A replicon capable of autonomous replication in trichophaea pinicola cells and application thereof

Abstract

The application discloses a replicon capable of autonomously replicating in trichophaea piniformis cells and application thereof, and belongs to the technical field of biology.The nucleotide sequence of the replicon tpARSrp is shown in SEQ ID NO.9.The application constructs a replicon tpARSrp capable of playing a replication function in a trichophaea piniformis expression system, the replicon has higher stability than AMA1 replicon, enriches a replicon element library, can be used for constructing a non-integrated expression vector of trichophaea piniformis, is used for transient expression of an exogenous gene or gene editing, provides a tool for gene editing of trichophaea piniformis, and expands the selection diversity of filamentous fungi using replicons.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a replicon capable of autonomous replication in Talaromyces pinophilus cells and application thereof. BACKGROUND

[0002] Before the discovery of the fungal autonomous replication sequence, the main defect of the filamentous fungal transformation system is that there is no plasmid similar to the plasmid that can autonomously replicate outside the yeast chromosome, resulting in low efficiency of integrated transformation. Since researchers discovered the ARS sequence in Saccharomyces cerevisiae, research on replicons has been carried out in fungi, and the AMA1 sequence containing sequence that can autonomously replicate outside the chromosome was first discovered in Aspergillus nidulans, and the sequence has also been applied to other filamentous fungi. To date, the research on the autonomous replication sequence of filamentous fungi has been slow, and therefore screening potential fungal replicons can provide certain reference value for the development of synthetic biology.

[0003] Talaromyces pinophilus has the advantages of high expression efficiency, strong secretion ability, easy high cell density culture, low product purification and recovery cost, and is suitable for large-scale industrial production, and has broad application potential in food and pharmaceutical fields. It is one of the most commonly used filamentous fungal expression hosts, even more than Trichoderma reesei. However, Talaromyces pinophilus lacks stable non-integrated plasmids in application, and the main vector for gene manipulation is still integrated plasmid. The copy number of integrated plasmid is low, and high concentration of antibiotics is usually used for screening or in vitro construction of multi-copy expression vectors without replicon. Due to the high dosage of antibiotics, the relatively complex operation, the low homologous recombination and transformation efficiency, the instability of the chromosome after integration and other problems, it is of great significance to develop a non-integrated vector that can stably exist in Talaromyces pinophilus. SUMMARY

[0004] The purpose of the present application is to provide a replicon capable of autonomous replication in Talaromyces pinophilus cells and application thereof, in order to solve the problems existing in the prior art. The present application constructs a replicon tpARSrp capable of playing a replication function in the expression system of Talaromyces pinophilus, which has higher stability than AMA1 replicon, enriches the replicon element library, can be used to construct a non-integrated expression vector of Talaromyces pinophilus, and is used for transient expression of exogenous genes or gene editing, thereby providing a tool for gene editing of Talaromyces pinophilus and expanding the selection diversity of filamentous fungi using replicons.

[0005] In order to achieve the above-mentioned purpose, the present application provides the following scheme:

[0006] The present application provides a replicon tpARSrp capable of autonomous replication in Talaromyces pinophilus cells, and the nucleotide sequence of the replicon tpARSrp is shown in SEQ ID NO. 9.

[0007] The application also provides a construction method of the replicon tpARSrp, comprising the following steps:

[0008] 1) using 30 kinds of mixed fungal genomes as templates, DNA fragmentation is performed by Tn5 transposase, 0.5-3Kb target fragments are amplified by using Mabsori-F / R primers, and the amplification products are recovered and purified;

[0009] 2) using pAN7-1 plasmid as a template, linear carrier pAN7-1 is obtained by Hind III enzyme digestion; the purified target fragments in step 1) are connected with the linear carrier pAN7-1, and cells are transformed, and plasmids are extracted;

[0010] 3) the extracted plasmids in step 2) are transformed into T. pinophilus, and positive transformants are screened by hygromycin resistance; plasmids are extracted from the positive transformants, amplified by using Hind III-F / R primers and sequenced, and the tpARS sequence is obtained;

[0011] 4) the RPL9 sequence and the DNA replication helicase sequence are added at both ends of the tpARS sequence, and the replicon tpARSrp sequence is designed; the tpARSrp-F / R primers are designed according to the replicon tpARSrp sequence; the replicon tpARSrp is amplified by using the tpARS-F / R primers and taking the T. pinophilus genome as a template.

[0012] Further, the 30 kinds of fungi are Aspergillus niger, Aspergillus oryzae, Aspergillus flavus, Aspergillus nidulans, Aspergillus fumigatus, Paecilomyces fumosaeruleus, Penicillium chrysogenum, Penicillium funiculosum, Paecilomyces variotii, Rhizopus oryzae, Rhizopus arrhizus, Rhizopus microsporus, Rhizopus homilii, Rhizopus taiwanensis, Ganoderma lucidum, Trichoderma virens, Trichoderma longibrachiatum, Trichoderma koningii, Trichoderma reesei, Trichoderma harzianum, Mucor circinelloides, Mucor mucedo, Geotrichum candidum, Geotrichum agryae, T. pinophilus, T. funiculosum, Beauveria bassiana, Chaetomium globosum, Aspergillus aculeatus and Fusarium solani.

