Genetically engineered bacterium for synthesizing alkylresorcinol and preparation method of genetically engineered bacterium

Abstract

The invention belongs to the field of synthetic biology, and particularly relates to a genetically engineered bacterium for synthesizing alkylresorcinol and a preparation method of the genetically engineered bacterium. According to the invention, through screening, it is determined that an appropriate expression vector containing a polyketide synthetase gene efficiently expresses and generates alkyl resorcinol in genetically modified host bacteria escherichia coli Nissle 1917, and the expression of an acetyl coenzyme A carboxylase gene related to an alkyl resorcinol synthesis path is further enhanced; the yield of the alkyl resorcinol is further improved, the maximum yield of shake flask fermentation reaches 27.17 mg / L, and a foundation is laid for large-scale industrial production of the alkyl resorcinol.

Description

Technical Field

[0001] The present invention belongs to the field of synthetic biology. Specifically, the present invention relates to a genetically engineered bacterium for synthesizing alkylresorcinols and a preparation method thereof. Background Art

[0002] Alkylresorcinols (ARs) are natural bioactive components produced by bacteria, fungi, sponges, and higher plants. They have a lipophilic polyphenol structure and have various physiological functions such as antibacterial, anti-inflammatory, anti-cancer, fat-reducing, and antioxidant effects. In recent years, ARs have attracted extensive attention due to their amphiphilicity and interactions with enzymes and nucleic acids. However, the content of ARs in plants is very low. The average content of ARs in different wheat varieties is 697 - 1732 μg / g. Extracting ARs from grains using organic solvents such as ethyl acetate and acetone has problems such as high difficulty, serious environmental pollution, and low extraction yield. Type III polyketide synthase (PKS) identified in plants and microorganisms is involved in the biosynthesis of various natural products, including the synthesis of ARs. Sun Lei et al. [1] Identified two type III polyketide synthases, Sl-pks1 and Sl-pks2, from Sporotrichum laxum ATCC 15155. Expressing Sl-pks2 in Escherichia coli BL21-CodonPlus(DE3)-RIL enabled it to have the ability to synthesize alkylresorcinols with C13–C17 saturated or unsaturated side chains. Liu Guiyou et al. [2] Also reported the recombinant expression of Sl-pks2 of Sporotrichum laxum using Saccharomyces cerevisiae. This recombinant bacterium has the ability to ferment and produce 5 different ARs. After 48 hours of fermentation, the yield of ARs is the highest.

[0003] Both Escherichia coli and Saccharomyces cerevisiae are commonly used host strains in genetic engineering for synthetic biology, and have been applied to the expression of various bioactive molecules and proteins. Escherichia coli is a prokaryotic expression host and is widely used in the fields of bioengineering, metabolic engineering, and synthetic biology, and is suitable for expressing various foreign genes. The main advantages of the E. coli protein expression system are as follows: 1. Its genetic background is clear. After whole-genome sequencing, a total of 4,405 open reading frames were found; 2. The molecular biology operation element system supporting E. coli is mature and perfect; 3. It is easy to culture and control, the transformation operation is simple and efficient, the protein expression level is high, the cost is low, and the cycle is short, etc. However, as a prokaryotic expression host, E. coli will produce a type of bacterial endotoxin with a lipopolysaccharide (LPS) structure during the culture process, which will cause host toxicity reactions. Bacterial endotoxins have a small molecular weight and strong stability to heat and chemical reagents. Currently, methods such as ion exchange, adsorption, ultrafiltration, and surfactants are mainly used to remove endotoxins from samples. As a eukaryotic expression host, Saccharomyces cerevisiae has many advantages, but there are also problems such as low expression level, long fermentation time, and possible glycosylation modification. Therefore, further research is still needed for the efficient, safe, and low-cost microbial expression and production of alkylresorcinols (ARs).

[0004] Technical solution

[0005] In order to overcome the problems of related safety, low efficiency, and high cost existing in the extraction or biosynthesis of alkylresorcinols (ARs) in the prior art, through extensive screening, research, and modification, the present invention proposes a genetically engineered bacterium for synthesizing alkylresorcinols and a preparation method thereof.

[0006] In the first aspect of the present invention, the present invention provides a genetically engineered bacterium for synthesizing alkylresorcinols, wherein the genetically engineered bacterium contains an expression vector, and the expression vector expresses polyketide synthase (PKS).

[0007] In an embodiment of the present invention, the initial strain of the genetically engineered bacterium is Escherichia coli. Preferably, the Escherichia coli is Escherichia coli BL21(DE3) or probiotic Escherichia coli Nissle 1917.

[0008] As a probiotic Escherichia coli, Nissle 1917 does not contain pathogenic factors such as enterotoxin, hemolysin, and cytotoxin, and has no safety risk to the human body. Selecting Nissle 1917 as the host bacterium for biosynthesis can avoid the production of these pathogenic factors.

