SNP molecular markers related to wheat appearance quality and their applications

Abstract

This invention relates to the field of genetic engineering technology, and more particularly to a SNP molecular marker related to wheat appearance quality and its application. The SNP molecular marker described in this invention contains a nucleotide sequence with a polymorphism of C or T at position 767257977 bp on wheat chromosome 2A. This invention has determined that this site is a polymorphic site affecting grain length and protein content, and has designed a specific KASP primer combination to achieve rapid and accurate identification of wheat grain length and protein content.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to an SNP molecular marker related to wheat appearance quality and its application. Background Technology

[0002] wheat( Triticum aestivum L. Wheat, as a widely cultivated food crop globally, has a significant impact on food security due to its abundant planting area and high yield. The quality of wheat mainly includes processing quality and nutritional quality, with nutritional quality primarily referring to grain protein content. Breeders are strengthening quality breeding alongside yield breeding, as people's diets are gradually shifting from simply wanting to eat enough to prioritizing health. Therefore, increasing the protein content of wheat is one of the important goals in breeding and agricultural production. Exome sequencing is a technique that uses sequence capture technology to capture and enrich DNA from the exon regions of the entire genome, followed by high-throughput sequencing to discover genetic mutations related to protein function variations. Compared to whole-genome sequencing, exome sequencing is more economical and efficient, offering significant advantages for studying known variant sites, insertions, and deletions. KASP (Kompetitive Allele Specific PCR) technology is a molecular marker method based on SNP sites, highly favored in genotyping due to its high stability, accuracy, and economy. It is particularly suitable for high-throughput analysis, especially when processing large numbers of samples but having limited available SNP sites. The application of KASP technology has not only improved the speed and efficiency of genotyping but also reduced costs, making it a promising candidate for applications in agricultural breeding, genetic research, and molecular diagnostics. Currently, SNP markers related to wheat protein content require further development. Therefore, this invention is proposed. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides an SNP molecular marker related to plant appearance quality, along with its KASP primer combination and application.

[0004] Specifically, the technical solution of the present invention is as follows:

[0005] In a first aspect, the present invention provides an SNP molecular marker related to the appearance quality of plants, wherein the SNP molecular marker contains a nucleotide sequence with a polymorphism of C or T at 767257977 bp on wheat chromosome 2A.

[0006] The SNP molecular marker provided by this invention is related to the appearance quality of plants, especially to the grain length and protein content of wheat, and is a pleiotropic site.

[0007] Preferably, plants with the CC genotype at the polymorphic locus have longer seeds and higher protein content compared to plants with the TT genotype.

[0008] Secondly, the present invention provides a KASP primer combination for amplifying the SNP molecular marker, comprising forward primer 1, forward primer 2 and reverse primer; the nucleotide sequence of forward primer 1 comprises the nucleotide fragment shown in SEQ ID NO. 01; the nucleotide sequence of forward primer 2 comprises the nucleotide fragment shown in SEQ ID NO. 02; and the nucleotide sequence of reverse primer comprises the nucleotide fragment shown in SEQ ID NO. 03.

[0009] Thirdly, the present invention provides a detection reagent or kit for detecting the appearance quality of plants, the kit comprising the KASP primer combination.

[0010] Fourthly, the present invention provides a method for identifying the high protein content of plants, comprising: using the DNA of the plant sample to be tested as a template, performing PCR amplification using the KASP primer combination or the detection reagent or kit, and determining the protein content of the plant sample to be tested based on the amplification results.

[0011] Preferably, determining the protein content of the plant sample to be tested based on the amplification results includes: analyzing the genotype of the polymorphic site located at 767257977 bp on wheat chromosome 2A in the amplification product, and plants with genotype CC have higher protein content than plants with genotype TT.

[0012] Preferably, the plant is wheat.

[0013] Preferably, the PCR amplification system, based on a total system volume of 10 μL, comprises: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder being water; the primer mixture, based on a total volume of 100 μL, comprises: 10-14 μL of 100 μM forward primer 1, 10-14 μL of 100 μM forward primer 2, 10-14 μL of 100 μM reverse primer, and the remainder being water.

