Application of indole-3-lactic acid in preparation of medicine for treating liver aging related diseases

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of indole-3-lactic acid in preparation of medicines for treating liver aging related diseases. By regulating intestinal flora and a metabolite indole-3-lactic acid thereof, macrophage senescence can be effectively inhibited, and liver senescence and related diseases can be improved. Research results show that after the intestinal flora of young mice is transplanted, the expression level of inflammatory factors of liver tissues of old mice is reduced, the deposition of extracellular matrixes is reduced, and the expression of senescence-related genes is regulated and controlled. Besides, the supplement of the indole-3-lactic acid can significantly improve the liver function indexes of the old mice, reduce the expression level of inflammatory factors of liver tissues, reduce the deposition of extracellular matrixes, regulate the expression of senescence-related genes and improve the overall health state of the liver, so that the indole-3-lactic acid has important clinical application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of indole-3-lactic acid in the preparation of medicines for treating liver aging-related diseases. Background Art

[0002] Liver aging is considered an important risk factor for chronic liver disease, which is manifested by weakened liver regeneration, accelerated inflammation and fibrosis, and excessive accumulation of lipids. As the body's main immune and metabolic organ, the liver has an intricate network of intrahepatic immune cells and interactions. With age, the composition of the intestinal flora changes, and there is a certain correlation between the intestinal flora and the process of liver aging, which leads to an increased susceptibility of the liver to aging-related diseases (such as liver cancer, cirrhosis, and fatty liver disease), forming a vicious circle. my country is a country with a high incidence of liver disease, with approximately 400 million people suffering from chronic liver disease. With the aging of the population worldwide, the prevalence of aging-related liver diseases is also expected to continue to increase. Current studies have shown that indole and its derivatives, metabolites derived from the intestinal flora, have potential application value in anti-aging. Studies have shown that supplementing with microbial degradation products of tryptophan (such as indole) can extend the healthy lifespan of a variety of model organisms. In addition, with age, the level of indole derivatives in plasma is closely related to intestinal barrier function, and indole derivatives are believed to enhance intestinal barrier function during aging.

[0003] The intestinal flora and its metabolites play an important role in intestinal inflammation, immune regulation and intestinal barrier homeostasis. Current studies believe that the flora and its metabolites play an important role in the pathophysiological process of liver aging, and regulating the intestinal flora is one of the potential methods for treating liver aging. Although studies have revealed the relationship between intestinal flora and liver aging, the specific mechanism is still unclear. However, there are still many important "mediators" that regulate the body's response to disease that have not been explored and need further research. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings and deficiencies in the prior art and provide the use of indole-3-lactic acid in the preparation of drugs for treating liver aging-related diseases, thereby improving liver aging and related diseases by inhibiting macrophage aging.

[0005] To achieve the above objectives, the technical solutions adopted by the present invention include:

[0006] In a first aspect, the present invention provides the use of indole-3-lactic acid in the preparation of a medicament for preventing or treating liver aging or liver aging-related diseases.

[0007] Preferably, the indole-3-lactic acid is derived from intestinal flora.

[0008] Preferably, the gut microbiota includes at least one of Lactobacillus johnsonii, Lactobacillus reuteri, and Lactobacillus murinus.

[0009] Preferably, the gut microbiota is Lactobacillus murinus.

[0010] Preferably, the liver aging-related diseases include liver fibrosis, fatty liver, or liver inflammation.

[0011] The present invention demonstrates the potential to effectively inhibit macrophage aging and improve liver aging and related diseases by regulating the gut microbiota and its metabolite indole-3-lactic acid. The experimental results show that after transplanting the gut microbiota of young mice, the expression levels of inflammatory factors in the liver tissues of old mice are significantly reduced, the deposition of extracellular matrix is decreased, and the expression of aging-related genes is effectively regulated. In addition, through the gut microbiota colonization experiment, it is found that Lactobacillus murinus can more effectively increase the content of indole-3-lactic acid, further enhancing its protective effect on liver health. Moreover, the supplementation of indole-3-lactic acid plays a key role in improving liver function, reducing inflammation, and slowing down the aging process. The present invention provides a new idea for intervening in liver aging through the gut microbiota and its metabolites, and has broad clinical application prospects, especially in the treatment of liver aging-related diseases with potential therapeutic value.