[0013] Further, the sequence of the Mabsori-F / R primers is shown in SEQ ID NO. 1-2; the sequence of the Hind III-F / R primers is shown in SEQ ID NO. 5-6; and the sequence of the tpARSrp-F / R primers is shown in SEQ ID NO. 10-11.

[0014] The application also provides application of the replicon tpARSrp in construction of a T. pinophilus non-integrated expression vector.

[0015] The application also provides a construction method of a T. pinophilus non-integrated expression vector, wherein the T. funiculosum promoter P TFtru and the Trichoderma reesei terminator Tcbh1 The seamless cloning is carried out on the starting plasmid to obtain an integrated plasmid; the replicon tpARSrp is seamlessly cloned upstream of the promoter of the integrated plasmid to construct the non-integrated expression vector of T. pubescens.

[0016] Optionally, the starting plasmid comprises a pAN7-1 plasmid.

[0017] Further, the T. pubescens promoter P TFtru has a nucleotide sequence as shown in SEQ ID NO. 12; and the T. reesei terminator T cbh1 has a nucleotide sequence as shown in SEQ ID NO. 13.

[0018] The application further provides application of the replicon tpARSrp in preparation of a T. pubescens gene editing vector.

[0019] The application further provides application of the replicon tpARSrp in preparation of a T. pubescens exogenous gene expression vector.

[0020] The application discloses the following technical effects:

[0021] The application constructs a replicon tpARSrp capable of playing a replication function in a T. pubescens expression system, the replicon has higher transformation efficiency and stability than AMA1 replicon, enriches a replicon element library, provides a tool for gene editing of T. pubescens, and expands the selection diversity of replicon used by filamentous fungi.

[0022] The application further constructs a non-integrated vector capable of stably existing in T. pubescens, the non-integrated vector takes the tpARSrp as a replicon, contains an expression frame of the T. pubescens promoter P Tftru and the T. reesei terminator T cbh1 Compared with a commercial integrated vector, the non-integrated vector does not need linearization treatment, is more convenient to operate, and also makes subsequent gene operation more simple, thereby providing a more efficient and convenient genetic operation tool for a T. pubescens secretion expression system. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only constitute some embodiments of the application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative labor.

[0024] Figure 1 A map of the non-integrated expression vector plasmid pamyTP03 of T. pubescens.

[0025] Figure 2 Example 1: Expression of α-amylase by TVARS and TPARS rp as non-integrative vector DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present application will now be described in detail, with reference to the figures. The detailed description is merely intended to teach a person of ordinary skill in the art how to make and use the best mode of the present application and is not intended to limit the scope of the application. Therefore, specific structural and functional details disclosed herein are not to be interpreted in a manner that would limit the scope of the present application.

[0027] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, for a range of values of a parameter, unless otherwise stated, each intervening value by each intervening value, as well as any other stated or intervening value in that stated range is encompassed. In addition, any combination of the above-described values and ranges are included within the scope of the present application. The above-described exemplary embodiments are presented for purposes of illustration and description only. They are not intended to limit the scope of the present application in that the scope of the present application is limited only by the claims.

[0028] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference in their entirety for the disclosure and

[0029] Many modifications and variations of this application can be made in the light of the above teachings without departing from the spirit and scope thereof, and it is to be understood that all such modifications and variations warrant the patentable subject matter under the patent laws. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only and are not intended to be limiting.

[0030] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0031] The strains and culture conditions used in the following examples of the present application are shown in Table 1.

[0032] Table 1: Fungal species and culture conditions

[0033]

[0034]

[0035] The experimental methods used in the following examples of the present application are well known in the art, unless otherwise specified.

[0036] Example 1

[0037] 1. Fungal culture and genome extraction

[0038] (1) Fungal culture

[0039] The strains described in Table 1 were taken out from the -80°C refrigerator, naturally thawed on ice in a clean bench, and streaked on PDA solid medium with a loop dipped in the bacterial liquid. The culture was incubated in the dark according to the culture conditions described in Table 1 until single colonies grew. Part of the bacterial body was taken and mixed in sterile water by blowing, and 100 μL of the bacterial suspension was inoculated on PDA solid medium and incubated in the dark until the Petri dish was covered with mycelium. The Petri dish was stored in a 4°C refrigerator.

[0040] (2) Fungal genome extraction method

[0041] The cultured fungal mycelium was used as a template to extract the genome. The specific steps refer to the instructions of TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver. 5.0 (Takara No. 9765).