[0009] In one embodiment of the present invention, probiotic Escherichia coli Nissle 1917 is selected as the initial bacterium of the genetically engineered bacterium, and Nissle 1917 is genetically modified to improve its efficiency for biosynthesis.

[0010] In one embodiment of the present invention, the genetic modification of Nissle 1917 includes inserting a T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2 of Nissle 1917; preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the spacer sequence downstream of the RBS, its 5' end is shown as SEQ ID NO.13, and the T7 RNA polymerase expression cassette sequence is shown as SEQ ID NO.1.

[0011] In one embodiment of the present invention, the polyketide synthase gene constructed on the expression vector is derived from plants or microorganisms. Preferably, the sources include Secale cereale, Sorghum bicolor, Sporotrichum laxum, Nocardia farcinica, Micromonospora endolithica. More preferably, the polyketide synthase gene is derived from Sporotrichum laxum. In order to adapt to the expression of the expression vector in the host, the genes from the corresponding sources can be codon-optimized. In the present invention, the optimized sequences of the 5 different sources of PKS genes ScPK (Secale cereale, MF033355), SbPK (Sorghum bicolor, XP_002449744.1), SlPK (Sporotrichum laxum, KU560627), LpPK (Nocardia farcinica, NFA49290.1), MePK (Micromonospora endolithica, QZS07521.1) are shown as SEQ ID NO.2 to SEQ ID NO.6 respectively.

[0012] In one embodiment of the present invention, the expression of acetyl-CoA carboxylase is further enhanced in the genetically engineered bacterium for synthesizing alkylresorcinols.

[0013] In one embodiment of the present invention, the expression of acetyl-CoA carboxylase in genetically engineered bacteria is enhanced by an expression vector. The acetyl-CoA carboxylase gene and the polyketide synthase gene can be tandemly expressed on the same expression vector. Alternatively, the acetyl-CoA carboxylase gene and the polyketide synthase gene can be expressed on different expression vectors respectively.

[0014] In one embodiment of the present invention, the expression vector is selected from one or more of pRSFDuet, pCDFDuet, pETDuet, pCOLADuet, and pACYCDuet.

[0015] In one embodiment of the present invention, the sources of the acetyl-CoA carboxylase gene include Corynebacterium glutamicum and Escherichia coli.

[0016] In one embodiment of the present invention, the nucleotide sequences of the protein subunits derived from Corynebacterium glutamicum for the expression of acetyl-CoA carboxylase are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0017] In one embodiment of the present invention, the nucleotide sequences of the protein subunits derived from Escherichia coli for the expression of acetyl-CoA carboxylase are shown in SEQ ID NO.10 and SEQ ID NO.11.

[0018] In a second aspect of the present invention, a method for preparing a genetically engineered bacterium for synthesizing alkylresorcinol is disclosed, the method comprising:

[0019] (1) Preparing an expression vector containing a polyketide synthase gene;

[0020] (2) Transforming an initial strain with the expression vector containing the polyketide synthase gene.

[0021] In one embodiment of the present invention, the initial strain of the genetically engineered bacterium is Escherichia coli. Preferably, the Escherichia coli is Escherichia coli BL21(DE3) or probiotic Escherichia coli Nissle 1917.

[0022] In one embodiment of the present invention, the genetic modification of Nissle 1917 includes inserting a T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2 of Nissle1917; preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the spacer sequence downstream of the RBS, the 5' end of which is shown in SEQ ID NO.13, and the T7 RNA polymerase expression cassette sequence is shown in SEQ ID NO.1.

[0023] In one embodiment of the present invention, a polyketide synthase gene derived from Secale cereale, Sorghum bicolor, Sporotrichum laxum, Nocardia farcinica or Micromonospora endolithica is integrated onto an expression vector.

[0024] In one embodiment of the present invention, the method for preparing a genetically engineered bacterium for synthesizing alkylresorcinols of the present invention further includes enhancing the expression of acetyl-CoA carboxylase in the genetically engineered bacterium. The acetyl-CoA carboxylase gene and the polyketide synthase gene are tandemly expressed on the same expression vector; alternatively, the acetyl-CoA carboxylase gene and the polyketide synthase gene are expressed on different expression vectors respectively. Preferably, the source of the acetyl-CoA carboxylase gene includes Corynebacterium glutamicum and Escherichia coli.

[0025] In one embodiment of the present invention, the expression vector in the method for preparing a genetically engineered bacterium for synthesizing alkylresorcinols of the present invention is selected from one or more of pRSFDuet, pCDFDuet, pETDuet, pCOLADuet, and pACYCDuet.

[0026] In the third aspect of the present invention, the present invention provides an alkylresorcinol, which is produced by the genetically engineered bacterium of the present invention described above or the genetically engineered bacterium obtained according to the method for preparing the genetically engineered bacterium.

