cancer patients, and further verifies them in real clinical plasma samples collected by the present invention. The verification results show that the miRNAs have high accuracy, sensitivity and specificity in the diagnosis of peritoneal carcinomatosis in gastric cancer patients, and can be used for auxiliary diagnosis of peritoneal carcinomatosis in gastric cancer patients in clinical practice, which is of great significance for the early diagnosis of peritoneal carcinomatosis in gastric cancer patients.

[0007] The present invention adopts the following technical solutions to achieve the above-mentioned invention objectives:

[0008] A first aspect of the present invention provides the use of a reagent for detecting the expression level of the biomarkers miR-9 and / or miR-106a in a sample in the preparation of a product for diagnosing peritoneal carcinomatosis in gastric cancer patients.

[0009] Furthermore, the reagents include primers for specifically amplifying miR-9 and / or miR-106a, and / or probes for specifically recognizing miR-9 and / or miR-106a.

[0010] Furthermore, the sequence of the primer for specifically amplifying miR-9 is shown as SEQ ID NO.1-2.

[0011] Furthermore, the sequences of the primers for specifically amplifying miR-106a are shown in SEQ ID NO. 3-4.

[0012] Furthermore, the diagnosis of peritoneal canceration in gastric cancer patients includes diagnosing and distinguishing gastric cancer patients with peritoneal canceration and gastric cancer patients without peritoneal canceration, or diagnosing and distinguishing gastric cancer patients with peritoneal canceration and healthy subjects.

[0013] Furthermore, the sample is a plasma sample, tissue sample, blood sample, serum sample, cell sample, urine sample and / or exosome sample derived from a subject.

[0014] In this context, miRNA refers to microRNAs, or small non-coding RNA molecules. They are a class of endogenous RNA molecules, approximately 20-24 nucleotides in length, that play a variety of important regulatory roles within cells. They primarily regulate gene expression at the post-transcriptional level (regulating approximately one-third of protein-coding genes), thereby controlling cell apoptosis, proliferation, differentiation, metabolism, individual development, and tumorigenesis, progression, and drug resistance. MiRNAs exist in various forms. The most primitive form is pri-miRNA, which is approximately 300-1000 bases in length. After a primary processing step, pri-miRNA becomes pre-miRNA, a microRNA precursor, approximately 70-90 bases in length. Pre-miRNA is then cleaved by the Dicer enzyme to become mature miRNA, approximately 20-24 nucleotides in length.

[0015] In a specific embodiment of the present invention, the sequence information corresponding to the miRNA biomarkers miR-9 and miR-106a disclosed herein can be searched in the miRBase database (http: / / microrna.sanger.ac.uk / ). The sequence of miR-9 is UCUUUGGUUAUCUAGCUGUAUGA (SEQ ID NO. 5), and the sequence of miR-106a is AAAAGUGCUUACAGUGCAGGUAG (SEQ ID NO. 6).

[0016] In some embodiments, the product detects the expression level of miR-9 and / or miR-106a in a test sample derived from a subject based on a quantitative PCR method, a probe hybridization method, and / or a high-throughput sequencing method.

[0017] In some embodiments, the reagent for detecting the expression level of miR-9 and / or miR-106a in a test sample derived from a subject based on a quantitative PCR method comprises primers that specifically amplify miR-9 and / or miR-106a.

[0018] In some embodiments, the reagent for detecting the expression level of miR-9 and / or miR-106a in a test sample derived from a subject based on a probe hybridization method comprises a probe that specifically recognizes miR-9 and / or miR-106a.

[0019] The quantitative PCR method, also known as real-time fluorescence quantitative PCR (RT-PCR), uses a fluorescence detection PCR instrument to plot a dynamic curve of the cumulative rate of amplified sequences throughout the PCR process. The higher the initial concentration of the target sequence in the reaction mixture, the fewer PCR cycles (generally expressed as a threshold cycle number, Ct) are required to achieve a specific yield of amplified product. Because miRNAs are only 22 nt in length, traditional qRT-PCR is not suitable for amplifying such short fragments. Several real-time quantitative PCR methods are currently available for miRNA detection, such as the tailing method and the neck-loop method. The neck-loop method is an ideal qRT-PCR method for miRNA detection. First, a specific stem-loop primer is designed. The target miRNA is used as a template for reverse transcription to synthesize the first-strand cDNA. This cDNA is terminated by a stem-loop primer at one end. This stem-loop structure is opened, increasing the length of the cDNA. Subsequently, primers designed using the synthesized cDNA as a template are used for real-time quantitative PCR. qRT-PCR offers numerous advantages, including high specificity, excellent sensitivity, and rapidity and simplicity.