[0012] In a second aspect, the present invention provides a drug for preventing or treating liver aging and liver aging-related diseases, and the drug includes indole-3-lactic acid and / or Lactobacillus murinus.

[0013] Preferably, the drug further includes a pharmaceutically acceptable carrier or excipient.

[0014] Preferably, the drug is used in at least one of the following aspects:

[0015] a. Inhibiting the expression levels of pro-inflammatory factors, chemokines, or fibrosis-related genes in liver tissues;

[0016] b. Inhibiting the expression levels of fibrosis-related proteins or aging-related proteins in liver tissues;

[0017] c. Inhibiting the production of SA-β-galactosidase.

[0018] Preferably, the pro-inflammatory factors include at least one of IL-1β, IL-6, TNF-α, and Nos2; the chemokine includes CXCL2; the fibrosis-related genes include at least one of Col1a1 and Col3a1; the fibrosis-related proteins include at least one of fibronectin Fibronectin and α-smooth muscle actin α-SMA; the aging-related protein includes the aging protein P16.

[0019] Through experimental exploration, it was found that indole-3-lactic acid can effectively reduce the expression levels of pro-inflammatory factors and chemokines in liver tissues, thereby reducing inflammatory responses and slowing down the process of liver aging. At the same time, indole-3-lactic acid can also inhibit the protein expressions related to fibrosis and aging in liver tissues, and further reduce the degree of liver fibrosis and aging. In addition, indole-3-lactic acid can significantly inhibit the production of SA-β-galactosidase, which is closely related to the accumulation of senescent cells. Inhibiting its production helps to slow down the aging process. In summary, indole-3-lactic acid regulates the inflammation, fibrosis, and aging-related processes of the liver through multiple pathways, demonstrating its potential application value in the prevention and treatment of liver aging and related diseases.

[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0021] By regulating the gut microbiota and its metabolite indole-3-lactic acid, the present invention can effectively inhibit macrophage aging and improve liver aging and related diseases. The research results show that after transplanting the gut microbiota of young mice, the expression levels of inflammatory factors in the liver tissues of old mice are reduced, the deposition of extracellular matrix is decreased, and the expression of aging-related genes is regulated. In addition, the supplementation of indole-3-lactic acid can significantly improve the liver function indexes of old mice, reduce the expression levels of inflammatory factors in liver tissues, decrease the deposition of extracellular matrix, and regulate the expression of aging-related genes, improving the overall health status of the liver, and having important clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a result graph of the fecal microbiota transplantation experiment in Example 1. Among them, Figure 1 A is a schematic diagram of the experimental design; Figure 1 B is a result graph of the transcriptional levels of pro-inflammatory factors IL-1β, IL-6, TNF-α, Nos2, chemokine CXCL2, fibrosis-related genes Col1a1 and Col3a1 in liver tissues; Figure 1 C is a Masson MASSON staining, immunohistochemical labeling of fibronectin and aging index P16 staining in liver tissues (scale bar: 50 microns); Figure 1 D is a quantitative analysis result graph of immunohistochemistry of Masson MASSON staining, fibronectin, and P16 staining; Figure 1 E is a result graph of protein expressions of P16, fibronectin, and α-smooth muscle actin α-SMA in the liver detected by immunoblotting;

[0023] Figure 1Figure F shows the quantitative analysis results of immunoblotting. Each group of data is expressed as mean ± SEM, n = 4 - 6, IOD: integrated optical density, and statistical analysis was performed using Image-pro-plus software; *P < 0.05, **P < 0.01, ***P < 0.001, and the statistics were performed by unpaired Student’s t-test;

[0024] Figure 2 Figure shows the results of 16s rDNA sequencing and non-targeted metabolomics in Example 2, where Figure 2 Figure A shows the OPLS-DA analysis results of the intestinal flora of young and old mice; Figure 2 Figure B shows the cladogram of the key species composition of the intestinal flora of young and old mice; Figure 2 Figure C shows the differential analysis results of the key species of the intestinal flora of young and old mice; Figure 2 Figure D shows the difference results of the phylum-level composition of the intestinal flora of young and old mice; Figure 2 Figure E shows the bar chart of the species composition of the intestinal flora; Figure 2 Figure F shows the prediction of the function of the intestinal flora by KEGG signaling pathway enrichment analysis; Figure 2 Figure G shows the volcano plot of differential metabolites; Figure 2 Figure H shows the abundance results of indole-3-lactic acid (ILA) in young and old mice; Figure 2 Figure I shows the line chart of the intestinal microbiota and fecal differential metabolites; Figure 2 Figure J shows the correlation heatmap of the intestinal microbiota and fecal differential metabolites. The data are expressed as mean ± standard error of each group, n = 7; **P < 0.01; unpaired Student's t-test was used;