[0042] 2. Library construction

[0043] The vector plasmid pAN7-1 was single-cut with Hind III to obtain linear vector pAN7-1. This plasmid carries E. coli selection gene ampicillin and fungal selection gene hygromycin B for the selection of positive transformants. Tn5 transposase is a mutant of Tn5 transposase derived from E. coli with high activity, which can efficiently insert Tn5 transposon into target sequences. It has high transposition efficiency for DNA of eukaryotes and prokaryotes. Tn5 transposase specifically recognizes DNA fragments containing chimeric end sequences at both ends, forms Tn5 transposome, which can randomly bind to target DNA and cut and insert the DNA fragments carried by it.

[0044] First, the fungal genome was fragmented. The most widely used fragment conversion enzyme Tn5 (Huawmei Bio CSB-DEM076) was used, which binds to the inverted IS50 sequence outer end at both ends of the Tn5 transposon to form a two-transposase outer end (Tnp-OE) complex. After the complex associates, it randomly inserts double-stranded DNA to fragment the genome. According to the principle of homologous complementation, the primers were designed and connected by Infusion method, and the Tn5 library was obtained by transforming super-competent cells. The specific operation steps are as follows:

[0045] (1) Obtain pAN7-1 linear vector

[0046] The E. coli strain containing plasmid pAN7-1 was taken out from the -80°C refrigerator, and a small amount of bacterial liquid was streaked on an LB solid plate containing ampicillin resistance (working concentration 50 μg / mL) and incubated at 37°C overnight. A single colony was picked and inoculated in 3 mL of LB liquid medium (ampicillin resistance 50 μg / mL) in a shaking tube, which was placed in a shaking bed at 37°C and shaken at 220 rpm for 16 h. According to the 1‰ inoculation amount, 80 mL of LB liquid medium (ampicillin resistance 50 μg / mL) was inoculated in a triangular flask, which was incubated at 37°C and shaken at 220 rpm for 16 h, and then used for plasmid extraction. The plasmid extraction method refers to the TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0 (Takara No. 9760) kit instructions.

[0047] According to the restriction enzyme QuickCut TM Hind III (Code No. 1615) instructions, 10x QuickCut Buffer 5 μL, Plasmid DNA 2 μg, QuickCut Hind III 2 μL, ddH2O to 50 μL; the above prepared system was mixed and centrifuged, incubated at 37°C for 2 h in a PCR instrument, and the whole enzyme digestion product was added with 10x Loading Buffer to a final concentration of 1x, and was loaded into a 1% agarose gel well, electrophoresed at 110V for 20 min, and the target band was cut off with DNA Marker-Wide-Range DNA Ladder (Takara No. 3415A) as a reference. The gel recovery kit TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Takara No. 9762) was used to purify and recover the gel recovery product to obtain the linear vector pAN7-1.

[0048] (2) Target fragment acquisition

[0049] Using 30 kinds of fungal mixed genomes as templates, Tn5 transposase (Huawmei Biological CSB-DEM076) was added to disrupt the genome, and the reaction system was as follows: template 2 μg, Tn5 transposase 0.2 U, Tn5 Buffer 10 μL, ddH2O to 50 μL, blow and mix, centrifuge briefly, and incubate at 55°C for 30 sec in a PCR instrument; mix 10 μL of the reaction system with 10 μL of ddH2O, incubate at 95°C for 10 min in a PCR instrument, and place on ice for standby.

[0050] The genomic fragment is amplified by Mabsori-F / R primer, which contains sequencing adapter M1 / M2 sequence and 15bp sequence homologous to both ends of linear vector Hind III enzyme cutting site, so as to realize seamless connection of target fragment and vector. The amplification system is as follows: template DNA 5 μL, PrimeSTAR GXL DNA Polymerase (1.25 U / μL) 3 μL, 5×PrimeSTAR GXL Buffer (Mg 2+ plus) 10 μL, dNTP Mixture (2.5 mM each) 8 μL, Mabsori-F (10 μM) 2.5 μL, Mabsori-R (10 μM) 2.5 μL, ddH2O supplemented to 50 μL; after mixing and centrifuging, the system is placed in a PCR instrument, and the amplification program is as follows: 1) 98 ℃ pre-denaturation for 5 min; 2) 94 ℃ denaturation for 1 min; 3) 61 ℃ annealing for 45 sec; 4) 72 ℃ extension for 70 sec; 5) repeat steps 2-4 for 32 times; 6) 72 ℃ extension for 10 min; 7) 4 ℃, 15 min. After the PCR reaction is completed, all the products are loaded into agarose gel holes, Takara 250 bp DNA Ladder Marker is used as a reference, and the DNA fragment purification kit TaKaRa MiniBEST DNA Fragment Purification Kit Ver.4.0 (Takara No.9761) is used to purify and recover the 0.5-3 Kb size gel recovery product.