[0020] The basic principle of the probe hybridization method is to hybridize a labeled probe with a miRNA sample, and then perform signal detection to determine the expression level of the miRNA. The probe hybridization method includes northern hybridization, miRNA expression microarray, ribozyme protection analysis technology, RAKE method, in situ hybridization, microsphere-based flow cytometry, and other technologies.

[0021] The high-throughput sequencing method is also known as next-generation sequencing. High-throughput sequencing can sequence hundreds of thousands to millions of DNA molecules at a time, significantly improving sequencing efficiency. This large-scale sequencing technology significantly accelerates the interpretation of genetic information from multiple species, ensuring the acquisition of sequence information for all miRNAs and the deciphering of miRNA profiles. High-throughput sequencing also enables detailed, comprehensive analysis of a species' transcriptome and genome, hence the term "deep sequencing." Representative high-throughput sequencing platforms include the Roche GSFLX sequencer, the Illumina Solexa Genome Analyzer, and the ABI SOLiD sequencer.

[0022] In some embodiments, based on the sequences of the miRNAs (miR-9 and / or miR-106a) described herein, suitable probes for Northern blot hybridization of a given miRNA can be generated, including but not limited to probes that are at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or completely complementary to the target miRNA.

[0023] In some embodiments, the products include but are not limited to: kits, chips, test strips, etc.

[0024] In some embodiments, the chip includes a solid phase support and oligonucleotide probes fixed on the solid phase support, wherein the oligonucleotide probes include one or more oligonucleotide probes targeting miR-9 and / or miR-106a for detecting the transcription level of miR-9 and / or miR-106a.

[0025] In the present invention, the chip can be prepared using conventional methods known in the art for preparing biochips. For example, if the solid phase carrier is a modified glass slide or silicon wafer, and the 5' end of the probe contains an amino-modified poly-dT string, the oligonucleotide probe can be prepared into a solution, then spotted onto the modified glass slide or silicon wafer using a spotter, arranged into a predetermined sequence or array, and fixed overnight to obtain the miRNA chip of the present invention. If the nucleic acid does not contain an amino modification, the preparation method can also be referred to: "Gene Diagnosis Technology - Non-Radioactive Operation Manual" edited by Wang Shenwu; J. Lerisi, V. R. Iyer, P. O. Brown. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science, 1997; 278: 680; and Ma Liren and Jiang Zhonghua. Biochips. Beijing: Chemical Industry Press, 2000, 1-130.

[0026] In some embodiments, the solid phase carrier can be made of various commonly used materials in the field of gene chips, including but not limited to: nylon membrane, glass slide or silicon wafer modified with active groups (such as aldehyde, amino, etc.), unmodified glass slide, plastic sheet, etc.

[0027] In some embodiments, the sample includes a sample collected and sampled from cells, tissues or body fluids of any subject. Specifically, the sample includes but is not limited to: the source of the tissue or cell sample can be solid tissue from fresh, frozen and / or preserved organs or tissue samples, or biopsies or aspirates, blood or any blood components; body fluids such as cerebrospinal fluid, amniotic fluid, peritoneal fluid or interstitial fluid. The tissue sample can be a primary or in vitro cultured cell or cell line. Optionally, the tissue or cell sample is obtained from a diseased tissue / organ. The tissue sample may contain compounds naturally mixed with the tissue, such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or similar compounds. In a specific embodiment of the present invention, the sample to be tested is a plasma sample from a subject.

[0028] In the present invention, verification in real clinical samples collected by the present invention revealed that the biomarkers miR-9 and / or miR-106a have good diagnostic efficacy for the diagnosis of peritoneal carcinomatosis in gastric cancer patients, wherein the diagnostic efficacy is verified by a receiver operating characteristic curve (ROC). The area under the curve (AUC) refers to the area under the ROC curve well known to those skilled in the art. The determination of the area under the curve (AUC) helps to compare the accuracy of the classifier across the entire data range.

[0029] A classifier with a larger area under the curve (AUC) has a greater ability to accurately classify unknowns between two groups of interest (e.g., cancer samples and normal or control samples). A receiver operating characteristic (ROC) curve is useful for graphically representing the performance of a particular feature (e.g., a biomarker described herein and / or any item of additional biomedical information) in distinguishing between two populations. Typically, data for the feature across an entire population (e.g., a patient group and a control group) are sorted in ascending order based on the value of a single feature. Then, for each value of the feature, the true positive rate and false positive rate are calculated for the data. The true positive rate is determined by calculating the number of cases with a score exceeding the value for the feature and dividing it by the total number of cases. The false positive rate is determined by calculating the number of controls with a score exceeding the value for the feature and dividing it by the total number of controls. While this definition refers to situations where the feature is high in the patient group relative to the control group, it also applies to situations where the feature is low in the patient group relative to the control group (in which case, the number of samples with a score below the feature can be calculated).