[0027] In the fourth aspect of the present invention, the present invention provides the use of the genetically engineered bacterium prepared by the present invention in the production and preparation of alkylresorcinols. The genetically engineered bacterium is inoculated into a fermentation medium, cultured, and the fermentation product is separated and purified to obtain alkylresorcinols. The medium is preferably an LB medium, and an inducer IPTG is added during the culture process for induced expression.

[0028] In the fifth aspect of the present invention, the present invention discloses the use of the alkylresorcinol prepared by the present invention in the preparation of a composition, and the composition includes drugs, health foods, foods for special medical purposes, and ordinary foods. It can be used as an active ingredient or as an additive with auxiliary efficacy. The composition may also contain excipient components acceptable in drugs and health foods. The dosage form of the composition may be tablets, capsules (hard capsules, soft capsules), liquid preparations, granules, powders, and gels.

[0029] Beneficial effects

[0030] The advantages or positive effects of the present invention compared with the prior art:

[0031] (1) The present invention utilizes an expression vector containing a polyketide synthase gene to efficiently express and produce alkylresorcinols in a host bacterium. In particular, the present invention uses Escherichia coli Nissle 1917 as the initial bacterium for genetic engineering, which has antibacterial activity and does not contain pathogenic factors such as enterotoxin, hemolysin, and cytotoxin, and has no safety risks and other advantages.

[0032] (2) While constructing a high-efficiency expression vector for polyketide synthase, the present invention also enhanced the expression of the acetyl-CoA carboxylase gene in the initial bacterium for genetic engineering, further increasing the yield of alkylresorcinols. The highest yield in shake-flask fermentation reached 27.17 mg / L, laying a foundation for the large-scale industrial production of alkylresorcinols. Description of the Drawings

[0033] Figure 1 shows the expression detection of polyketide synthase (PKSs) genes from different sources in genetically modified Escherichia coli Nissle 1917 and in Escherichia coli BL21(DE3). Among them, (A) is the SDS-PAGE detection after expression in Escherichia coli Nissle 1917. Lanes 1, 6, 11, 16: Marker; Lanes 2 and 12, 3 and 13: Supernatant and precipitate after cell disruption of TCBJ117-CK; Lanes 4, 5: Supernatant and precipitate after cell disruption of TCBJ117-ScPK, protein size 44.9 KDa; Lanes 7, 8: Supernatant and precipitate after cell disruption of TCBJ117-SbPK, protein size 44.4 KDa; Lanes 9, 10: Supernatant and precipitate after cell disruption of TCBJ117-SlPK, protein size 44.8 KDa; Lanes 14, 15: Supernatant and precipitate after cell disruption of TCBJ117-LpPK, protein size 44.5 KDa; Lanes 17, 18: Supernatant and precipitate after cell disruption of TCBJ117-MePK, protein size 38.4 KDa. Among them, (B) is the SDS-PAGE detection after expression in Escherichia coli BL21(DE3). Lanes 5, 10, 15, 18: Marker; Lanes 1 and 11, 2 and 12: Supernatant and precipitate after cell disruption of BL21-CK; Lanes 3, 4: Supernatant and precipitate after cell disruption of BL21-ScPK, protein size 44.9 KDa; Lanes 6, 7: Supernatant and precipitate after cell disruption of BL21-SbPK, protein size 44.4 KDa; Lanes 8, 9: Supernatant and precipitate after cell disruption of BL21-SlPK, protein size 44.8 KDa; Lanes 13, 14: Supernatant and precipitate after cell disruption of BL21-LpPK, protein size 44.5 KDa; Lanes 16, 17: Supernatant and precipitate after cell disruption of BL21-MePK, protein size 38.4 KDa.

[0034] Figure 2 、 C 15:0 、 C 17:0 、 C 19:0 、 C 21:0 、 C 25:0 Liquid mass spectrometry peak charts of the mixed standard and the fermentation sample, where (A) is C 15:0 、 C 17:0 、 C 19:0 、 C 21:0 、 C 25:0 Liquid mass spectrometry peak chart of the mixed standard; (B) is the liquid mass spectrometry detection peak of the TCBJ117-SlPK fermentation broth.

[0035] Figure 3 、 C in the product of the TCBJ117-SlPK fermentation broth 15:0 、 C 17:0 、 C 19:0 、 C 21:0 、 C 25:0 Ion peak chart. (A) is the ion peak chart of C 15:0 , with the parent ion at m / z 319.3 and the daughter ions at m / z 81.0 and 122.1; (B) is the ion peak chart of C 17:0 , with the parent ion at m / z 347.2 and the daughter ions at m / z 81.0 and 305.3; (C) is the ion peak chart of C 19:0 , with the parent ion at m / z 375.3 and the daughter ions at m / z 81.0 and 333.4; which is consistent with the MS results of ARs reported in the literature, indicating that the product of the strain TCBJ117-SlPK in the examples is C 15:0 、 C 17:0 and C 19:0 , and no C 21:0 、 C 25:0 . Detailed implementation manners

[0036] To more clearly describe the technical solution of the present invention, it is further illustrated below in combination with specific embodiments. Unless otherwise specified, the technical means used in the present invention are all methods well-known to those skilled in the art. In addition, the implementation manners should be understood as illustrative rather than limiting the scope of the present invention. This is only a part of the embodiments of the present invention, and the essence and scope of the present invention are only defined by the claims. For those skilled in the art, any changes or modifications to the material components and dosages in these implementation manners without departing from the essence and scope of the present invention also belong to the protection scope of the present invention.

