Lactobacillus paracasei ZY and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to lactobacillus paracasei ZY and application thereof, and the preservation number of the lactobacillus paracasei ZY is CGMCC (China General Microbiological Culture Collection Center) No.30303. The invention provides the lactobacillus paracasei ZY capable of regulating the iron balance of intestinal tracts, and the lactobacillus paracasei ZY also can promote the growth of saccharomyces cerevisiae. The animal feed prepared from the lactobacillus paracasei ZY can regulate the iron absorption of intestinal tracts according to the iron content in blood, promote the intestinal tracts to autonomously regulate the iron balance, and effectively solve the problem of iron balance imbalance in large-scale production; a fermented product prepared from the lactobacillus paracasei ZY is good in palatability, digestion is promoted, and the immunity of the organism is enhanced.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and particularly relates to a Lactobacillus paracasei ZY and its application. Background Art

[0002] Iron is one of the most abundant trace metal elements in animals. It is widely involved in the metabolic processes in the body. Therefore, iron balance is crucial for the body. Animals such as weaned piglets that are prone to iron deficiency, due to their rapid growth and limited iron storage, are particularly susceptible to iron deficiency problems. However, iron deficiency is relatively hidden and difficult to detect in practice in the early stage. Severe iron deficiency can cause diseases such as anemia. When the trace element iron is supplemented in excess, it will cause colitis. Under large-scale farming, it is necessary to find a method for regulating iron balance that has production and economic benefits.

[0003] As a promising alternative to antibiotics in the context of antibiotic prohibition, probiotics play beneficial functions such as regulating the intestinal flora, anti-inflammatory, and antioxidant in the intestine. Therefore, finding a probiotic that is beneficial to intestinal health, while regulating the balance of the intestinal flora and also regulating the intestinal iron balance to cope with the iron deficiency problem during early weaning, or the iron overload and enteritis problems caused by improper use of iron elements, is effective, safe and has a transformation prospect.

[0004] Lactobacillus paracasei is a probiotic that can be consumed by humans and animals or added to feed. However, the role of Lactobacillus paracasei on the market in regulating animal iron balance is not clear. Summary of the Invention

[0005] The purpose of the present invention is to provide a Lactobacillus paracasei ZY and its application.

[0006] To achieve the above purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a Lactobacillus paracasei ZY, and the preservation number of the Lactobacillus paracasei ZY is CGMCC No. 30303.

[0008] The present invention also includes an application of the above Lactobacillus paracasei ZY in regulating intestinal iron balance.

[0009] Furthermore, the application of the Lactobacillus paracasei ZY in preparing animal feed.

[0010] Furthermore, the application of the Lactobacillus paracasei ZY as an animal feed additive.

[0011] The present invention also includes an application of the above Lactobacillus paracasei ZY in promoting the growth of Saccharomyces cerevisiae.

[0012] Furthermore, the application of Lactobacillus paracasei ZY in the preparation of fermented products.

[0013] Furthermore, the application of Lactobacillus paracasei ZY in the preparation of fermented feed products.

[0014] Compared with the prior art, the present invention provides a Lactobacillus paracasei ZY capable of regulating intestinal iron balance, and this Lactobacillus paracasei ZY can also promote the growth of Saccharomyces cerevisiae. Compared with other Lactobacillus paracasei, this Lactobacillus paracasei ZY has stronger antioxidant ability. The animal feed prepared with the Lactobacillus paracasei ZY of the present invention can regulate the intestinal absorption of iron according to the blood iron content, prompting the intestine to autonomously regulate iron balance and effectively solving the problem of iron balance disorder in large-scale production; the fermented products prepared with the Lactobacillus paracasei ZY of the present invention have good palatability, promote digestion and enhance the body's immunity; the feed containing the Lactobacillus paracasei ZY of the present invention can withstand a complex intestinal environment and is more likely to inhibit the growth of pathogenic bacteria.