[0030] A receiver operating characteristic (ROC) curve can be generated for other single calculations or for a single characteristic. For example, two or more characteristics can be mathematically combined (e.g., by addition, subtraction, multiplication, etc.) to provide a single sum value, which can be represented by a receiver operating characteristic (ROC) curve. Additionally, a receiver operating characteristic (ROC) curve can be used to plot combinations of multiple characteristics that can yield a single calculation value. These combinations of characteristics can constitute a test. The receiver operating characteristic (ROC) curve is a graph that plots the true positive rate (sensitivity) of a test relative to the false positive rate (1-specificity) of the test.

[0031] A second aspect of the present invention provides a product for diagnosing peritoneal carcinomatosis in patients with gastric cancer.

[0032] Furthermore, the product comprises a reagent for detecting the expression level of the biomarkers miR-9 and / or miR-106a in a sample.

[0033] Further, the reagents include primers that specifically amplify miR-9 and / or miR-106a, and / or probes that specifically recognize miR-9 and / or miR-106a;

[0034] Optionally, the sequence of the primer for specifically amplifying miR-9 is shown as SEQ ID NO.1-2.

[0035] Optionally, the primers for specifically amplifying miR-106a are shown in SEQ ID NO.3-4;

[0036] Optionally, the product includes a detection kit, a detection chip and / or a detection test strip;

[0037] Optionally, the detection kit comprises primers, probes or chips that specifically bind to the biomarkers miR-9 and / or miR-106a;

[0038] Optionally, the detection chip includes a solid phase carrier and a probe attached to the solid phase carrier that specifically recognizes the biomarker miR-9 and / or miR-106a.

[0039] In some embodiments, the primer refers to a 7-50 nucleic acid sequence that can form base pairs complementary to the template strand and serve as a starting point for replication of the template strand. Primers are typically synthesized, but naturally occurring nucleic acids can also be used. The sequence of the primer does not necessarily need to be exactly the same as the sequence of the template, as long as it is sufficiently complementary to hybridize with the template.

[0040] In some embodiments, the detection kit further comprises a container, instructions for use, a positive control, a negative control, a buffer, an adjuvant, or a solvent, such as a solution for suspending or fixing cells, a detectable label or marker, a solution for facilitating nucleic acid hybridization, a solution for lysing cells, or a solution for nucleic acid purification.

[0041] In some embodiments, the detection kit may also be accompanied by instructions for use of the detection kit, which record how to use the kit for detection and how to use the test results to determine whether the subject is a gastric cancer patient with peritoneal carcinomatosis or the risk of gastric cancer patients with peritoneal carcinomatosis.

[0042] In some embodiments, the detection kit is an RT-PCR kit, which may further include components necessary for reverse transcription polymerase chain reaction. The RT-PCR kit includes a pair of primers specific for the biomarkers miR-9 and / or miR-106a. The RT-PCR kit may also include test tubes or suitable containers, reaction buffer (with varying pH values ​​and magnesium concentrations), enzymes (e.g., Taq polymerase and reverse transcriptase), DEPC-containing water, and sterile water.

[0043] In some embodiments, the detection chip comprises a solid support; and oligonucleotide probes sequentially immobilized on the solid support, wherein the oligonucleotide probes specifically correspond to a portion or all of the sequence of the biomarker miR-9 and / or miR-106a. The solid support can be made of various commonly used materials in the chip field, including but not limited to plastics, microparticles, and membrane supports.

[0044] A third aspect of the present invention provides the use of a reagent for detecting the expression level of the biomarkers miR-9 and / or miR-106a in a sample in the preparation of a system or device for diagnosing peritoneal carcinomatosis in gastric cancer patients.

[0045] In the present invention, the system or device is a method for distinguishing different components, elements, parts, parts or assemblies at different levels. However, if other words can achieve the same purpose, the words can be replaced by other expressions. It is well known to those skilled in the art that the present invention can be implemented as an apparatus, method or computer program product. Therefore, the content disclosed in the present invention can be specifically implemented in the following forms, that is, it can be complete hardware, it can be complete software (including firmware, resident software, microcode, etc.), or it can be a combination of hardware and software. In addition, in some specific embodiments, the present invention can also be implemented in the form of a computer program product in one or more computer-readable media, and the computer-readable medium contains computer-readable program code.

[0046] A fourth aspect of the present invention provides a system for diagnosing peritoneal carcinomatosis in gastric cancer patients.

[0047] Furthermore, the system includes a processor, an input module, and an output module;

[0048] Among them, the input module is used to input the expression level of miR-9 and / or miR-106a in the subject sample; the processor is used to perform logical operations on the input information using bioinformatics methods, and the processor contains a computer-readable medium storing instructions, and the instructions, when executed by the processor, execute an algorithm on the input miR-9 and / or miR-106a expression level; the output module is used to output the result of whether the subject is a gastric cancer patient with peritoneal cancer or the risk of gastric cancer patients with peritoneal cancer.