[0051] The primer sequences used above are as follows:

[0052] Mabsori-F: 5'-TTGCAGCACATCCCCAAGCTTTCGTCGGCAGCGT-3', SEQ ID NO.1;

[0053] Mabsori-R: 5'-GTCTCGTGGGCTCGGAAGCTTGCCAGCTGGCGA-3', SEQ ID NO.2;

[0054] M1: 5'-ACCTGCAGGCATGC-3', SEQ ID NO.3;

[0055] M2: 5'-ACGACGGCCAGTGCC-3', SEQ ID NO.4.

[0056] (3) Connection transformation

[0057] The 0.5-3 Kb fragments recovered from the gel were connected to the purified pAN7-1 linear carrier by In-Fusion Snap Assembly. The reaction system was prepared according to the In-Fusion Cloning Reagent In-Fusion HD Cloning Plus (Takara No. 638918) kit instructions. The inserted fragments and linearized vectors were added to the system at a molar ratio of 3:1. The inserted fragments were calculated at 3 Kb. The reaction system was: 5x In-Fusion HD Enzyme Premix 5 μL, pAN7-1 linearized vector 1 μg, recovered 0.5-3 Kb PCR fragments 2 μg, Cloning Enhancer 3 μL, ddH2O to 25 μL. The system was mixed and centrifuged, and then placed in a PCR instrument. The system was preheated at 37°C for 15 min, incubated at 50°C for 15 min, and terminated at 4°C for 5 min.

[0058] In order to improve the transformation efficiency, Stellar competent cells (Takara No. 636765) were used for electroporation. Compared with the traditional calcium chloride method for preparing competent cells, the transformation efficiency of super-competent cells can be increased by 2 orders of magnitude. 10 μL of the ligation system was transformed into Stellar competent cells (Takara No. 636765), mixed and transferred to a 1 mm shock cup. The shock cup was shocked at 1.5 kV, 25 μF, 200 Ω, 1 mL of pre-cooled SOC medium was added, and the shock cup was incubated at 160 rpm on a shaker for 1 h. Then, an LB solid plate containing ampicillin resistance (50 μg / mL) was coated, and the plate was incubated in a 37°C constant temperature incubator overnight until single colonies grew. Random single colonies were picked and the ligation efficiency was verified by Hind III-F / R primers.

[0059] The primer sequences used above are as follows:

[0060] Hind III-F: 5'-TCCCCAAGCTTGGGCGTCGATCAAGG-3', SEQ ID NO. 5;

[0061] Hind III-R: 5'-TCGGAAGCTTAATCCCTCGGAAGTAA-3', SEQ ID NO. 6.

[0062] (4) Plasmid extraction

[0063] The ligation system was scaled up to transform Stellar competent cells. All single colonies were scraped with 500 mL of LB liquid medium containing ampicillin resistance (100 μg / mL), and incubated in a 37°C constant temperature incubation shaker at 220 rpm for several hours until the OD600 = 0.2, large-scale plasmid extraction refers to the instructions of GeneJET Endo-Free Plasmid Maxiprep Kit (Thermo Fisher K0861) without endotoxin plasmid large-scale extraction kit.

[0064] (5) Library construction results

[0065] The size of the target fragment is affected by the Tn5 treatment time, Tn5 dosage and amplification cycle number. The larger the dosage and the longer the treatment time, the smaller the target fragment. In order to maximize the content of the target fragment, the amplification cycle number, Tn5 dosage and Tn5 treatment time were optimized, and the amount of 0.5-3Kb fragment was observed by agarose gel electrophoresis. Under the optimal conditions of Tn5 dosage of 0.1U, treatment time of 40 seconds and cycle number of 36 cycles, the size of the amplified fragment was the most in the range of 0.5-3Kb.

[0066] The optimal conditions were used to fragment 30 fungal genomes, seamlessly connect with linearized vectors and transform Stellar electrotransformation competent cells. Twelve single colonies were randomly picked to verify the ligation efficiency with Hind III-F / R primers. The pAN7-1 vector Hind III-F / R primer amplification band was 178bp, and among the 18 single colonies, 10 bands were more than 255bp, between 500bp and 3Kb. The reaction system was scaled up to 800μL, and about 12500 single colonies were obtained and large-scale plasmid extraction was performed, and stored at -20℃.

[0067] 3. Screening of transformants

[0068] (1) Preparation of reagents and media

[0069] ① 0.8M NaCl solution: 46.8g NaCl was dissolved in 1000mL double distilled water, and after constant volume, it was subjected to conventional high temperature sterilization;

[0070] ② 1M Tris-Cl: 121.14g Tris was dissolved in 600mL double distilled water, and the pH was adjusted to 7.5 with concentrated hydrochloric acid, then double distilled water was added to 1L, and it was subjected to conventional high temperature sterilization for standby;

[0071] ③ Cell wall degrading enzyme solution KNY solution: 20mg Yatalase (Takara Bio) and 100mg Lywallzyme were weighed on the balance and dissolved in 10mL 10mM KH2PO4 and 0.8M NaCl solution. Filtered with a filter membrane with a diameter of 0.22μm to remove bacteria, and used immediately;