[0037] The experimental methods used in the following examples are, unless otherwise specified, those that can be operated according to the operation instructions of relevant commercial reagents / kits by those skilled in the art. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0038] Example 1: Modify Escherichia coli Nissle1917 to optimize the T7-RNAP expression cassette and improve protein expression ability. (This method is also described in CN202310516515.6, which is incorporated herein by reference in its entirety as part of the present invention).

[0039] (1) In the original probiotic Escherichia coli Nissle1917 (E. coli Nissle1917), based on the CRISPR / Cas9 gene editing technology, using a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm, catalog number E086), the Cas9 fragment was ligated with the NcoI / XhoI double-digested fragment of the pKD46 plasmid to construct the pKD-Cas9 plasmid. The pKD-Cas9 plasmid was transformed into the E. coli Nissle1917 strain, and positive clones were screened and named EcN-Cas9.

[0040] (2) While preparing EcN-Cas9, sgRNAs of the cryptic plasmids pMTU1 and pMTU2 were designed and prepared respectively, and transferred into EcN-Cas9 for knockout of the cryptic plasmids, thereby constructing an Escherichia coli strain with the cryptic plasmids removed, named EcNc.

[0041] Among them: sgRNA-pMTU1: agttaccggataaggcgcagcgg; sgRNA-pMTU2: gtttggcgcagaacctcggacgg.

[0042] (3) Insert the optimized T7RNAP expression cassette into the genome of the Nissle 1917 bacterium, and the insertion site of the expression cassette is the attB site on the genome.

[0043] The optimized T7RNAP expression cassette (abbreviated as "lacUV5-T7") includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and the T7 RNA polymerase (Gene ID: 1261050) sequence located downstream of the spacer sequence downstream of the RBS. The 5' end of the T7RNAP expression cassette sequence is tttacactttatgcttccggctcgtataatgtgtggaattgtgagcggataacaaGGCCACTACTAGAGAAA GAGGAGAAA TACTAGATGAACACGATTAACATCGCTAAGAAC (SEQ ID NO.13), where the promoter sequence is "tttacactttatgcttccggctcgtataatg", the operator sequence is "ttgtgagcggataacaa", the RBS sequence is "AAAGAGGAGAAA", the spacer sequences are "GGCCACTACTAGAG" (upstream spacer sequence of RBS) and "TACTAG" (downstream spacer sequence of RBS), "ATGAACACGATTAACATCGCTAAGAAC" is the upstream partial sequence of the gene encoding T7 RNA polymerase (Gene ID: 1261050), and ATG is the start codon. The complete optimized T7 RNAP expression cassette sequence is as shown in SEQ ID NO.1.

[0044] Construct EcNc-Cas9 according to step (1), and then co-transfer the pUC-sgRNA-attB plasmid and the Donor fragment (the Donor fragment contains the T7 RNAP fragment (i.e., the T7RNAP expression cassette) and homologous arms of about 300 bp in length upstream and downstream of the attB site) into EcNc-Cas9 cells. Use the CRISPR / Cas9 system to integrate the T7 RNAP fragment into the attB site of the EcNc strain to obtain the strain EcNcΔattB(lacUV5-T7), simply referred to as EcNc-T7. The Donor fragment is as shown in SEQ ID NO.12.

[0045] Among them, the sgRNA nucleotide sequence targeting the attB site is sgRNA-attB: ctaacttgagcgaaacgggaagg; the Donor fragment contains the T7 RNAP fragment (i.e., the T7RNAP expression cassette) and homologous arms of about 300 bp in length upstream and downstream of the attB site.

[0046] (4) Knock out the endA and ompT genes in the probiotic Escherichia coli EcNc-T7 strain based on the CRISPR / Cas9 gene editing technology to prepare EcNcΔattB(lacUV5-T7)ΔendAΔompT.

[0047] sgRNAs targeting genes endA and ompT were designed separately. The nucleotide sequence of the sgRNA for endA is sgRNA-endA: tttttctcaagcgaaagccgcgg; and the nucleotide sequence of the sgRNA for ompT is sgRNA-ompT: tactcctgacaacataaatgcgg. The CRISPR / Cas9 knockout system was transformed into the target strain EcNc-T7, i.e., the target genes in EcNc-T7 were knocked out, resulting in EcNcΔattB(lacUV5-T7)ΔendAΔompT, which was named "TCBJ117".

[0048] As known to those skilled in the art, in addition to using the CRISPR / Cas9 gene editing technology, homologous recombination technology can also be used to knock out relevant genes and plasmids, and the finally obtained strain is identical to TCBJ117.