[0014] Preferably, the PCR amplification reaction program is as follows: 95℃, 8~12min; 95℃, 15~25s, 61℃, 60s, 8~12 cycles, with the annealing temperature decreasing by 0.5℃~0.7℃ in each cycle; 95℃, 15~25s, 55℃, 35~45s, 32~36 cycles; 25℃, 10~20min.

[0015] Fifthly, the present invention provides any of the following applications of the SNP molecular marker, the KASP primer combination, or the detection reagent or kit:

[0016] (1) Used for the identification, selection and improvement of wheat protein content;

[0017] (2) Used for early prediction of wheat quality traits;

[0018] (3) Used in marker-assisted breeding of wheat;

[0019] (4) Used for screening or cultivating high-yielding plants.

[0020] Beneficial effects:

[0021] This invention provides an SNP molecular marker related to plant appearance quality and its application. The SNP molecular marker contains a nucleotide sequence with a polymorphism of C or T at position 767257977 bp on wheat chromosome 2A. This invention has determined that this site is a polymorphic site affecting grain length and protein content, and designed a specific KASP primer combination to achieve rapid and accurate identification of wheat grain length and protein content. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0023] Figure 1 This is a map of SNP sites in the exon of the TraesCS2A03G1293100 gene obtained by exon capture sequencing technology provided in Example 1 of this invention.

[0024] Figure 2 This is a statistical chart of grain length and protein content of different genotypes at the 767257977 locus of chromosome 2A provided in Example 2 of the present invention.

[0025] Figure 3 This is the wheat genotyping result at the 767257977 locus on chromosome 2A provided in Example 2 of the present invention; wherein, CC represents 767257977-C and TT represents 767257977-T.

[0026] Figure 4 This is a sequencing peak diagram of different genotypes at locus 767257977 on chromosome 2A, provided in Example 2 of this invention. This gene is in the negative direction in the genome, but the sequencing results are in the positive direction. Specifically: CG, AT. Detailed Implementation

[0027] This invention discloses SNP markers related to plant protein content and their applications. The SNP locus is located at 767,257,977 bp on wheat chromosome 2A, with a reference genome of IWGSC V2.1 and a polymorphism of C / T. This invention uses haplotype analysis to determine that this locus is a polymorphic site affecting grain length and protein content, and designs a specific KASP primer combination to achieve rapid and accurate identification of wheat grain length and protein content. Long-grain japonica rice has slender, glossy grains and good appearance quality. The SNP markers and applications provided by this invention are of significant importance for improving wheat quality. They not only improve selection efficiency but also shorten the breeding cycle, helping to quickly identify and cultivate wheat varieties with ideal protein content. The use of the KASP primer combination provided by this invention offers an effective tool for marker-assisted selection of wheat yield-related traits, which can improve the appearance quality of crops.

[0028] The SNP molecular marker provided by this invention contains a nucleotide sequence with a polymorphism of C / T at position 767257977 bp on wheat chromosome 2A.

[0029] Furthermore, plants with the CC genotype of the polymorphic site contained in the marker have longer seeds and higher protein content compared to plants with the TT genotype.

[0030] The KASP primer combination for amplifying the marker provided by the present invention includes forward primer 1 (GCTCGAGGCCACCGAAGC) as shown in SEQ ID NO:1, forward primer 2 (GCTCGAGGCCACCGAAGT) as shown in SEQ ID NO:2, and reverse primer (CCACAGACAACCTCTACGACA) as shown in SEQ ID NO:3.

[0031] Furthermore, the 5′ ends of forward primers 1 and 2 in the KASP primer combination can also be linked to fluorescent label sequences, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0032] In one specific embodiment of the present invention, the KASP primer combination is as follows:

[0033] 767257977 F1 (SEQ ID NO:4):

[0034] 5' GAAGGTGACCAAGTTCATGCTGCTCGAGGCCACCGAAGC 3'.

[0035] 767257977 F2 (SEQ ID NO:5):

[0036] 5'GAAGGTCGGAGTCAACGGATGCTCGAGGCCACCGAAGT 3'.

[0037] 767257977 R (SEQ ID NO:3):

[0038] 5'GAAGGTCGGAGTCAACGGATT 3' (SEQ ID NO:3).

[0039] The present invention also provides detection reagents or kits containing the primer combinations described above.