[0025] Figure 3 Figure shows the results of the experiment on clearing the intestinal flora and strain colonization by antibiotics in Example 3, where Figure 3 Figure A shows the schematic diagram of the experimental design; Figure 3 Figure B shows the results of detecting the ILA levels in mouse feces and serum by enzyme-linked immunosorbent assay (ELISA) kit; The data are expressed as mean ± standard error of each group, n = 5; **P < 0.01, ***P < 0.001; NS, no significance; unpaired Student's t-test was used;

[0026] Figure 4 Figure shows the results of analyzing the potential effects and mechanisms of indole-3-lactic acid (ILA) through in vitro experiments in Example 4, where Figure 4Figure showing the transcriptional levels of pro-inflammatory factors IL-1β, IL-6, TNF-α, Nos2, and chemokine Ccl3 detected by qRT-PCR in bone marrow-derived macrophages (BMDMs) from old mice (24 months old) stimulated with LPS and IFN-γ to induce inflammatory polarization; Figure 4 Figure showing the results of immunofluorescence detection of the phagocytosis of apoptotic thymocytes by BMDMs (scale bar: 50 μm); Figure 4 Figure showing the results of quantitative analysis of the percentage of macrophages phagocytosing apoptotic cells and the number of apoptotic cells phagocytosed; Figure 4 Figure showing the staining of SA-β-galactosidase in BMDMs (scale bar: 50 μm); Figure 4 Figure showing the results of quantitative analysis of SA-β-galactosidase staining; each group of data is expressed as mean ± SEM, n = 3; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; statistical analysis was performed by unpaired Student's t-test;

[0027] Figure 5 Figure showing the results of evaluating the therapeutic improvement effect of indole-3-lactic acid (ILA) on liver aging and fibrosis in Example 5, where, Figure 5 Figure showing the results of measuring the serum ALT and AST levels in old mice; Figure 5 Figure showing the results of detecting the transcript levels of MMP3, MMP7, MMP9, IL-1β, IL-6, TNF-α, and Nos2 in the liver tissues of old mice by qRT-PCR; Figure 5 Figure showing the immunohistochemical staining of P16 and Masson staining of liver tissues from old mice (scale bar: 100 μm), TUNEL staining and immunofluorescence staining of cleaved-caspase3 (scale bar: 150 μm); Figure 5 Figure showing the quantitative analysis of immunohistochemical staining of P16 and Masson staining, and the quantitative analysis of the number of positive cells in TUNEL staining and immunofluorescence staining of cleaved-caspase3; Figure 5 Figure showing the results of detecting the protein expression of fibronectin, α-SMA, γ-H2AX, P21, and P16 in the liver tissues of old mice by immunoblotting; Figure 5 Figure showing the quantitative analysis of immunoblotting of fibronectin and α-SMA proteins; Figure 5Figure showing the results of immunoblot quantitative analysis of γ-H2AX, P21 and P16 proteins; each group of data is expressed as mean ± SEM, n = 4-6; *P<0.05, **P<0.01, ***P<0.001; NS, no significance; the data were analyzed by unpaired student t-test. Detailed implementation manners

[0028] To make the objectives, technical solutions and effects of the present invention clearer and more definite, the present invention will be further described in detail below with reference to the embodiments and the drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention, and are not used to limit the present invention.

[0029] Unless otherwise specified, the reagents used in the embodiments are all conventional reagents in the art and can be obtained through commercial channels. The experimental operations not specifically described in the embodiments are all conventional operations in the art or can be understood or known by those skilled in the art according to the existing technology or common general knowledge they have mastered.