[0049] Example 2: Construction of Polyketide Synthase Expression Plasmid

[0050] Polyketide synthases (PKSs) are an important class of enzymes involved in the biosynthesis of natural products. PKSs use acyl carrier protein-(ACP)- or coenzyme A-(CoA)-activated compounds as starter units and malonyl-CoA as extender units to catalyze multiple rounds of chain elongation (polyketide formation). Known PKSs are subdivided into three different subclasses (types I, II, and III), which reflect different levels of complexity regarding protein domain structure and catalytic reaction cascades. To test the activities of PKSs from different sources, we synthesized 5 different PKS genes and constructed expression vectors, and then measured the alkylresorcinol production of the engineered strains after transferring them into the chassis strain TCBJ117.

[0051] Entrust Wuhan Tianyi Huayu Gene Technology Co., Ltd. to artificially synthesize 5 PKS genes with codon-optimized sequences from different sources, namely ScPK (Secale cereale, MF033355), SbPK (Sorghum bicolor, XP_002449744.1), SlPK (Sporotrichum laxum, KU560627), LpPK (Nocardia farcinica, NFA49290.1), and MePK (Micromonospora endolithica, QZS07521.1). The optimized sequences are shown as SEQ ID NO.2 - SEQ ID NO.6 respectively. Connect the synthesized gene fragments to the vector pRSFDuet through a homologous recombination kit (Pro Ligation-Free Cloning Kit, abm, catalog number E086) to obtain recombinant plasmids pRSFDuet-ScPK, pRSFDuet-SbPK, pRSFDuet-SlPK, pRSFDuet-LpPK, and pRSFDuet-MePK respectively. Transform the recombinant plasmids into the chassis strain TCBJ117 to obtain engineered strains TCBJ117-ScPK, TCBJ117-SbPK, TCBJ117-SlPK, TCBJ117-LpPK, and TCBJ117-MePK. Transform the recombinant plasmids into the commercial strain BL21(DE3) to obtain engineered strains BL21-ScPK, BL21-SbPK, BL21-SlPK, BL21-LpPK, and BL21-MePK respectively. Transform the empty plasmid vector pRSFDuet into TCBJ117 and BL21(DE3) respectively as negative control strains TCBJ117-CK and BL21-CK.

[0052] Example 3: Expression Screening of Polyketide Synthase and Fermentation Detection of Alkylresorcinols

[0053] For the engineered strains TCBJ117-ScPK, TCBJ117-SbPK, TCBJ117-SlPK, TCBJ117-LpPK, TCBJ117-MePK, BL21-ScPK, BL21-SbPK, BL21-SlPK, BL21-LpPK, BL21-MePK and the negative control strains TCBJ117-CK and BL21-CK, pick single colonies and inoculate them into LB medium (5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl) containing 50 μg / mL kanamycin, and culture overnight at 37°C with 200 rpm for 12 h. Transfer the seed liquid at 1% to 100 mL of fresh LB medium (containing 50 μg / mL kanamycin), and culture at 37°C with 200 rpm until the OD of the bacterial solution600 = 0.6 - 0.8, add 0.3 mM IPTG to induce the expression of polyketide synthase, ferment at 37 °C and 200 rpm for 24 h.

[0054] Collect the fermentation broth, centrifuge at 6000 rpm for 10 min to separate the supernatant and the precipitate. Add 100 mL of ethyl acetate to the supernatant, shake and extract at 150 rpm for 12 h, and collect the ethyl acetate layer. Add 10 mL of PBS buffer to the precipitate, sonicate for 15 min, centrifuge the cell lysate at 12000 rpm for 10 min, take the supernatant and add 100 mL of ethyl acetate, shake and extract at 150 rpm for 12 h, and collect the ethyl acetate layer. Mix the two batches of ethyl acetate solutions obtained by extraction, dry by vacuum rotary evaporation, dissolve and resuspend the solid with 2 mL of methanol, filter through a 0.22 μm filter membrane for liquid chromatography - mass spectrometry detection, using 5 - pentadecylresorcinol (C 15:0 ), 5 - heptadecylresorcinol (C 17:0 ), 5 - nonadecylresorcinol (C 19:0 ), 5 - heneicosylresorcinol (C 21:0 ) and 5 - pentacosylresorcinol (C 25:0 ) standards as detection markers.

[0055] To identify whether the polyketide synthase is soluble expressed, mix the supernatant and the precipitate after cell disruption above with 4× protein loading buffer respectively, heat at 100 °C for 10 min to prepare the sample, and separate by SDS - PAGE. The SDS - PAGE gel pattern is as shown in Figure 1 . The polyketide synthases ScPK, SbPK, SlPK, LpPK and MePK are well expressed and soluble expressed in the strain TCBJ117; but the expression level is low in BL21(DE3) and there are no obvious protein bands.

