KASP markers, primers for identifying red flower strawberry double flower trait and application thereof

By developing KASP markers and primers for identifying the double-petal trait in red-flowered strawberries and utilizing SNP site detection technology, the problems of long cycles and misjudgments in traditional breeding have been solved, enabling rapid and accurate trait identification and selection, and meeting the needs of large-scale breeding.

CN120138212BActive Publication Date: 2026-01-09SHENYANG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510426875.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-07
Publication Date
2026-01-09
Estimated Expiration
2045-04-07

AI Technical Summary

Technical Problem

In traditional breeding methods, the identification of double-petal trait in red-flowered strawberries relies on phenotypic observation, which leads to a long breeding cycle and susceptibility to environmental factors. Furthermore, conventional molecular marker typing is inefficient and cannot meet the needs of large-scale breeding.

Method used

We developed a KASP molecular marker and its specific primers for identifying the double-petal trait in red-flowered strawberries. By detecting the SNP polymorphism at position 22801452bp on chromosome 7-1, and combining the KASP kit with real-time PCR technology, we achieved rapid and accurate genotyping.

Benefits of technology

This technology enables rapid identification and breeding of double-petaled traits in red-flowered strawberries, shortens the breeding cycle, improves screening efficiency and accuracy, and provides a foundation for large-scale breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138212B_ABST
    Figure CN120138212B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of strawberry breeding, and more particularly relates to a KASP marker for identifying a double flower trait of a red flower strawberry, a primer and an application thereof. The present application provides a KASP marker for identifying a double flower trait of a red flower strawberry, wherein the SNP site is located at position 22801452 on chromosome 7-1, has a T or C polymorphism, and a red flower strawberry with a TT homozygous type at the site is double flowered. The KASP marker is closely related to the double flower trait of the red flower strawberry, and can be used for rapid identification and breeding of a double flower red flower strawberry variety.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of strawberry breeding, and more particularly relates to a KASP marker for identifying a double-petal trait of Fragaria chiloensis, a primer and application thereof. BACKGROUND

[0002] As an important horticultural crop with both ornamental and economic values, Fragaria chiloensis has diverse flower morphologies, one of which is the double-petal trait. The double-petal trait is of great concern because it can significantly improve the ornamental value of flowers. However, the formation of the double-petal trait involves complex genetic regulatory mechanisms. Traditional breeding mainly relies on phenotypic observation for screening, that is, whether a plant is of the double-petal type is determined by manually counting the number of petals after the plant has flowered. This method has obvious limitations. On the one hand, phenotypic screening requires waiting for the plant to enter the flowering stage, resulting in a prolonged breeding cycle, usually 1-2 years. On the other hand, environmental factors such as light and temperature can affect petal development, leading to misjudgment of the phenotype and further reducing the screening efficiency. In addition, the segregation pattern of single-petal and double-petal traits in conventional hybrid breeding is not clear, making it challenging to stably inherit the target trait.

[0003] In recent years, molecular marker-assisted selection technology has provided a new approach for early identification of plant traits. By mining molecular markers closely linked to the target trait, individuals with specific genotypes can be quickly screened at the seedling stage, significantly shortening the breeding cycle. Although some studies have attempted to use SSR markers or simplified genome sequencing-based association sites, these markers often have low typing efficiency and insufficient polymorphism, making it difficult to meet the needs of large-scale breeding. SUMMARY

[0004] The purpose of the present application is to provide a KASP marker, a primer and application thereof for identifying the double-petal trait of Fragaria chiloensis to solve the above technical problems.

[0005] The purpose of the present application is achieved by the following technical solutions:

[0006] The present application provides a KASP molecular marker for identifying the double-petal trait of Fragaria chiloensis, the nucleotide sequence of which is shown in SEQ ID NO. 1. The N at position 150 is a SNP site, and the polymorphism is T or C. Fragaria chiloensis with TT genotype at this site has the double-petal trait.

[0007] The present application determines the double-petal trait of Fragaria chiloensis by judging the SNP site polymorphism of the gene sequence at position 22801452 bp of chromosome 7-1 of Fragaria chiloensis. When the SNP site of the gene sequence of Fragaria chiloensis is detected as TT genotype, it is considered that Fragaria chiloensis has the double-petal trait.

[0008] The application further provides a specific primer for amplifying the KASP marker, including an upstream primer as shown in SEQ ID NO. 2, SEQ ID NO. 3, and a downstream primer as shown in SEQ ID NO. 4.

[0009] The application further provides a kit for detecting the petal trait of the Fragaria vesca, and the kit comprises the specific primer.

[0010] Further, the kit further comprises 2x KASP master mix.