[0030] In the embodiments, qRT-PCR was used to detect the expression of pro-inflammatory factors (such as IL-1β, IL-6, TNF-α, Nos2, etc.), profibrotic factors (such as Col1a1, Col3a1, etc.) and chemokines (such as Cxcl2, etc.). The primer sequences involved are shown in Table 1.

[0031] Table 1 RT-PCR primer sequences for mice

[0032] Gene Name Forward Primer Reverse Primer Col1a1 GCTCCTCTTAGGGGCCACT CCACGTCTCACCATTGGGG Col3a1 CTGTAACATGGAAACTGGGGAAA CCATAGCTGAACTGAAAACCACC Cxcl2 CGGTCAAAAAGTTTGCCTTG TCCAGGTCAGTTAGCCTTGC Ccl3 ACCATGACACTCTGCAACCA GTGGAATCTTCCGGCTGTAG MMP3 ACATGGAGACTTTGTCCCTTTTG TTGGCTGAGTGGTAGAGTCCC MMP7 CTGCCACTGTCCCAGGAAG GGGAGAGTTTTCCAGTCATGG MMP9 CTGGACAGCCAGACACTAAAG CTCGCGGCAAGTCTTCAGAG IL-6 TGATGCACTTGCAGAAAACA ACCAGAGGAAATTTTCAATAGGC TNF-α CCACCACGCTCTTCTGTCTAC AGGGTCTGGGCCATAGAACT NOS2 GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC IL-1β ATGCCCACCTCCTCAAAGAC GTAGTTTCCGTTGGAACAGTGAA

[0033] Example 1

[0034] Liver aging is often accompanied by intestinal microbiota imbalance, and at the same time, intestinal microbiota imbalance will exacerbate liver aging, and the mechanism of intestinal microbiota dysbiosis in the elderly population is not fully understood. Starting from the perspective of microbiota, this example aims to explore whether the transplantation of young mouse intestinal microbiota into old mice can improve liver aging through fecal microbiota transplantation experiments. The specific method is as follows:

[0035] (1) Select 15-month-old wild-type C57BL / 6 mice and perform gavage intervention with quadruple antibiotics (vancomycin (100 mg / kg), metronidazole (200 mg / kg), ampicillin (200 mg / kg), neomycin (200 mg / kg)) for three consecutive days to clear the intestinal microbiota and construct a pseudo-sterile old mouse model; the pseudo-sterile old mice were randomly divided into two groups: Aged-FMT+Aged group and Young-FMT+Aged group;

[0036] (2) Fecal microbiota transplantation experiment: Feces of young mice (2 months old, Young) and old mice (24 months old, Aged) were collected. Then, 1 g of feces was added to 5 ml of PBS, and the feces were mashed with a grinding rod. Then, it was centrifuged at 500 rpm for 3 minutes, and the supernatant was aspirated to prepare a fecal microbiota suspension. The corresponding fecal microbiota suspensions were respectively gavaged once a day to two groups of 15-month-old pseudo-sterile old mice with 0.2 mL of fecal suspension by gavage method. The intervention was carried out four times in total, each lasting for five days, and then observed until the 24th month of age;

[0037] (3) Observation index recording: General condition and liver function assessment. Observe the mental state, body weight, and activity of the mice, and record the survival curve. To evaluate the mice, the expression levels of pro-inflammatory factors (such as IL-1β, IL-6, TNF-α, Nos2, etc.) and chemokines (such as Cxcl2, etc.) (primer sequences are shown in Table 1) in liver tissues were detected by qRT-PCR. For liver fibrosis assessment, Western blot (WB) was used to detect fibrotic indexes (such as Fibronectin and α-SMA). Quantitative analysis of MASSON staining was performed, and the expression level and expression site of Fibronectin protein were detected by immunohistochemistry (IHC). The expression levels of profibrotic factors (such as Col1a1, Col3a1) (primer sequences are shown in Table 1) in liver tissues were detected by qRT-PCR. For liver aging assessment, WB and qRT-PCR were used to analyze the expression of aging proteins (such as P16, etc.) in liver tissues. The expression level and expression site of P16 protein were detected by IHC.

[0038] The results are as Figure 1 shown. Transplantation of fecal microbiota from young donor mice significantly improved liver aging, liver fibrosis, and liver inflammation in old mice.