[0040] Furthermore, the present invention provides a method for identifying the protein content (high or low, size) of plants, comprising: using the DNA of the plant sample to be tested as a template, performing PCR amplification using the KASP primer combination or the detection reagent or kit, and determining the protein content of the plant sample to be tested based on the amplification results.

[0041] Preferably, based on a total system volume of 10 μL, the PCR amplification system includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder being water.

[0042] The primer mixture, in 100 μL, comprises: 10-14 μL of 100 μM forward primer 1, 10-14 μL of 100 μM forward primer 2, 28-32 μL of 100 μM reverse primer, and the remainder is water.

[0043] Preferably, the reaction program for PCR amplification is as follows: 95℃ for 8~12 min; 95℃ for 15~25 s, 61℃ for 60 s, 8~12 cycles, with the annealing temperature decreasing by 0.5℃~0.7℃ in each cycle; 95℃ for 15~25 s, 55℃ for 35~45 s, 32~36 cycles; 25℃ for 10~20 min.

[0044] Furthermore, the present invention determines the protein content of the plant sample to be tested based on the amplification results by analyzing the genotype of the polymorphic sites contained in the marker in the amplification product. Plants with genotype CC have longer seeds and higher protein content compared to plants with genotype TT.

[0045] Furthermore, the plant in question is wheat.

[0046] The present invention also provides any of the following applications of the marker, the combination of markers, or the detection reagent or kit:

[0047] (1) Used for the identification, selection and improvement of wheat protein content;

[0048] (2) Used for early prediction of wheat protein content traits;

[0049] (3) Used in marker-assisted breeding of wheat;

[0050] (4) Used for screening or cultivating high-yielding plants.

[0051] This invention successfully identified a SNP locus closely related to plant grain length and protein content using phenotypic differential analysis and exon capture sequencing technology. Polymorphism detection at this locus can accurately and rapidly assess the protein content characteristics of plants.

[0052] By utilizing KASP technology, the SNP loci and corresponding primer combinations provided in this invention not only improve the efficiency of plant variety selection but also help shorten the breeding cycle and accelerate the cultivation of high-quality plant varieties. These markers have good genetic stability, high resolution, and are suitable for high-throughput detection, demonstrating significant application value in the field of plant breeding.

[0053] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0054] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0055] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "specific implementation," or "some specific implementations," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0056] In the embodiments provided in this specification, unless specific techniques or conditions are specified, the techniques or conditions described in the literature in this field, or the product instructions, shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0057] The wheat varieties (lines) mentioned in the following examples were all provided by Researcher Zhang Xueyong of the Institute of Crop Science, Chinese Academy of Agricultural Sciences. All wheat varieties were sown in Xinxiang, Henan Province, harvested after physiological maturity, naturally dried, and used for subsequent analysis. It should be noted that, as a professional agricultural research institution, the applicant has long maintained relevant germplasm materials, and all relevant wheat varieties are publicly available on the market or in existing germplasm banks.

[0058] Example 1

[0059] This embodiment describes the process of obtaining SNP markers related to plant protein content and the design of KASP primers.

[0060] 1. 214 exons were captured and sequenced.

[0061] The whole exome sequencing process includes the following four steps.

[0062] 1) Sample testing: Before DNA sequencing, the quality and quantity of sample DNA must be ensured by agarose gel electrophoresis and nanodrop detection. The DNA concentration should be no less than 20 ng / ul, and the total amount should be no less than 800 ng to ensure the accuracy and repeatability of sequencing.

[0063] 2) Library Construction: Genomic DNA was randomly fragmented into 180-280 bp segments using a Covaris fragmentation instrument. Next, end repair, phosphorylation, and polyA tailing were performed using the Agilent Sure Select kit. Exon regions were enriched by liquid chromatography-mass spectrometry (LC-MS), and biotin-labeled probes were used for specific hybridization with the library containing specific indexes, followed by PCR amplification. Finally, the amplified library underwent quality testing to ensure it met pre-sequencing standards.