[0011] The application further provides application of the KASP marker, the specific primer or the kit in identifying the petal trait of the Fragaria vesca.

[0012] The application further provides application of the KASP marker, the specific primer or the kit in breeding or assisting breeding of the Fragaria vesca with the double-petal trait.

[0013] The application further provides a detection method for the double-petal trait of the Fragaria vesca, comprising the following steps.

[0014] (1) extracting genomic DNA of the Fragaria vesca to be detected;

[0015] (2) using the genomic DNA of the Fragaria vesca to be detected as a template, and using the specific primer to amplify;

[0016] (3) identifying the genotype of the 150th position of the amplification product, and the Fragaria vesca with the SNP site of the 150th position as the TT genotype is the double-petal trait.

[0017] The application further provides a breeding method for the double-petal Fragaria vesca, comprising the following steps.

[0018] (1) using the detection method to screen the Fragaria vesca plant with the double-petal trait genotype;

[0019] (2) using the screened plant as a parent to cross or self-cross, and obtaining the Fragaria vesca offspring with the stable double-petal trait.

[0020] The application has the following beneficial effects:

[0021] The application provides a KASP marker for identifying the double-petal trait of the Fragaria vesca, which can be used for rapid identification and breeding of the double-petal Fragaria vesca, lays a foundation for large-scale rapid identification and screening of the double-petal Fragaria vesca, and makes a contribution to molecular breeding of the Fragaria vesca. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1The KASP typing map. The abscissa is the proportion of FAM fluorescence, the ordinate is the proportion of VIC fluorescence, the red dot represents the TT genotype, and the blue dot represents the CC genotype. DETAILED DESCRIPTION

[0023] The application will be described in detail below with specific examples, but should not be understood as limiting the application. If not specifically stated, the technical means used in the following examples are conventional means known to those skilled in the art, and the materials, reagents, etc. used in the following examples, if not specifically stated, can be obtained from commercial channels.

[0024] Example 1: KASP molecular marker development of red strawberry double flower trait

[0025] 1. Construction of hybrid population: The single-petal red strawberry variety 'Ruby' was used as the male parent, and the double-petal red strawberry variety 'Cherry Blossom' was used as the female parent to carry out hybridization, obtaining about 400 hybrid offspring population. In order to determine the key genetic loci of double-petal flower formation, 30 single-petal (petal number 6-8) and double-petal (petal number ≥ 15) plants with similar colors were selected from the hybrid offspring to construct two extreme pools.

[0026] 2. Obtaining genomic DNA of parents and offspring in the pool: Fresh and tender leaves of red strawberry parents and offspring in the pool were used as materials, and a new type of plant genomic DNA extraction kit (Aidlab New Type Plant DNA Kit, DN15) was used for genomic DNA extraction.

[0027] 3. Whole genome resequencing of single double-petal red strawberry hybrid population: 5 μL of extracted DNA was aspirated per tube, diluted to 50 ng / μL with ddH2O, and then the double-petal red strawberry DNA samples were mixed into one tube, and the single-petal red strawberry DNA samples were mixed into one tube. Through sequencing data quality control and alignment with the reference genome, a total of 2887790 SNPs were obtained, and 257074 SNPs caused non-synonymous mutations.

[0028] 4. SNP site screening: The DISTANCE method was used to fit ΔSNP-index, and then according to the association threshold, the regions above the threshold were selected as the regions related to the trait. It was found that two regions were located on chromosomes 6-4 and 7-1, with candidate lengths of 0.2 Mb and 0.64 Mb, respectively, including 2771 non-synonymous mutation SNP sites and 891 candidate genes. The two interval segments may have genes significantly associated with double-petal trait.

[0029] 5. Development of KASP molecular markers related to the formation of double-flowered traits of red flower strawberry: According to the specific information of the chromosomal position, flanking sequence, etc. of the SNP marker, the KASP marker is developed and designed, the sequence of the SNP marker is shown as SEQ ID NO. 1, the concentration of the three primers is 10 μM, then the primer mix is obtained by mixing the F1, F2 and R three primers according to the volume ratio of 1:1:3. The KASP marker primers are shown in Table 1, and the PCR amplification system and reaction program are shown in Tables 2 and 3.

[0030] SEQ ID NO. 1: GTCATCGAGTCTATACTCGTGCATGATCCAATCGGATT TTTGGCCGTGGGGAGCTCTGCCTTTGTAGAACACAACTGTTTTTCTCATACCAATCCGCAAGCAGTTCCTGCGTATCACCTTATCACGGCCGGTGGCCTTCCAGAAGCCGGNAGCTGTTGCACGATTCGTGCGTGTTCCGGTTGGATACTTCTTGTCCTTGTGGCTGAAGAAATACCAATCATTTTGTGGTGTGGTTCCTATATTGCACTTCTCTAGAAAAACCAATATGAATACTTGGTTATATTTCAAATGGATTATGCG.