[0049] The present invention also provides a method for diagnosing peritoneal canceration in patients with gastric cancer, the method comprising the following steps:

[0050] (1) Collect samples from subjects;

[0051] (2) Detecting the expression levels of miR-9 and / or miR-106a in samples from subjects;

[0052] (3) Diagnose whether the subject has peritoneal carcinomatosis in a gastric cancer patient or is at risk of peritoneal carcinomatosis in a gastric cancer patient based on the expression levels of miR-9 and / or miR-106a detected.

[0053] The present invention also provides a biomarker for diagnosing peritoneal carcinomatosis in gastric cancer patients, wherein the biomarker is miR-9 and / or miR-106a.

[0054] The present invention also provides the use of a miR-9 promoter and / or a miR-106a inhibitor in the preparation of a drug for treating and / or preventing peritoneal carcinogenesis in gastric cancer patients.

[0055] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0056] The present invention is the first to use miR-9 and miR-106a in the diagnosis of peritoneal carcinomatosis in gastric cancer patients. After verification in real clinical samples collected by the present invention, it was found that the miR-9 and miR-106a have good diagnostic efficacy for the diagnosis of peritoneal carcinomatosis in gastric cancer patients, with high accuracy, sensitivity and specificity, and can be used for the effective diagnosis of peritoneal carcinomatosis in gastric cancer patients. The present invention provides a new idea and strategy for the research and development of diagnostic products related to peritoneal carcinomatosis in gastric cancer patients, and has broad application prospects and important translational significance in the technical field of diagnosis of peritoneal carcinomatosis in gastric cancer patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 : In the screening set, miR-9 was significantly differentially expressed between GC patients with PC, GC patients without PC, and healthy controls;

[0058] Figure 2 : In the validation set, miR-9 was significantly differentially expressed between GC patients with PC, GC patients without PC, and healthy controls;

[0059] Figure 3 : Diagnostic efficacy of miR-9 in differentiating GC patients with PC (PC) from GC patients without PC (NPC) in the screening set;

[0060] Figure 4 : Diagnostic efficacy of miR-9 in differentiating GC patients with PC (PC) from healthy controls (HC) in the screening set;

[0061] Figure 5 : Diagnostic efficacy of miR-9 in differentiating GC patients with PC (PC) from GC patients without PC (NPC) in the validation set;

[0062] Figure 6 : Diagnostic efficacy of miR-9 in differentiating GC patients with PC (PC) from healthy controls (HC) in the validation set;

[0063] Figure 7 : In the screening set, miR-106a was significantly differentially expressed between GC patients with PC, GC patients without PC, and healthy controls;

[0064] Figure 8 : In the validation set, miR-106a was significantly differentially expressed between GC patients with PC, GC patients without PC, and healthy controls;

[0065] Figure 9 : Diagnostic efficacy of miR-106a in differentiating GC patients with PC (PC) from GC patients without PC (NPC) in the screening set;

[0066] Figure 10 : Diagnostic efficacy of miR-106a in differentiating GC patients with PC (PC) from healthy controls (HC) in the screening set;

[0067] Figure 11: Diagnostic efficacy of miR-106a in differentiating GC patients with PC (PC) from GC patients without PC (NPC) in the validation set;

[0068] Figure 12 : Diagnostic efficacy results of miR-106a in differentiating GC patients with PC (PC) from healthy controls (HC) in the validation set. DETAILED DESCRIPTION

[0069] The present invention will be further described below with reference to specific embodiments. The following specific embodiments are intended only to illustrate the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the claims and their equivalents.

[0070] The reagents, experimental consumables, and raw materials used in the present invention are readily available to those of ordinary skill in the art and, unless otherwise specified, can be obtained commercially. Experimental methods for which specific conditions are not specified in the present invention are generally performed under conventional conditions or as recommended by the manufacturer. In particular, the following examples are intended only to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and results described in the following examples are intended only to illustrate the present invention and should not, and will not, limit the present invention described in detail in the claims.

[0071] Example 1 Analysis of plasma miR-9 as a diagnostic marker for peritoneal carcinomatosis in gastric cancer patients and its diagnostic efficacy in real clinical samples collected by the present invention

[0072] 1. Research subjects and sample preparation

[0073] Between March 2013 and January 2014, we recruited 92 patients with gastric cancer (GC) from the inpatient Department of Medical Oncology at the 3201 Hospital. Of these, 42 were GC patients with peritoneal metastasis (PC) (i.e., peritoneal carcinomatosis in patients with GC), and 50 were GC patients without PC. In addition, 50 age- and sex-matched healthy controls (HCs) were recruited from the physical examination center of the same hospital during the same period. Exclusion criteria included a history of other organ malignancies, chronic inflammatory diseases, or recent infection. All participants provided written informed consent, and the experimental protocol was approved by the hospital's Clinical Research Ethics Committee.