[0056] Perform liquid chromatography and mass spectrometry detection on the expression product: Liquid chromatography detection conditions for alkylresorcinols: Use an Agilent1200 HPLC instrument (Agilent Eclipse Plus C18, 5 μm, 4.6 mm × 250 mm) to detect the product, the column temperature is 30 °C, the mobile phases are A: 89% (v / v) methanol aqueous solution and B: 99% (v / v) methanol aqueous solution, the flow rate is 0.65 mL / min, the elution gradient is shown in Table 1, and the ultraviolet detection wavelength is 280 nm.

[0057] Table 1 Elution gradient for liquid chromatography detection of alkylresorcinols

[0058] Elution time A％ B％ 0 min 100 0 10 min 0 100 30 min 0 100 40 min 100 0

[0059] MS detection conditions: Ionization mode: Electrospray negative ion mode; Detection mode: Product Ion; Nebulizer gas pressure: 40 psi; Ion spray voltage: 4000 V; Dryer temperature: 350 °C; Dry gas flow rate: 8 L / min. Qualitative ion pairs, fragmentation voltage and collision energy are shown in Table 2:

[0060] Table 2

[0061]

[0062]

[0063] See Figure 2 , HPLC-MS results of ARs standards and samples, (A) is for C 15:0 , C 17:0 , C 19:0 , C 21:0 , C 25:0 mixed standard liquid mass spectra; (B) is the liquid mass detection peak of TCBJ117-SlPK fermentation broth. The product in the sample has the same peak time as the standard.

[0064] See Figure 3 , for the ion chromatograms of C 15:0 , C 17:0 , C 19:0 in the product of TCBJ117-SlPK fermentation broth. Among them, (A) is the ion chromatogram of C 15:0 , with the parent ion at m / z 319.3 and the daughter ions at m / z 81.0 and 122.1; (B) is the ion chromatogram of C 17:0 , with the parent ion at m / z 347.2 and the daughter ions at m / z 81.0 and 305.3; (C) is the ion chromatogram of C 19:0 , with the parent ion at m / z375.3 and the daughter ions at m / z 81.0 and 333.4; which is consistent with the MS results of ARs reported in the literature, indicating that the product of strain TCBJ117-SlPK in the example is C 15:0 , C 17:0 and C 19:0 , and does not produce C 21:0 , C 25:0 .

[0065] The types and total contents of Ars produced by the fermentation of genetically engineered strains are shown in Table 3. The overall yield of alkylresorcinols of the BL21 series of engineered bacteria is lower than that of the TCBJ117 series of engineered bacteria, indicating that the constructed novel probiotic Escherichia coli Nissle 1917 can promote the expression of foreign genes and is more suitable for the expression of polyketide synthase and the synthesis of alkylresorcinols than the commercial strain BL21(DE3). Therefore, TCBJ117 was selected as the chassis for further modification to improve the yield of alkylresorcinols in the following research. Among the TCBJ117 series of engineered strains expressing 5 different polyketide synthases, TCBJ117-SlPK accumulated the highest total amount of resorcinol, reaching 22.62 mg / L, and had a relatively high proportion of C15:0 and C17:0, indicating that SlPK had the strongest catalytic activity for polyketide synthesis in TCBJ117, and SlPK might be more inclined to catalyze the polymerization of acyl-CoA with a chain length below C17 and malonyl-CoA. The enzyme activities of ScPK and LpPK were relatively low, and the total amount of resorcinol catalyzed and synthesized was relatively low. Therefore, SIPK, SbPK, and MePK were selected for further research in the follow-up.

[0066] Table 3

[0067]

[0068]

[0069] - indicates that the compound was not detected

[0070] Example 4: Strengthening acetyl-CoA carboxylase to increase the synthesis amount of alkylresorcinols

[0071] Malonyl-CoA is the key polymerization unit for the synthesis of alkylresorcinols. It is catalyzed by polyketide synthase to polymerize to form the benzene ring structure of alkylresorcinols. At the same time, malonyl-CoA is also the key precursor for the synthesis of intracellular fatty acyl-CoA, and fatty acyl-CoA is another key starting unit for the synthesis of alkylresorcinols. Therefore, increasing the supply of intracellular malonyl-CoA may be an effective means to increase alkylresorcinols.