[0072] (4) STC solution: weigh 21.8604 g of sorbitol, 0.735 g of calcium chloride, and dissolve in about 60 mL of water, then add 1 mL of prepared 1M Tris-Cl, and then make up to 100 mL;

[0073] (5) Potato dextrose agar medium (PDA): cut 200 g of potatoes into small pieces, boil in water for 15 min, then filter through 2 layers of gauze, discard the potato pieces, add 20 g of glucose and 20 g of agar to the filtrate, make up to 1000 mL with distilled water, and then perform routine high-temperature sterilization;

[0074] (6) Potato dextrose broth (PDB): cut 200 g of potatoes into small pieces, boil in water for 15 min, then filter through 2 layers of gauze, discard the potato pieces, add 20 g of glucose to the filtrate, make up to 1000 mL with distilled water, and then perform routine high-temperature sterilization.

[0075] (2) Preparation of Talaromyces pinophilus protoplasts

[0076] (1) Incubation: inoculate Talaromyces pinophilus strain onto PDA plates, incubate at 28°C for 5 days, then use a toothpick to pick 5 pieces and inoculate into 100 mL of YPD liquid medium (2% tryptone, 0.5% yeast extract, and 2% glucose), and incubate at 28°C for 36 h;

[0077] (2) Collection: in a clean bench, filter the mycelium through 4 layers of gauze, then rinse the mycelium with 0.9% NaCl 3 times, and dry the water with sterilized filter paper and absorbent paper;

[0078] (3) Enzymatic digestion: weigh 1 g of mycelium into a 50 mL sterilized centrifuge tube, add 10 mL of prepared cell wall degrading enzyme solution KNY, and shake at 80 rpm on a shaker at 28°C for 3.5 h until the mycelium is completely converted to protoplasts under a microscope;

[0079] (4) Filtration: filter the enzyme solution through 2 layers of sterilized lens paper, then rinse the protoplasts remaining on the lens paper with 0.8M NaCl 2 times, each time with 10 mL. Remove the residue and transfer the filtrate to a 50 mL centrifuge tube, and centrifuge at 5000 rpm for 10 min at 4°C;

[0080] (5) Washing: carefully discard the supernatant, add 15 mL of STC solution, and gently shake the centrifuge tube to suspend the precipitate; place the 50 mL centrifuge tube in the centrifuge, and centrifuge at 3000 rpm for 10 min at 4°C;

[0081] (6) Resuspension: Carefully discard the supernatant, add 1 mL STC solution, gently shake the centrifuge tube to suspend the precipitate, and obtain the protoplasts, which are then aliquoted into sterilized 1.5 mL centrifuge tubes, 100 μL per tube, and stored at 80°C for later use.

[0082] (3) Transformation of T. placenta protoplasts

[0083] (1) 10 μg plasmid is added to 100 μL protoplast cells, and the mixture is placed on ice for 5 min;

[0084] (2) 400 μL PTC solution (40% PEG4000, 10 mM Tris-HCl pH 7.5, 10 mM CaCl2) is added, and the mixture is placed on ice for 60 min, followed by the addition of 8.5 mL STC solution, mixing, and centrifugation at 3000 rpm for 10 min;

[0085] (3) After centrifugation, the protoplast-plasmid mixture is resuspended in 5 mL STC solution, centrifuged at 4000 rpm for 10 min, and finally resuspended in 100 μL STC solution;

[0086] (4) The protoplast-plasmid mixture is spread on a regeneration plate YPDA (1% yeast extract, 1% tryptone, 1 M sucrose, 2% agar), and incubated at 25°C for 24 h;

[0087] (5) The concentration of hygromycin B is added to 500 μg / mL in a 0.2% agar YPD medium, which is then mixed and uniformly spread on the above-mentioned overnight culture plate. After complete absorption, the plate is incubated at 28°C for 3-5 d.

[0088] (4) Screening of T. placenta transformants

[0089] T. placenta grows slowly, and the colony diameter is 5 mm after 3 d of incubation at 28°C, and 26 mm after 5 d of incubation. The colony is white and fluffy, and then turns dark green, with a yellowish concentric ring on the back. Microscopic observation shows that the mycelium has a cross-septate structure of spore pustules, which are broom-like. The top of the spore pustule produces 5-7 small stems, and the top produces spores. The spores are spherical or subspherical, with a diameter of 2.5-3.5 μm.

[0090] The colony growth was observed after growing on YPD medium plate for 4 days, and when the single colony of S. flocculosa grew on the plate, part of the mycelium was picked up in lysis buffer for microorganism to direct PCR (Takara No. 9164) at 85°C for 15 min as a template, and the INpAN7-F / R primer was used for colony PCR to preliminarily verify the hygromycin fragment, and if the transformant had a correct band, part of the single colony was picked up in ddH2O to obtain a bacterial suspension, and 100 μL of the suspension was spread on YPD solid medium containing hygromycin B (working concentration 500 μg / mL) for expansion culture, and glass paper was laid on the culture medium to facilitate the collection of mycelium. The mycelium was cultured at 28°C in the dark for 2 days until the glass paper was covered with mycelium, and the appropriate amount of mycelium was picked up with a gun head, and the plasmid was extracted according to the instructions of the yeast plasmid extraction kit Zymoprep Yeast Plasmid Miniprep II (Jianshi Bio D2004).