[0031] Table 1: Molecular marker primers related to the formation of double-flowered traits of red flower strawberry

[0032] Primer 5'-3' SEQ ID NO. F1 GAAGGTGACCAAGTTCATGCTGCCTTCCAGAAGCCGGT 2 F2 GAAGGTCGGAGTCAACGGATTCCTTCCAGAAGCCGGC 3 R CCGGAACACGCACGAAT 4

[0033] Table 2: PCR reaction system

[0034] Component Addition 2x KASP master mix 2.5 μL primer mix 1.25 μL DNA 1.25 μL Total 5 μL

[0035] Table 3: PCR amplification system

[0036]

[0037] 6. Fluorescence detection and analysis: After the end of the PCR amplification cycle, the fluorescence value is read in an environment below 40℃ using a fluorescence quantitative PCR instrument, and the result data of the fluorescence value reading is analyzed using the genotype reading software (Kluster Caller) of LGC_OMEGA to determine the allelic type. The fluorophore FAM and VIC are used to distinguish the two isogenic sites in the SNP site detection. The passive reference dye ROX is used to correct the signal difference between wells due to reaction volume error. The relevant excitation and emission wavelengths are shown in Table 4 below.

[0038] Table 4: Fluorescence value reading wavelength

[0039]

[0040]

[0041] 7. LGC_OMEGA Gene Analysis Results: The fluorescence value reading results from the above steps were analyzed using LGC_OMEGA genotyping software. In this software, VIC and FAM data were plotted on the x and y axes, respectively. The VIC and FAM values ​​for each reaction well were corrected using the reference dye (ROX) value for that specific well. The fluorescence values ​​were then standardized to obtain the relative fluorescence values ​​corresponding to VIC and FAM for each PCR reaction well. Based on the relative fluorescence values, the samples were clustered, and the genotype was determined according to the sample clusters and fluorescence type.

[0042] 8. KASP Molecular Marker Genotyping Validation: KASP markers were applied to single- and double-flowered red-flowered strawberry parents and their hybrid offspring for genotyping validation. Genotypic and phenotypic data are shown in Tables 5 and 6. The detection results are as follows: Figure 1 As shown, the KASP marker is associated with the formation of double-petal trait in red-flowered strawberries. Among the 48 validated samples, 15 red-flowered strawberry samples with double-petal trait were successfully detected.

[0043] Table 5: Statistics on KASP marker genotypes and phenotypes in red-flowered strawberry

[0044] Number of individuals Genotype Phenotype 15 TT Double 33 CC Single

[0045] Table 6: KASP marker genotype and phenotypic validation data for red-flowered strawberry

[0046]

[0047]

[0048] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0049] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0050] Obviously, many modifications and variations of the present application are possible in light of the above teachings. It is, therefore, to be understood that within the scope of the appended claims and their equivalents, the application can be practiced otherwise than as specifically described.

Claims

1. A KASP molecular marker associated with the red flower strawberry double flower trait, characterized in that, The nucleotide sequence is shown as SEQ ID NO. 1, N at position 150 is a SNP site, and the polymorphism is G or A, and the red strawberry with GG genotype at the site is a double-petaled trait.

2. A specific primer for amplifying the KASP marker of claim 1, characterized in that, The upstream primer comprises SEQ ID NO. 2 and SEQ ID NO. 3, and the downstream primer comprises SEQ ID NO.

4.

3. A kit for detecting the flower petal trait of red clover, characterized in that, The kit comprises the specific primer of claim 2.

4. The kit of claim 3, wherein The kit further comprises 2x KASP mastermix.

5. A method for detecting red safflower strawberry double flower trait, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of the red strawberry to be tested; (2) using the genomic DNA of the red strawberry to be tested as a template and using the specific primer of claim 2 for amplification; (3) identifying the genotype at position 150 of the amplification product, and the red strawberry with GG genotype at the SNP site at position 150 is a double-petaled trait.

6. A method for breeding a red clover strawberry double variety, characterized by, The method comprises the following steps: (1) using the detection method of claim 5 to screen the red strawberry plants with a double-petaled trait genotype; (2) using the screened plants as parents for crossbreeding or self-pollination to obtain red strawberry offspring with a stable double-petaled trait.

Citation Information

Patent Citations

  • KASP molecular marker related to strawberry petal shedding speed character and application of KASP molecular marker

    CN113186323A

  • KASP molecular marker group for identifying five-leaf strawberries and application of KASP molecular marker group

    CN116875728A