[0039] Example 2

[0040] In this example, 16S rDNA sequencing and non-targeted metabolomics (Guangzhou Gene Denovo Biotechnology Co., Ltd.) were used to analyze the composition and structural changes of the microbiota, demonstrate the metabolic characteristics of microbiota metabolites, and screen for differential metabolites. The specific methods are as follows:

[0041] Two-month-old (Young) young mice and 24-month-old (Aged) old mice with C57BL / 6 background were selected, and they were divided into the Young group and the Aged group; their feces were obtained for 16S rDNA sequencing analysis to describe the changes in the composition and structure of their gut microbiome; the changes in gut microbiota metabolites of old mice were analyzed by non-targeted metabolomics; finally, the two sequencing data were jointly analyzed to find differential strains and their related metabolites that may mediate the progression of liver aging. The specific results are shown in Figure 2 .

[0042] OPLS-DA analysis of the gut microbiota showed that the diversity of the gut microbiota in old mice (24 months old) was reduced compared with that in young mice (2 months old). Further comparison of the gut microbiota composition in young mice found that the abundances of beneficial bacteria, including Firmicutes, Lactobacillales, and Lactobacillus murinus, decreased in old mice. KEGG pathway prediction showed a downregulation of the tryptophan metabolism pathway in the gut microbiota of old mice. Metabolomics analysis found a decrease in the abundance of indole-3-lactic acid (ILA). The above results indicate that microbiota-derived indole-3-lactic acid plays an improving role in the development of liver aging.

[0043] Example 3

[0044] In this example, through antibiotic clearance of the gut microbiota and strain colonization experiments, different Lactobacillus strains were used to colonize germ-free mice to clarify the source of indole-3-lactic acid, and enzyme-linked immunosorbent assay (ELISA) was used to detect the changes in tryptophan metabolites in the feces and sera of different mice to confirm the source of indole-3-lactic acid (ILA). The specific method is as follows:

[0045] (1) Antibiotic clearance experiment: Wild-type C57BL / 6 mice at 2 months old were selected and gavaged with a combination of four antibiotics to construct a pseudo-germ-free mouse model. After continuous observation for three days, feces and sera of different mice were collected, and enzyme-linked immunosorbent assay (ELISA) kits were used to detect the changes in tryptophan metabolites.

[0046] (2) Strain colonization experiment: Lactobacillus johnsonii, Lactobacillus reuteri, and Lactobacillus murinus were used for colonization experiments. The freeze-dried powders of Lactobacillus johnsonii, Lactobacillus reuteri, and Lactobacillus murinus were purchased from Beijing Beina Biotechnology Company. Single colonies were collected into Man Rogosa Sharpe (MRS) medium (Beijing Solarbio Science & Technology Co., Ltd.), and then the bacterial solution was cultured under anaerobic conditions at 37°C. After growing for 16 - 24 hours, the OD 600 = 0.5 - 0.6 was measured until the logarithmic phase, at which time the colony count was 5×10 8 CFU / mL. The above Lactobacillus strains were resuspended with sterile PBS at 5×10 8The colony counts of CFU were gavaged into germ-free mice colonized once a day, 200 μL each time, for five consecutive days; the mice in the control group were gavaged with an equal volume of sterile PBS. Feces and serum were collected, and the changes in the tryptophan metabolite indole-3-lactic acid (ILA) were detected using an enzyme-linked immunosorbent assay (ELISA) kit (MM-926095O1; Jiangsu Enzyme Immuno-Biology Co., Ltd.).

[0047] The results are as Figure 3 shown. The intestinal colonization experiment of Lactobacillus murinus led to an increase in the levels of ILA in feces and serum, indicating that indole-3-lactic acid (ILA) is a metabolite derived from Lactobacillus murinus in the intestine.

[0048] Example 4

[0049] In this example, the potential effects and mechanisms of indole-3-lactic acid (ILA) were analyzed through in vitro experiments. The specific methods are as follows:

[0050] (1) Primary bone marrow-derived macrophages (BMDMs) of 24-month-old C57BL / 6 wild-type aged mice were isolated, and a classical macrophage inflammation model was constructed by stimulating with lipopolysaccharide (LPS) and IFN-γ.