[0091] The primer sequences used above are as follows:

[0092] INpAN7-F: 5'-GGGCGAAGAATCTCGTGCTTTC-3', SEQ ID NO. 7;

[0093] INpAN7-R: 5'-CCACGGCCTCCAGAAGAAGATG-3', SEQ ID NO. 8.

[0094] The extracted plasmid was used as a template, the Hind III-F / R primer was used to amplify the target fragment, 1% agarose gel electrophoresis was used for verification, the PCR product with a band was sent to Sanger of Shengong Bioengineering Company for sequencing, and the new replicon sequence was obtained, and the positive transformant was continued to be transferred to YPD plates containing hygromycin resistance for several times to verify whether the replicon had replication function, and if the band was correct after several transfers, the positive transformant genome was used as a template, and the Mabsori-F / R primer was used to amplify the new replicon fragment, and the In-Fusion cloning reagent was connected with the linear carrier of pAN7-1 to construct a plasmid with a new replicon.

[0095] The positive transformant screened was treated for preservation: part of the mycelium of the positive transformant was picked up in ddH2O to obtain a mycelium suspension, the inoculation ring was dipped in the bacterial suspension, and the solid YPD medium (containing 500 μg / mL of hygromycin) was streaked, and the culture was carried out at 28°C in the dark until white fluffy mycelium grew, 10% sterilized glycerol was gently scraped and washed on the plate, and was stored in a 1.5 mL centrifuge tube at -80°C.

[0096] 4. Screening and improvement of replicon

[0097] The Tn5 library plasmid obtained by Tn5 transposase method was transformed into T. pinophilus, and 18 transformants were obtained. The target gene was amplified by primer Hind III-F / R, and only sample No. 6 and No. 9 had a band of about 500 bp. Sample No. 9 was subjected to Sanger sequencing, and the inserted sequence was 459 bp. After sequence alignment by NCBI database Blast, it was found that the sequence was not similar to AMA1, and the similarity with the mitochondrial sequence gene of Trichoderma viride was 96.7%, and the GC content was 26.7%. It was a new sequence, and the above sequence was named tvARS. The PCR product of sample No. 6 was subjected to Sanger sequencing, and the inserted sequence was 532 bp. After sequence alignment by NCBI database Blast, it was found that the sequence was not similar to AMA1, and the similarity with Talaromyces pinophilus strain 1-95 genome was 98.3%, and the GC content was 18%. It was a new sequence, and the above 532 bp sequence was named tpARS.

[0098] The tvARS and tpARS were respectively cloned into pAN7-1 vector to obtain new plasmids pAN71-tvARS and pAN71-tpARS. Meanwhile, the replicon AMA1 was cloned into pAN7-1 vector to obtain plasmid pAN71-AMA1. In order to compare the transformation efficiency of different replicons on T. pinophilus, different plasmids (pAN71-tvARS, pAN71-tpARS and pAN71-AMA1) were respectively used for protoplast transformation of T. pinophilus (CICC 40341) at the dosage of 2 μg, 5 μg and 10 μg. The transformation results showed that pAN71-AMA1 had the best transformation effect at the plasmid dosage of 10 μg, and the highest record could grow 12 transformants. pAN71-tvARS had the best transformation effect at the plasmid dosage of 6 μg, and the highest record could grow 106 transformants. pAN71-tpARS had the best transformation effect at the plasmid dosage of 2 μg, and the highest record could grow 153 transformants. In order to confirm the stability of tpARS replicon again, pAN71-tpARS plasmid was subjected to multiple protoplast transformation, but the repeated experimental results were unstable. Sequence analysis showed that, compared with the special structure of AMA1, tpARS had no inverted repeat structure and other special structures, and the sequence was relatively short and insufficient to maintain its stable replication function in T. pinophilus.

[0099] Because the pAN71-tpARS plasmid transformation effect is unstable, therefore attempt to add part of RPL9 sequence and DNA replication helicase sequence at both ends of tpARS sequence, get new sequence tpARSrp, new sequence contains complete RPL9 and DNA replication helicase sequence. According to tpARSrp and linear carrier design connection primer tpARSrp-F / R, with the genome of T. pinophilus (CICC40341) as template to amplify tpARSrp fragment, get 1.0Kb fragment, and clone it to pAN7-1 linear carrier, get new plasmid pAN71-tpARSrp and protoplast transform T. pinophilus, grow 3180 transformants after transformation, verify the transformants with Hind III-F / R primer, there is 1.1Kb band, sequence the PCR product; Sequence results show that the full length of tpARSrp is 1079bp, after NCBI comparison, found that 475bp base has 96% similarity with CICC 40341 DNA helicase, 210bp base has 88% sequence similarity with CICC40341 RPL9, at 240-250bp (bold) and 487-497bp (bold) respectively consistent with ARS conservative sequence, no special structure. Helicase plays an important role in DNA replication, repair, recombination and transcription metabolic process, combined with nucleotide, in the form of hairpin structure, has RNA binding ability, can maintain DNA stability or promote its translation, affect cell metabolism from editing, cutting and other aspects.