[0015] Description of the drawings

[0016] Figure 1 Is the detection result of total blood iron content.

[0017] Figure 2 Is the detection result of the gene expression levels of the iron absorption-related genes divalent metal ion transporter 1, duodenal cytochrome b, and iron pump protein in intestinal epithelial cells.

[0018] Figure 3 Is OD 600 Detection result at absorbance.

[0019] Figure 4 Is the detection result of Saccharomyces cerevisiae DNA quantification.

[0020] Figure 5 Is the result of Salmonella and Escherichia coli in the fecal suspension.

[0021] Figure 6 Is the antioxidant result.

[0022] Among them, Figure 1-2 Group 1 in the sub refers to Group 1 of Lactobacillus paracasei under iron deficiency treatment in Example 2, and Group 2 in the sub refers to Group 2 of Lactobacillus paracasei under iron overload treatment in Example 2; Figure 3 The supernatant group of ZY bacteria solution in it refers to the Saccharomyces cerevisiae group with the supernatant of the bacteria solution containing Lactobacillus paracasei ZY added in Example 3; Figure 4 The Lactobacillus paracasei ZY group in it refers to the Saccharomyces cerevisiae group with the bacterial sludge containing Lactobacillus paracasei ZY added in Example 3. Detailed implementation manners

[0023] The technical solution of the present invention will be further described below in conjunction with specific embodiments. It should be understood that the following embodiments are only for illustrative and explanatory purposes of the present invention, and should not be construed as limiting the protection scope of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0024] The Lactobacillus paracasei ZY involved in the present invention has the Latin name Lactobacillus paracasei and was deposited in the General Microbiological Center of the China National Culture Collection of Microorganisms on April 11, 2024, with the deposit number CGMCC No. 30303.

[0025] The growth characteristics are as follows: In MRS liquid medium, cultured at 37°C, it enters the logarithmic growth phase in about 3 hours, reaches the stationary phase in 16 hours, and the maximum viable cell count can reach 10 8 CFU / mL.

[0026] Example 1

[0027] Collect the feces of weaned piglets fed with Xinzhengyang creep feed for 14 days. Place the collected feces in a sterile PBS buffer containing 25% glycerol on ice, and quickly inoculate it into a sterile MRS liquid medium. Adjust the pH and place it in an incubator at 37°C for 24 hours. Subsequently, the visibly turbid bacterial liquid is diluted and spread on MRS solid medium at a ratio of 10 2 ~10 7 and cultured in an incubator at 37°C for 24 hours. Pick out the white and opaque single colonies that grow and inoculate them into the solid medium for continued culture for 24 hours, repeating 2 - 3 times. After culturing the single bacteria obtained from the last culture in MRS liquid medium for 24 hours, use the CW Biotech bacterial DNA extraction kit to extract bacterial DNA. Use the universal bacterial primers 27F: AGAGTTTGATCCTGGCTCAG; 1492R: GGTTACCTTGTTACGACTT for colony PCR amplification, and then send it to Sangon Biotech (Shanghai) Co., Ltd. for 16S rDNA sequencing and identification.

[0028] After identification, the feces of weaned piglets fed with Xinzhengyang creep feed all contain Lactobacillus paracasei. The colony PCR identification results are as follows, and it is named Lactobacillus paracasei ZY. The Lactobacillus paracasei ZY provided by this patent is a dominant strain obtained from the intestinal flora of weaned piglets fed with Xinzhengyang creep feed, and has good stress resistance and probiotic effects.