[0064] 3) Library Inspection: After library construction, preliminary quantification is performed using Qubit 2.0. Then, the Agilent 2100 bioanalyzer is used to detect the insert fragments, ensuring appropriate size. Once qualified, the effective concentration of the library is accurately quantified to 3 nmol / L using Q-PCR to ensure the quality and accuracy of the sequencing library.

[0065] 4) Sequencing: After the library passes inspection, PE150 sequencing is performed using the Illumina HiSeq platform, based on the effective library concentration and data requirements. PE150 is paired-end sequencing, with 150 bp read from each end. High-throughput sequencing is performed using insert fragments from small libraries, facilitating subsequent sequence alignment and analysis, and improving the accuracy and reliability of the data.

[0066] 2. Development of different wheat grain lengths and protein contents, as well as SNP molecular markers.

[0067] To screen for key genes affecting wheat protein content, protein content was first measured in 214 wheat varieties to assess phenotypic variation. This basic data collection is the first step in understanding the genetic background of protein content. The results are shown in Table 1. This study lays the foundation for further gene analysis and breeding research.

[0068] Based on the phenotypic data of grain length and protein content obtained in step 2, and combined with exon capture sequencing analysis, the contribution of important gene SNP sites to protein content was explored. An SNP site was found in exon 2A of the wheat genome, TraesCS2A03G1293100. The protein content of the CC genotype material at this SNP site was significantly increased. A significant site affecting wheat protein content (2A: 767257977 bp) was identified (partial results are shown in...). Figure 1 The site was named 767257977. It should be noted that this gene is in the negative direction in the genome, while the designed sequencing and KASP primers are both in the positive direction.

[0069] Based on the above sequence differences and the KASP principle, a primer set for PCR amplification to obtain the wheat molecular markers was further developed and designed, as follows:

[0070] 767257977 F1 (SEQ ID NO:4):

[0071] 5' GAAGGTGACCAAGTTCATGCTGCTCGAGGCCACCGAAGC 3'.

[0072] 767257977 F2 (SEQ ID NO:5):

[0073] 5'GAAGGTCGGAGTCAACGGATGCTCGAGGCCACCGAAGT 3'.

[0074] 767257977 R (SEQ ID NO:3):

[0075] 5' GAAGGTCGGAGTCAACGGATT 3'.

[0076] When using primer pairs 767257977-F1 and 767257977-R, the sequence with a C base at the 767257977 site on chromosome 2A of wheat molecular markers is amplified.

[0077] When using primer pairs 767257977-F2 and 767257977-R, the sequence with a base of T at the 767257977 site on chromosome 2A of wheat molecular markers is amplified.

[0078] Example 2

[0079] This embodiment provides the application of the above-mentioned SNP markers in identifying wheat protein content.

[0080] 1. Based on the primer pair design of Example 1, the genotypes of 214 wheat materials (46 CC / 46 TT) were detected, and the association between genotype and protein content phenotype was identified. The specific process is as follows.

[0081] First, genomic DNA was extracted from each wheat variety.

[0082] Then, using the primers designed in Example 1 and the extracted DNA as a template, different wheat samples were analyzed by PCR (using a Quant Studio 1 real-time PCR instrument).

[0083] For specific PCR amplification, the 10 μL amplification system was designed as follows:

[0084] KASP Mix (2×), 5 μL; HiGeno 2x Probe Mix (provided at 2x concentration), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTPs, buffer, MgCl2, and reference dye ROX; Primer Mix, 0.14 μL; DNA, 30 ng; ddH2O, to a final volume of 10 μL. The Primer Mix, per 100 μL, contains: 767257977-F1, 100 μM, 12 μL; 767257977-F2, 100 μM, 12 μL; 767257977-R, 100 μM, 30 μL; ddH2O, 46 μL.

[0085] The PCR reaction procedure (which can be adjusted according to the amplification results) is as follows:

[0086] 95℃ for 10 min; 95℃ for 20 s, 61℃ for 60 s (10 cycles, each cycle decreasing by 0.6℃); 95℃ for 20 s, 55℃ for 40 s, 34 cycles; 25℃ for 15 min.

[0087] 2. Using the genomic DNA extracted from each wheat variety in step 1, perform conventional PCR and sequencing to verify the accuracy of KASP genotyping.