[0100] The sequence of tpARSrp is as follows:

[0101]

[0102] The primer sequences used above are as follows:

[0103] tpARSrp-F: 5'-CATCCCCTTTATATTATTAATTAT-3', SEQ ID NO. 10;

[0104] tpARSrp-R: 5'-CTGGCGAAAGTTTATTAATTTTA-3', SEQ ID NO. 11.

[0105] Example 2 Construction of non-integrative expression vector of Talaromyces pinophilus

[0106] 1. Construction of non-integrative plasmid with two different replicons

[0107] Optimized promoter P from Talaromyces funiculosus CICC 41743 genome TFtru and optimized terminator T from Trichoderma reesei CICC2626 genome cbh1 were synthesized by Shanghai Generay.

[0108] Talaromyces funiculosus promoter P TFtru The sequence is as follows:

[0109]

[0110] Trichoderma reesei terminator T cbh1 The sequence is as follows:

[0111] ggctttcgtgaccgggcttcaaacaatgatgtgcgatggtgtgattcccggttggcggagtctttgtctactttggttgtctgtcgcaggtcggtagaccgcaaatgagcaactgatggattgttgccagcgatactataattcacatggatggtctttgtcgatcagtagctagtgagagagagagaacatctatccacaatgtcgagtgtctattagacatattccgagaataaagtcaaccgtgtctgtgatctaaagatcgattcggcagtcgagtagcgtataacaactccgagtaaccagcaaaagcacgtcgtgacaggagcagggctttgccaactgcgcaaccttgcttgaatgaggatacacgggttgcaacatggctgtactggtccatcgcaaccaaaatttctgtttatagatcaagctggtagattccaattcctccacctcttgcgcttctacatgacatgtaagtgcacgtggaaaccatacccaaattgcctacagctgcggagcatgagcccatggcaatcagtctggtcatgttaaccagcctgtgctctgacgttaatgcagaatagaaagccgcggttgcaatacaaatgatgatgcctttgcagaaatggcttgctcgctgactgataccagtaacaactttgcttggacgtctagcgctgttgattgtattcatcac (SEQ ID NO. 13).

[0112] The pAN7-1 was used as the starting plasmid, and the Trichoderma reesei promoter P TFtru and the Trichoderma reesei terminator T cbh1 were sequentially cloned into the pAN7-1 by seamless cloning. After verification by PCR and confirmation by sequencing, the episomal vector pTP001 containing the promoter P TFtru and the terminator T cbh1 was obtained.

[0113] 2 kinds of autonomous replication sequences are tvARS from Trichoderma viride and tpARSrp from S. piceum genome optimized by Shanghai Generayx Biotech. Co., Ltd. On the basis of the episomal vector pTP001, tvARS and tpARSrp were cloned into pTP001 respectively, and after PCR verification and sequencing confirmation, 2 kinds of episomal vectors containing ARS, pTP002 and pTP003 were obtained.

[0114] 2. Construction of amylase expression plasmid

[0115] The primer amyS-F / R was used to clone the size of 1632 bp of Aspergillus fumigatus alpha-amylase gene (amyS) with the genome of Aspergillus fumigatus as the template. After the two non-integrated vectors pTP002 and pTP003 and the integrated vector pTP001 were digested with Pas I and Xba I respectively, they were assembled with the amylase gene amyS. After PCR verification and sequencing confirmation, 3 kinds of amylase gene expression vectors, pamyTP01, pamyTP02 and pamyTP03 were obtained. Among them, the vector map of pamyTP03 is shown in Figure 1 .

[0116] amyS-F: 5'-GCTGCTCCTTTTAATGGAACAATG-3', SEQ ID NO. 14;

[0117] amyS-R: 5'-CATTAAGGCCAAGCAACTAATCTTG-3', SEQ ID NO. 15.

[0118] 3. Functional verification of non-integrated plasmid

[0119] The pTP001, pTP002, pTP003, pamyTP01, pamyTP02 and pamyTP03 vectors were transformed into S. piceum strain for functional verification. The strains and plasmids involved in this verification process are shown in Table 2.