[0074] Among them, GC patients with PC must meet any of the following diagnostic criteria:

[0075] (1) Pathological examination confirmed the presence of tumor cells in malignant ascites;

[0076] (2) extensive peritoneal metastasis observed during palliative surgery or laparotomy;

[0077] (3) CT scan showed extensive peritoneal infiltrative nodules, and pathological examination confirmed the patient to be stage IV GC.

[0078] Among them, GC patients without PC must meet all the following criteria:

[0079] (1) Confirmed by locally advanced stage and evidence of large tumor or lymph node metastasis;

[0080] (2) preoperative CT scan did not show peritoneal dissemination;

[0081] (3) No pathological evidence of PC during and after surgery.

[0082] Before treatment, venous blood (3-5 mL) was collected from each participant into EDTA-containing tubes. Plasma samples were prepared by centrifugation within 2 hours of blood collection. Briefly, the blood samples were centrifuged at 1900 g for 10 minutes and then at 13,000 g for 10 minutes to remove cellular debris and genomic DNA. Collected plasma samples were aliquoted and stored at -80°C until further use.

[0083] The plasma samples from the above subjects were randomly divided into a screening set and a validation set. In the screening set, the plasma samples of GC patients with PC: the plasma samples of GC patients without PC: the plasma samples of healthy controls = 13 cases: 13 cases: 13 cases; in the validation set, the plasma samples of GC patients with PC: the plasma samples of GC patients without PC: the plasma samples of healthy controls = 29 cases: 37 cases: 37 cases.

[0084] 2. RNA Extraction and qRT-PCR Analysis

[0085] Total RNA was extracted from the plasma samples using Trizol LS reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Briefly, 250 μL of plasma sample was mixed with 750 μL of Trizol LS. After washing by centrifugation, the RNA pellet was resuspended in 25 μL of nuclease-free water and stored at -80°C.

[0086] The relative expression level of miR-9 was quantitatively detected by qRT-PCR. The primers were provided by Takara (Japan). The steps were as follows: 3 μL of RNA sample was polyadenylated and reverse transcribed into cDNA (using the Takara One Step PrimeScript miRNA cDNA Synthesis Kit). Subsequently, PCR amplification was performed on a Biorad (IQ5) instrument using premixed SYBR green and specific primers using the diluted cDNA as a template. The operation was carried out according to the manufacturer's instructions. -ΔΔCt The relative expression level of miR-9 was calculated by the method.

[0087] Among them, the specific primer sequences for miR-9 are as follows:

[0088] Forward primer: 5′-TCTTTGGTTATCTAGCTGTATGA-3′ (SEQ ID NO. 1);

[0089] Reverse primer: 5′-CAACTCAGGTCGTAGGCAATTCGT-3′ (SEQ ID NO. 2).

[0090] 3. Validation of the diagnostic efficacy of miR-9 in the screening and validation sets

[0091] For the biomarker miR-9, which was screened in this example and showed significant differential expression between GC patients with PC, GC patients without PC, and healthy controls, the R package "pROC" (version 1.15.0) was used to draw a receiver operating characteristic (ROC) curve, and its accuracy, sensitivity, specificity, and AUC value for diagnosing and distinguishing GC patients with PC, GC patients without PC, and healthy controls were analyzed to determine its diagnostic efficacy in the above-mentioned screening set and validation set.

[0092] When assessing the diagnostic efficacy of the biomarker miR-9 in the screening and validation sets, the relative expression level of miR-9 was analyzed, and the level corresponding to the maximum Youden index was selected as the cutoff value. The resulting AUC value is the area under the ROC curve enclosed by the coordinate axes, ranging from 0.5 to 1. A larger AUC value indicates a higher accuracy in distinguishing GC patients with PC from those without PC and healthy controls. An AUC value close to 1.0 indicates a high degree of authenticity and excellent predictive efficacy in the diagnostic results obtained using the biomarker.

[0093] 4. Statistical analysis of data

[0094] Differences between groups were analyzed using the Mann-Whitney and Kruskal-Wallis tests. Clinicopathological characteristics were assessed using analysis of variance (ANOVA), Student's t-test, or chi-square test (as appropriate). The sensitivity and specificity of relative plasma miRNA levels in diagnosing GC patients with PC were calculated using the area under the receiver operating characteristic (ROC) curve (AUC). All statistical analyses were performed using SPSS 16.0 software (SPSS Ltd., United Kingdom), and a two-sided P value < 0.05 was considered statistically significant.