[0088] First, specific primers were designed to amplify the region at 767257977 bp on wheat chromosome 2A (reference sequence for Chinese spring wheat). The primer sequences are as follows:

[0089] F (SEQ ID NO:6): 5' CGGTCGTGCCAGCCAGACATAC 3'.

[0090] R (SEQ ID NO:7): 5' CAGACATACGTATAGAGCGCGA 3'.

[0091] Six wheat varieties with CC / TT genotypes from the KASP genotyping results were randomly selected, amplified using a conventional PCR instrument, and sequenced after electrophoresis to verify the reliability of the genotyping results.

[0092] For specific PCR amplification, the 25 μL amplification system was designed as follows:

[0093] TransGen Biotech 2×EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL; primers WAF / WAR, 1 μL each; primer concentration 10 μM. DNA, 60 ng; ddH2O, to a final volume of 25 μL.

[0094] The PCR reaction procedure (which can be adjusted according to the amplification results) is as follows:

[0095] 94℃ for 5 min; 94℃ for 30 s, 90℃ for 30 s, 72℃ for 40 s (35 cycles); 72℃ for 10 min; end at 16℃.

[0096] Specific genotypes, wheat grain length, and protein content statistics are shown in Table 1 and... Figure 1-4 As shown.

[0097] Table 1. Correspondence between grain length and protein content of different wheat genotypes

[0098]

[0099]

[0100]

[0101]

[0102]

[0103] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of SNP molecular markers in identifying wheat grain length and protein content, characterized in that, The SNP molecular marker contains a nucleotide sequence with a polymorphism of C or T at 767257977 bp on wheat chromosome 2A, with the reference genome being IWGSCV2.1; wheat with the SNP molecular marker polymorphism site genotype CC has longer grains and higher protein content compared to wheat with the genotype TT.

2. Application of the KASP primer combination in the preparation of a detection reagent or kit for detecting wheat grain length and protein content, wherein the detection reagent or kit includes the KASP primer combination, which is used to amplify the SNP molecular marker of claim 1, and includes forward primer 1, forward primer 2 and reverse primer; The nucleotide sequence of forward primer 1 includes the nucleotide fragment shown in SEQ ID NO. 01; The nucleotide sequence of forward primer 2 includes the nucleotide fragment shown in SEQ ID NO. 02; The reverse primer's nucleotide sequence includes the nucleotide fragment shown in SEQ ID NO. 03; The amplification results showed that wheat with the SNP molecular marker polymorphism site genotype CC had longer grains and higher protein content compared to wheat with the genotype TT.

3. A method for identifying high protein content in wheat, characterized in that, include: Using the DNA of the wheat sample to be tested as a template, PCR amplification is performed using the detection reagent or kit described in claim 2, and the protein content of the wheat sample to be tested is determined based on the amplification results.

4. The method for identifying high protein content in wheat according to claim 3, characterized in that, Determining the protein content of the wheat sample to be tested based on the amplification results includes: analyzing the genotype of the polymorphic site located at 767257977 bp on the wheat chromosome 2A in the amplification product. The reference genome is IWGSC V2.

1. Wheat with genotype CC has a higher protein content than wheat with genotype TT.

5. The method for identifying high protein content in wheat according to claim 3 or 4, characterized in that, The total volume of the PCR amplification system is 10 μL, which includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder is water. The primer mixture is 100 μL, which includes: 10-14 μL of 100 μM forward primer 1, 10-14 μL of 100 μM forward primer 2, 10-14 μL of 100 μM reverse primer, and the remainder is water.

6. The method for identifying high protein content in wheat according to claim 5, characterized in that, The PCR amplification reaction program was as follows: 95℃, 8~12min; 95℃, 15~25s, 61℃, 60s, 8~12 cycles, with the annealing temperature decreasing by 0.5℃~0.7℃ per cycle; 95℃, 15~25s, 55℃, 35~45s, 32~36 cycles; 25℃, 10~20min.

7. Any of the following applications of the SNP molecular marker in the application of claim 1 or the detection reagent or kit in the application of claim 2: (1) Used for the identification, selection and improvement of wheat protein content; (2) Used for early prediction of wheat grain length and protein content; (3) Used in marker-assisted breeding of wheat; (4) Used for screening or breeding high-yield wheat.

Images