[0072] Acetyl-CoA carboxylase is the only biological pathway that catalyzes the production of malonyl-CoA from acetyl-CoA. In Corynebacterium glutamicum, acetyl-CoA carboxylase is composed of three protein subunits, encoded by the CaccB, CaccC, and dtsR1 genes, respectively. Among them, CaccB and CaccC are transcribed from the same promoter in the genome. In Escherichia coli, acetyl-CoA carboxylase is composed of four protein subunits, encoded by the EaccA, EaccB, EaccC, and EaccD genes, respectively. Among them, EaccB and EaccC are transcribed from the same promoter in the genome. Wuhan Tianyi Huayu Gene Technology Co., Ltd. was commissioned to artificially synthesize the codon-optimized CaccB, CaccC, and dtsR1 genes and construct them into two multiple cloning sites of plasmid pCDFDuet to obtain the expression vector pCDFDuet-CaccBC-dtsR1. The optimized CaccBC nucleic acid sequence is as shown in SEQ ID NO.7, and the optimized dtsR1 nucleic acid sequence is as shown in SEQ ID NO.8. Wuhan Tianyi Huayu Gene Technology Co., Ltd. was commissioned to artificially synthesize the EaccA, EaccB, EaccC, and EaccD genes, construct EaccBC into the first multiple cloning site of plasmid pCDFDuet, and ligate the 3' end of EaccA and the 5' end of EaccD through the RBS sequence (SEQ ID NO.9: TTAAGTATAAGAAGGAGATATA) to the second multiple cloning site of pCDFDuet, thereby obtaining the expression vector pCDFDuet-EaccBC-EaccAD, where the overall EaccBC nucleic acid sequence is as shown in SEQID NO.10, and the overall EaccAD nucleic acid sequence is as shown in SEQ ID NO.11.

[0073] The expression vector pCDFDuet-CaccBC-dtsR1 was separately transformed into the engineered strains TCBJ117-SbPK, TCBJ117-SlPK, and TCBJ117-MePK to obtain the strains TCBJ117-SbPK-Cacc, TCBJ117-SlPK-Cacc, and TCBJ117-MePK-Cacc. The expression vector pCDFDuet-EaccBC-EaccAD was separately transformed into the engineered strains TCBJ117-SbPK, TCBJ117-SlPK, and TCBJ117-MePK to obtain the strains TCBJ117-SbPK-Eacc, TCBJ117-SlPK-Eacc, and TCBJ117-MePK-Eacc. The empty vector pCDFDuet was separately transformed into the engineered strains TCBJ117-SbPK, TCBJ117-SlPK, and TCBJ117-MePK to obtain the control strains TCBJ117-SbPK-CK, TCBJ117-SlPK-CK, and TCBJ117-MePK-CK. The types and accumulation amounts of Ars of the above-mentioned engineered strains were detected by fermentation, and the detection results are shown in Table 4. The fermentation and detection methods were the same as those in Example 3.

[0074] After overexpressing acetyl-CoA carboxylase from Corynebacterium glutamicum in the engineered bacteria TCBJ117-SbPK, TCBJ117-SlPK, and TCBJ117-MePK containing polyketide synthase, the total accumulation amounts of alkylresorcinols increased by 9.33%, 22.1%, and 27.5% respectively. Overexpressing acetyl-CoA carboxylase from Corynebacterium glutamicum increased the supply of malonyl-CoA in the cells, thereby increasing the synthesis amount of alkylresorcinols. However, overexpressing acetyl-CoA carboxylase from Escherichia coli BL21 did not produce similar results. Instead, the accumulation amount of alkylresorcinols with longer carbon chains decreased. The overexpression of acetyl-CoA carboxylase might cause greater metabolic pressure on the strains, which was instead not conducive to the synthesis of products.

[0075] Table 4

[0076]

[0077] In summary, the present invention provides a probiotic Escherichia coli genetic engineering strain for synthesizing medium- and long-chain alkylresorcinols and a preparation method thereof. The genetic engineering strain overexpresses the polyketide synthase genes SbPK (Sorghum bicolor, XP_002449744.1), SlPK (Sporotrichum laxum, KU560627) or MePK (Micromonospora endolithica, QZS07521.1) in the original strain Nissle1917ΔattB(lacUV5-T7)ΔendAΔompT, enabling it to have the ability to synthesize alkylresorcinols. Subsequently, the supply of intracellular malonyl-CoA is increased by expressing the acetyl-CoA carboxylase gene, thereby increasing the synthesis amount of alkylresorcinols in Escherichia coli Nissle 1917. Finally, three engineering strains for synthesizing alkylresorcinols, namely TCBJ117-SbPK-Cacc, TCBJ117-SlPK-Cacc and TCBJ117-MePK-Cacc, are obtained. Among them, the total content of alkylresorcinols produced by shake-flask fermentation of TCBJ117-SlPK-Cacc reaches up to 27.17 mg / L.

[0078] In conclusion, the present invention has for the first time achieved the soluble expression of five polyketide synthases from different sources in Escherichia coli Nissle 1917, demonstrated that the polyketide synthase has the activity of catalyzing the synthesis of medium- and long-chain alkylresorcinols in Escherichia coli Nissle 1917, and further increased the synthesis amount of alkylresorcinols in the engineering strain by optimizing the synthesis pathway and increasing the supply of intracellular malonyl-CoA precursor. It provides ideas for the research on the activity and function of polyketide synthase and the metabolic engineering transformation of safe probiotic Escherichia coli to synthesize alkylresorcinols.