[0095] 5. Experimental results

[0096] (1) Differential expression analysis results

[0097] In the screening set, the results showed that miR-9 was significantly differentially expressed between GC patients with PC, GC patients without PC, and healthy controls ( Figure 1 ), the differences were statistically significant (P<0.001). Compared with healthy controls, miR-9 was significantly down-expressed in the plasma samples of GC patients with PC and GC patients without PC. Compared with GC patients without PC, miR-9 was significantly down-expressed in the plasma samples of GC patients with PC. This result preliminarily indicates that miR-9 can be used to diagnose and differentiate GC patients with PC, GC patients without PC and healthy controls.

[0098] In the validation set, the results showed that miR-9 was also significantly differentially expressed between GC patients with PC, GC patients without PC, and healthy controls ( Figure 2 ), the differences were statistically significant (P<0.001). Compared with healthy controls, miR-9 was significantly down-expressed in the plasma samples of GC patients with PC and GC patients without PC. Compared with GC patients without PC, miR-9 was significantly down-expressed in the plasma samples of GC patients with PC. This result preliminarily indicates that miR-9 can be used to diagnose and differentiate GC patients with PC, GC patients without PC and healthy controls.

[0099] (2) Diagnostic efficacy verification results

[0100] In the screening set, the diagnostic efficacy of miR-9 for differentiating GC patients with PC (PC) from GC patients without PC (NPC) is shown in Figure 3The results showed that miR-9 had high accuracy, sensitivity and specificity in the diagnosis and differentiation of GC patients with PC and GC patients without PC. Among them, the AUC value was as high as 0.778, the sensitivity was 84.62%, and the specificity was 76.92%. This result proved that miR-9 can be used for the effective diagnosis and differentiation of GC with PC and GC without PC.

[0101] In the screening set, the diagnostic efficacy of miR-9 for differentiating GC patients with PC (PC) from healthy controls (HC) is shown in Figure 4 The results showed that miR-9 had high accuracy, sensitivity and specificity in the diagnosis and differentiation of GC patients with PC (PC) and healthy controls (HC), among which the AUC value was as high as 0.965, the sensitivity was 100%, and the specificity was 92.31%. This result proved that miR-9 can be used for the effective diagnosis of GC with PC.

[0102] In the validation set, the diagnostic efficacy of miR-9 in differentiating GC patients with PC (PC) from GC patients without PC (NPC) is shown in Figure 5 The results showed that miR-9 had high accuracy, sensitivity and specificity in the diagnosis and differentiation of GC patients with PC and GC patients without PC. The AUC value was as high as 0.780, the sensitivity was 100%, and the specificity was 63.33%. This result once again proved that miR-9 can be used for the effective diagnosis and differentiation of GC with PC and GC without PC.

[0103] In the validation set, the diagnostic efficacy of miR-9 in differentiating GC patients with PC (PC) from healthy controls (HC) was shown in Figure 6 The results showed that miR-9 had high accuracy, sensitivity and specificity in the diagnosis and differentiation of GC patients with PC (PC) and healthy controls (HC), among which the AUC value was as high as 0.815, the sensitivity was 89.66%, and the specificity was 71.43%. This result once again proved that miR-9 can be used for the effective diagnosis of GC with PC.

[0104] The above results indicate that miR-9 can be used for the effective diagnosis and differentiation of GC with PC and GC without PC, as well as for the effective diagnosis of GC with PC, and has high accuracy, sensitivity and specificity in both the screening set and the validation set composed of random real clinical samples.

[0105] Example 2 Analysis of plasma miR-106a as a diagnostic marker for peritoneal carcinomatosis in gastric cancer patients and its diagnostic efficacy in real clinical samples collected by the present invention

[0106] 1. Research subjects and sample preparation

[0107] Between March 2013 and January 2014, we recruited 86 patients with gastric cancer (GC) from the Department of Medical Oncology at the 3201 Hospital. Of these, 43 were GC patients with peritoneal metastasis (PC) (i.e., peritoneal carcinomatosis in patients with GC), and 43 were GC patients without PC. In addition, 35 age- and sex-matched healthy controls (HCs) were recruited from the physical examination center of the same hospital during the same period. Exclusion criteria included a history of other organ malignancies, chronic inflammatory diseases, or recent infection. All participants provided written informed consent, and the experimental protocol was approved by the hospital's Clinical Research Ethics Committee.

[0108] Among them, GC patients with PC must meet any of the following diagnostic criteria:

[0109] (1) Pathological examination confirmed the presence of tumor cells in malignant ascites;

[0110] (2) extensive peritoneal metastasis observed during palliative surgery or laparotomy;

[0111] (3) CT scan showed extensive peritoneal infiltrative nodules, and pathological examination confirmed the patient to be stage IV GC.

[0112] Among them, GC patients without PC must meet all the following criteria:

[0113] (1) Confirmed by locally advanced stage and evidence of large tumor or lymph node metastasis;

[0114] (2) preoperative CT scan did not show peritoneal dissemination;

[0115] (3) No pathological evidence of PC during and after surgery.