[0051] (2) To evaluate the transcriptional levels of pro-inflammatory factors of ILA in macrophages, qRT-PCR was used to detect pro-inflammatory factors (such as IL-1β, IL-6, TNF-α, Nos2, etc.) and chemokines (such as Ccl3, etc.) (the primer sequences are shown in Table 1); the phagocytosis of macrophages (the phagocytic function of BMDMs cells on apoptotic thymocytes was detected by immunofluorescence); and SA-β-gal staining was used to detect cell senescence.

[0052] Figure 4 The results showed that the treatment of primary aged mouse macrophages with ILA significantly reduced the expression of pro-inflammatory genes and promoted the phagocytosis of macrophages. These results indicate that ILA plays a key role in maintaining macrophage homeostasis and preventing liver inflammation; ILA can effectively reduce the number of SA-β-galactosidase-positive cells, indicating that ILA has a potential anti-aging effect on macrophages.

[0053] Example 5

[0054] In this example, an aged mouse model was selected to evaluate the therapeutic and ameliorative effects of indole-3-lactic acid (ILA) on liver aging and fibrosis. The specific methods are as follows:

[0055] Eighteen-month-old C57BL / 6 wild-type aged mice were randomly divided into the following two groups: the Aged group of aged mice and the Aged+ILA group of aged mice. Starting from the 18th month of age, ILA (40 mg / kg) or normal saline was administered by gavage every other day until the 24th month of age. The general conditions of the above two groups of mice were recorded, and at the same time, mouse serum, liver tissue, and various organs were obtained to detect the following indicators.

[0056] Assessment of general condition and liver function: Observe the general condition of the mice (mental state, body weight, activity); assess liver function by AST and ALT in liver function; Assessment of liver inflammation: qRT-PCR was used to detect the expression of pro-inflammatory factors (IL-1β, IL-6, TNF-α, Nos2, etc.) in liver tissue. Assessment of liver fibrosis: Immunoblotting (WB) was used to detect fibrotic indicators (Fibronectin and α-SMA); Quantitative analysis of MASSON staining; qRT-PCR was used to detect the expression of profibrotic factors (MMP3, MMP7, MMP9) in liver tissue; Assessment of liver aging: WB and qRT-PCR were used to analyze the expression of senescence proteins (P16, P21, γ-H2AX, etc.) in liver tissue; Immunohistochemical staining was used to detect the expression level and location of P16 protein; Assessment of efferocytosis: Immunohistochemical staining was used to detect the expression level and location of Cleaved-Caspase3 protein in liver tissue and TUNNEL staining was used to detect apoptotic cells.

[0057] Figure 5 The results showed that ILA had a protective effect on the liver by regulating macrophage immune response and efferocytosis, promoted liver regeneration, and inhibited inflammation, indicating that ILA represents a potential method for treating age-related liver diseases such as fatty liver and cirrhosis.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Use of indole-3-lactic acid in the preparation of a drug for preventing or treating liver aging or liver aging-related diseases.

2. The use according to claim 1, characterized in that The indole-3-lactic acid is derived from intestinal flora.

3. The use according to claim 2, characterized in that The intestinal flora includes at least one of Lactobacillus johnsonii, Lactobacillus reuteri and Lactobacillus murinus.

4. The use according to claim 1, characterized in that The liver aging-related diseases include liver fibrosis, fatty liver or liver inflammation.

5. The use according to claim 1, characterized in that The drug is used in at least one of the following aspects: a. Inhibit the expression levels of pro-inflammatory factors, chemokines or pro-fibrotic factors in liver tissue; b. Inhibiting the expression level of fibrosis-related proteins or aging-related proteins in liver tissue; c. Inhibit the production of SA-β-galactosidase.

6. The use according to claim 5, characterized in that The pro-inflammatory factor comprises at least one of IL-1β, IL-6, TNF-α and Nos2; The chemokines include CXCL2; The profibrotic factor comprises at least one of Col1a1 and Col3a1; The fibrosis-related protein includes at least one of fibronectin and α-smooth muscle actin α-SMA; The aging-related proteins include aging protein P16.

7. A drug for preventing or treating liver aging and liver aging-related diseases, characterized in that: The drug comprises indole-3-lactic acid and / or Lactobacillus murinus.

8. The drug according to claim 7, characterized in that The medicine also includes a pharmaceutically acceptable carrier or excipient.

Images