[0079] The applicant declares that the above is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by any person skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

[0080] References:

[0081] [1]Lei S,Siyuan W,Shuwei Z,et al.Identification of a type IIIpolyketide synthase involved in the biosynthesis of spirolaxine.[J].Appliedmicrobiology and biotechnology,2016,100(16):7103-13.

[0082] [2]Liu GY,Liu ZH.Recombinant expression of Sporotrichum laxum polyketide synthase 2 in Saccharomyces cerevisiae and fermentation production of alkylresorcinols[J].Journal of Jiangsu University of Science and Technology (Natural Science Edition),2016,30(06):627-630.

Claims

1. A genetically engineered bacterium for synthesizing alkylresorcinol, characterized in that: The genetically engineered bacteria contains an expression vector, the expression vector expresses polyketide synthase, and the initial strain of the genetically engineered bacteria is Escherichia coli Nissle 1917.

2. The genetically engineered bacterium according to claim 1, characterized in that: The initial strain is genetically modified Escherichia coli Nissle 1917; preferably, the genetic modification of Escherichia coli Nissle 1917 includes inserting a T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2 of Nissle 1917; preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the RBS downstream spacer sequence, and its 5' end is shown as SEQ ID NO.13, and the T7 RNA polymerase expression cassette sequence is shown as SEQ ID NO.

1.

3. The genetically engineered bacterium according to claim 1, characterized in that The polyketide synthase gene originates from plants or microorganisms; preferably, the sources include rye (Secale cereale), sorghum (Sorghum bicolor), Sporotrichum laxum, Nocardiafarcinica, Micromonospora endolithica, and the gene sequences are shown in SEQ ID NO.2 to SEQ ID NO.6; more preferably, the polyketide synthase gene originates from Sporotrichum laxum, and the gene sequence is shown in SEQ ID NO.

4.

4. The genetically engineered bacterium according to any one of claims 1 to 3, characterized in that: The expression of acetyl-CoA carboxylase is further enhanced in the genetically engineered bacteria; preferably, the expression of acetyl-CoA carboxylase is enhanced by an exogenous expression vector containing the acetyl-CoA carboxylase gene; preferably, the acetyl-CoA carboxylase gene is derived from Corynebacterium glutamicum and Escherichia coli; more preferably, the acetyl-CoA carboxylase gene is derived from Corynebacterium glutamicum, and the protein subunit nucleotide sequences used for the expression of acetyl-CoA carboxylase are shown in SEQ ID NO.7 and SEQ ID NO.

8.

5. A method for preparing a genetically engineered bacterium for synthesizing alkylresorcinol, the method comprising: (1) preparing an expression vector containing a polyketide synthase gene; (2) transforming the initial strain with an expression vector containing a polyketide synthase gene; Wherein, the polyketide synthase gene originates from plants or microorganisms; preferably, the sources include Secale cereale, Sorghum bicolor, Sporotrichum laxum, Nocardia farcinica, Micromonospora endolithica, and the gene sequences are shown in SEQ ID NO.2 to SEQ ID NO.6; more preferably, the polyketide synthase gene originates from Sporotrichum laxum, and the gene sequence is shown in SEQ ID NO.4; The initial strain is genetically modified Escherichia coli Nissle 1917; preferably, the genetic modification of Escherichia coli Nissle1917 includes inserting a T7 RNA polymerase expression cassette into the genome of Nissle 1917, knocking out the endA gene and the ompT gene on the genome, and knocking out the cryptic plasmids pMUT1 and pMUT2 of Nissle 1917; preferably, the T7 RNA polymerase expression cassette includes a promoter sequence, an operator sequence, an RBS sequence, a spacer sequence, and a T7 RNA polymerase sequence located downstream of the RBS downstream spacer sequence, and its 5' end is shown as SEQ ID NO.13, and the T7 RNA polymerase expression cassette sequence is shown as SEQ ID NO.

1.

6. The preparation method according to claim 5, characterized in that: The expression of acetyl-CoA carboxylase is further enhanced in the genetically engineered bacteria. Preferably, the acetyl-CoA carboxylase gene is integrated into an expression vector for enhanced expression, and the acetyl-CoA carboxylase gene is derived from Corynebacterium glutamicum or Escherichia coli.

7. The genetically engineered bacteria according to any one of claims 1 to 4, and the preparation method according to any one of claims 5 to 6, characterized in that: The expression vector is selected from one or more of pRSFDuet, pCDFDuet, pETDuet, pCOLADuet, and pACYCDuet.

8. Use of the genetically engineered bacteria prepared according to any one of claims 5-6 in the preparation of alkylresorcinol.

9. A method for preparing alkylresorcinol, characterized in that: The genetically engineered bacteria according to any one of claims 1 to 4 are inoculated into a fermentation medium, cultured, induced to express, and the fermentation product is separated and purified to obtain alkylresorcinol.

10. Use of the alkylresorcinol obtained according to claim 9 in preparing a composition, characterized in that: The composition includes medicines, health foods, special medical foods, and ordinary foods.

Images