[0116] Before treatment, venous blood (3-5 mL) was collected from each participant into EDTA-containing tubes. Plasma samples were prepared by centrifugation within 2 hours of blood collection. Briefly, the blood samples were centrifuged at 1900 g for 10 minutes and then at 13,000 g for 10 minutes to remove cellular debris and genomic DNA. Collected plasma samples were aliquoted and stored at -80°C until further use.

[0117] The plasma samples from the above subjects were randomly divided into a screening set and a validation set. In the screening set, the plasma samples of GC patients with PC: the plasma samples of GC patients without PC: the plasma samples of healthy controls = 13 cases: 13 cases: 13 cases; in the validation set, the plasma samples of GC patients with PC: the plasma samples of GC patients without PC: the plasma samples of healthy controls = 30 cases: 30 cases: 22 cases.

[0118] 2. RNA Extraction and qRT-PCR Analysis

[0119] Total RNA was extracted from the plasma samples using Trizol LS reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Briefly, 250 μL of plasma sample was mixed with 750 μL of Trizol LS. After washing by centrifugation, the RNA pellet was resuspended in 25 μL of nuclease-free water and stored at -80°C.

[0120] The relative expression level of miR-106a was quantitatively detected by qRT-PCR. The primers were provided by Takara (Japan). The steps were as follows: 3 μL of RNA sample was polyadenylated and reverse transcribed into cDNA (using the Takara One Step PrimeScript miRNA cDNA Synthesis Kit). Subsequently, PCR amplification was performed on a Biorad (IQ5) instrument using the diluted cDNA as a template using premixed SYBR green and specific primers according to the manufacturer's instructions. -ΔΔCt The relative expression level of miR-106a was calculated by the method.

[0121] Among them, the specific primer sequences for miR-106a are as follows:

[0122] Forward primer: 5′-AAAAGTGCTTACAGTGCAGGTAG-3′ (SEQ ID NO. 3);

[0123] Reverse primer: 5′-CAACTCAGGTCGTAGGCAATTCGT-3′ (SEQ ID NO. 4).

[0124] 3. Validation of the diagnostic efficacy of miR-106a in the screening and validation sets

[0125] For the biomarker miR-106a, which was screened in this example and showed significant differential expression between GC patients with PC, GC patients without PC, and healthy controls, the R package "pROC" (version 1.15.0) was used to draw a receiver operating characteristic (ROC) curve to analyze its accuracy, sensitivity, specificity, and AUC value for diagnosing and distinguishing GC patients with PC, GC patients without PC, and healthy controls, so as to determine its diagnostic efficacy in the above-mentioned screening set and validation set.

[0126] When assessing the diagnostic efficacy of the biomarker miR-106a in the screening and validation sets, the relative expression level of miR-106a was analyzed, and the level corresponding to the maximum Youden index was selected as the cutoff value. The resulting AUC value is the area under the receiver operating characteristic (ROC) curve enclosed by the coordinate axes, ranging from 0.5 to 1. A higher AUC value indicates a higher accuracy in distinguishing GC patients with PC from those without PC and healthy controls. An AUC value close to 1.0 indicates a high degree of authenticity and excellent predictive efficacy in the diagnostic results obtained using the biomarker.

[0127] 4. Statistical analysis of data

[0128] Differences between groups were analyzed using the Mann-Whitney and Kruskal-Wallis tests. Clinicopathological characteristics were assessed using analysis of variance (ANOVA), Student's t-test, or chi-square test (as appropriate). The sensitivity and specificity of relative plasma miRNA levels in diagnosing GC patients with PC were calculated using the area under the receiver operating characteristic (ROC) curve (AUC). All statistical analyses were performed using SPSS 16.0 software (SPSS Ltd., United Kingdom), and a two-sided P value < 0.05 was considered statistically significant.

[0129] 5. Experimental results

[0130] (1) Differential expression analysis results

[0131] In the screening set, the results showed that miR-106a was significantly differentially expressed between GC patients with PC, GC patients without PC, and healthy controls ( Figure 7 ), the differences were statistically significant (P<0.001). Compared with healthy controls, miR-106a was significantly overexpressed in the plasma samples of GC patients with PC and GC patients without PC. Compared with GC patients without PC, miR-106a was significantly overexpressed in the plasma samples of GC patients with PC. This result preliminarily indicates that miR-106a can be used to diagnose and distinguish GC patients with PC, GC patients without PC and healthy controls.