[0120] Table 2 Characteristics of strains and plasmids

[0121]

[0122] After 3 generations of continuous subculture of two strains (TP002 and TP003) containing non-integrated vectors (pTP002 and pTP003) in non-resistant YPD liquid medium, the culture liquids of the 1st, 2nd and 3rd generations were respectively inoculated on non-resistant YPD solid medium to obtain single colonies. The single colonies were respectively diluted and printed on non-resistant solid medium YPD and solid medium YPDH containing hygromycin. It was found that the two strains containing two free plasmids could grow on YPD medium and could not grow on YPDH medium. This indicated that the two plasmids were lost during the continuous subculture in non-resistant YPD liquid medium and were not integrated into the chromosome but existed in free form. That is, when the two replicons tvARS and tpARSrp were used as plasmid backbones, the plasmids could exist in free form in T. pinophilus.

[0123] The two strains (YTP02 and YTP03) containing non-integrated vectors (pamyTP02 and pamyTP03) were respectively continuously subcultured in resistant medium YPDH. The plasmids of the 10th generation were extracted using a kit. It was found that the two plasmids could stably exist in T. pinophilus cells after 10 generations of subculture in resistant medium.

[0124] The two strains (YTP02 and YTP03) containing non-integrated vectors (pamyTP02 and pamyTP03) were subcultured in non-resistant liquid medium YPD. The samples of each generation were left. The left sample was diluted and then inoculated on non-resistant solid medium YPD and solid medium YPDH containing hygromycin, respectively, to obtain single colonies which were then counted to calculate the plasmid loss rate. The results are shown in Table 3.

[0125] Table 3 Plasmid loss rate

[0126]

[0127] As shown in Table 3, the loss rate of the plasmid containing the tpARSrp replicon in the 1st and 2nd generations was significantly higher than that of the plasmid containing the tvARS replicon, but the plasmids of both were lost in the 3rd generation. This indicates that the two replicons can quickly lose plasmids and can be used as gene editing tools for T. pinophilus.

[0128] 4. Expression of amylase by non-integrated vector

[0129] After the three plasmids pamyTP01, pamyTP02 and pamyTP03 were introduced into T. pinophilus strains with a-amylase as a reporter protein, strains with larger amylase hydrolysis rings in physiological experiments were selected for shake flask fermentation. The supernatant was subjected to enzyme activity determination to compare the protein expression of different replicons. The results are shown in Table 4. Figure 2 Table 4 Protein expression of different replicons Figure 2It can be seen that the enzyme activity of all strains reaches the highest at 48h, and the strains YTP02 and YTP03 containing non-integrated plasmid have higher α-amylase enzyme activity than the strain YTP01 containing integrated plasmid, wherein the enzyme activity of the strain YTP03 carrying replicon tpARSrp is 6 times of that of the integrated strain YTP01, and 3 times of that of the strain YTP02 containing replicon tvARS.

[0130] In conclusion, the application uses integrated expression vector pAN7-1 as the starting plasmid, uses tpARSrp as the replicon, uses the expression frame containing Talaromyces funiculosus promoter P Tftru and Trichoderma reesei terminator T to construct the plasmid and strain for expressing α-amylase by using non-integrated vector. cbh1 It is found that there is no stable non-integrated plasmid in Talaromyces pinophilus, compared with the commercial integrated vector, the non-integrated vector does not need linearization treatment, and the experimental operation is more convenient, and the strain containing replicon tpARSrp which can autonomously replicate in Talaromyces pinophilus cells has higher protein yield and transformation efficiency.

[0131] The above-described embodiments are only used to describe the preferred modes of the application, and do not limit the scope of the application, and various modifications and improvements to the technical solutions of the application made by those skilled in the art without departing from the design spirit of the application shall fall within the protection scope of the claims of the application.

Claims

1. A replicon tpARSrp capable of autonomous replication within a T. pinophilus cell, characterized in that, The nucleotide sequence of the replicon tpARSrp is shown as SEQ ID NO.

9.

2. Use of the replicon tpARSrp in claim 1 in constructing a non-integrative expression vector of T. pinophilus.

3. A method for constructing a non-integrative expression vector of Talaromyces pinophilus, characterized by, The Phanerochaete chrysosporium promoter P TFtru and the Trichoderma reesei terminator T cbh1 Seamless cloning into the starting plasmid results in an integrative plasmid; The replicon tpARSrp in claim 1 is seamlessly cloned upstream of the promoter of the integrative plasmid to construct the non-integrative expression vector of T. pinophilus. The nucleotide sequence of the said cordate-shaped basket fungus promoter P TFtru is shown as SEQ ID NO.

12.

4. The construction method according to claim 3, characterized in that, The starting plasmid comprises a pAN7-1 plasmid.

5. The construction method of claim 3, wherein, The Trichoderma reesei terminator T cbh1 The nucleotide sequence of the Trichoderma reesei terminator T cbh1 is shown in SEQ ID NO.

13.

6. Use of the replicon tpARSrp in claim 1 in preparing a T. pinophilus gene editing vector.

7. Use of the replicon tpARSrp in claim 1 in preparing a T. pinophilus exogenous gene expression vector.

Images