[0132] In the validation set, the results showed that miR-106a was also significantly differentially expressed between GC patients with PC, GC patients without PC, and healthy controls ( Figure 8), the differences were statistically significant (P<0.001). Compared with healthy controls, miR-106a was significantly overexpressed in the plasma samples of GC patients with PC and GC patients without PC. Compared with GC patients without PC, miR-106a was significantly overexpressed in the plasma samples of GC patients with PC. This result preliminarily indicates that miR-106a can be used to diagnose and distinguish GC patients with PC, GC patients without PC and healthy controls.

[0133] (2) Diagnostic efficacy verification results

[0134] In the screening set, the diagnostic efficacy of miR-106a for differentiating GC patients with PC (PC) from GC patients without PC (NPC) is shown in Figure 9 The results showed that miR-106a had high accuracy, sensitivity and specificity in the diagnosis and differentiation of GC patients with PC and GC patients without PC. The AUC value was as high as 0.932, the sensitivity was 88%, and the specificity was 91.3%. This result proved that miR-106a can be used for the effective diagnosis and differentiation of GC with PC and GC without PC.

[0135] In the screening set, the diagnostic efficacy of miR-106a for differentiating GC patients with PC (PC) from healthy controls (HC) is shown in Figure 10 The results showed that miR-106a had high accuracy, sensitivity and specificity in the diagnosis and differentiation of GC patients with PC (PC) and healthy controls (HC), among which the AUC value was as high as 0.964, the sensitivity was 100%, and the specificity was 84.62%. This result proved that miR-106a can be used for the effective diagnosis of GC with PC.

[0136] In the validation set, the diagnostic efficacy of miR-106a in differentiating GC patients with PC (PC) from GC patients without PC (NPC) was shown in Figure 11 The results showed that miR-106a had high accuracy, sensitivity and specificity in the diagnosis and differentiation of GC patients with PC and GC patients without PC. The AUC value was as high as 0.817, with a sensitivity of 80% and a specificity of 75%. This result once again proved that miR-106a can be used for the effective diagnosis and differentiation of GC with PC and GC without PC.

[0137] In the validation set, the diagnostic efficacy of miR-106a in differentiating GC patients with PC (PC) from healthy controls (HC) was shown in Figure 12The results showed that miR-106a had high accuracy, sensitivity and specificity in the diagnosis and differentiation of GC patients with PC (PC) and healthy controls (HC), among which the AUC value was as high as 0.839, the sensitivity was 100%, and the specificity was 59.09%. This result once again proved that miR-106a can be used for the effective diagnosis of GC with PC.

[0138] The above results indicate that miR-106a can be used for the effective diagnosis and differentiation of GC with PC and GC without PC, as well as for the effective diagnosis of GC with PC, and has high accuracy, sensitivity and specificity in both the screening set and the validation set composed of random real clinical samples.

Claims

1. Use of a reagent for detecting the expression level of the biomarkers miR-9 and / or miR-106a in a sample in the preparation of a product for diagnosing peritoneal carcinomatosis in gastric cancer patients, wherein the sample is a plasma sample.

2. The use according to claim 1, characterized in that The reagents include primers for specifically amplifying miR-9 and / or miR-106a, and / or probes for specifically recognizing miR-9 and / or miR-106a.

3. The use according to claim 2, characterized in that The sequences of the primers for specifically amplifying miR-9 are shown in SEQ ID NO. 1-2.

4. The use according to claim 2, characterized in that The sequences of the primers for specifically amplifying miR-106a are shown in SEQ ID NO. 3-4.

5. The use according to claim 1, characterized in that The diagnosis of peritoneal carcinomatosis in gastric cancer patients includes diagnosing and distinguishing gastric cancer patients with peritoneal carcinomatosis and gastric cancer patients without peritoneal carcinomatosis, or diagnosing and distinguishing gastric cancer patients with peritoneal carcinomatosis and healthy people.

6. Use of a reagent for detecting the expression level of the biomarkers miR-9 and / or miR-106a in a sample in the preparation of a system or device for diagnosing peritoneal carcinomatosis in gastric cancer patients, wherein the sample is a plasma sample.

7. A system for diagnosing peritoneal carcinomatosis in gastric cancer patients, characterized in that: The system includes a processor, an input module, and an output module; Among them, the input module is used to input the expression level of miR-9 and / or miR-106a in the subject's sample; the processor is used to perform logical operations on the input information using bioinformatics methods, and the processor contains a computer-readable medium storing instructions, and the instructions, when executed by the processor, execute an algorithm on the input miR-9 and / or miR-106a expression level; the output module is used to output the result of whether the subject is a gastric cancer patient with peritoneal cancer or the risk of gastric cancer patients with peritoneal cancer, and the sample is a plasma sample.

Citation Information

Patent Citations

  • Compositions and methods for microrna expression profiling of lung cancer

    CN102892897A

  • miRNA IN THE DIAGNOSIS OF OVARIAN CANCER

    US20120309645A1

  • Biomarkers For Endometriosis

    US20170016067A1