[0029] The sequencing results are as follows:

[0030]

[0031] Example 2

[0032] Set up 5 groups, with 20 weaned piglets at 28 days old in each group. When grouping, consider factors that may affect the results, such as weight, etc., and conduct balanced distribution to ensure the comparability between groups:

[0033] Control group (added with 100 mg / kg ferrous sulfate),

[0034] Iron deficiency group (added with 20 mg / kg ferrous sulfate),

[0035] Iron overload group (500 mg / kg ferrous sulfate),

[0036] Lactobacillus paracasei group 1 (added with 10 8 CFU / kg freeze-dried bacterial powder + 20 mg / kg ferrous sulfate),

[0037] Lactobacillus paracasei group 2 (added with 10 8 CFU / kg freeze-dried bacterial powder + 500 mg / kg ferrous sulfate).

[0038] Shake well the bacterial liquid of Lactobacillus paracasei ZY with a colony number of 10 8 CFU / mL, and freeze-dry it to make freeze-dried bacterial powder; add the freeze-dried bacterial powder and ferrous sulfate into the starter feed according to the corresponding amounts in the brackets of the above groups and mix them to make the feed for weaned piglets to eat, and conduct the experiment for 30 days.

[0039] 1. Detect the total iron content in the blood of weaned piglets.

[0040] Refer to Figure 1 , when weaned piglets are iron-deficient, the iron content in the blood is significantly reduced, and on this basis, supplementing Lactobacillus paracasei ZY can promote the absorption of iron by intestinal epithelial cells; when there is iron overload, since the body cannot quickly metabolize the excessive iron, it causes the intestinal epithelial cells to absorb excessive iron into the blood, leading to damage to the intestinal epithelial cells. Supplementing Lactobacillus paracasei ZY can reduce the iron absorbed by the small intestine from entering the blood, and Lactobacillus paracasei ZY can prompt the intestinal epithelial cells to autonomously regulate absorption according to the iron content.

[0041] 2. Detect the gene expression levels of the iron absorption-related genes divalent metal ion transporter 1, duodenal cytochrome b, and iron pump protein in intestinal epithelial cells.

[0042] Refer to Figure 2In weaned piglets, iron deficiency stimulates the gene expression levels of divalent metal ion transporter 1, duodenal cytochrome b, and iron pump protein in intestinal epithelial cells to increase significantly, while iron overload inhibits the expression of these genes. Supplementing Lactobacillus paracasei ZY can solve the problem of abnormal changes in iron absorption-related genes in intestinal epithelial cells caused by iron deficiency or iron overload.

[0043] Example 3

[0044] Inoculate Lactobacillus paracasei ZY at 1%, culture until the logarithmic growth phase, centrifuge the cultured Lactobacillus paracasei ZY bacterial liquid at 4000×g for 15 minutes, and separate the bacterial sludge and the supernatant of the bacterial liquid with a 0.22-μm filter.

[0045] 1. Add the supernatant of the bacterial liquid into the YPD medium inoculated with 1% Saccharomyces cerevisiae, and detect the growth curves of the control group of Saccharomyces cerevisiae (YPD medium inoculated only with 1% Saccharomyces cerevisiae) and Saccharomyces cerevisiae added with the supernatant of the bacterial liquid at an OD 600 absorbance within 0 - 40 hours.

[0046] Refer to Figure 3 , the supernatant of the bacterial liquid of Lactobacillus paracasei ZY accelerated the logarithmic growth phase of Saccharomyces cerevisiae and simultaneously increased the absorbance at the plateau phase of Saccharomyces cerevisiae, proving that the supernatant of the bacterial liquid of Lactobacillus paracasei ZY can promote the growth of Saccharomyces cerevisiae.

[0047] 2. Add the bacterial sludge into another tube of YPD medium inoculated with 1% Saccharomyces cerevisiae, and detect the relative quantification of Saccharomyces cerevisiae. The upstream primer (5’-3’) of Saccharomyces cerevisiae selected in this experiment: GACTGCTTACCGCCATCGTA; the downstream primer (5’-3’): TGATGATGTGGTCGTGGGTG. Use a fungal genomic DNA extraction kit to extract the DNA of Saccharomyces cerevisiae, and quantitatively detect the DNA of the control group (YPD medium inoculated only with 1% Saccharomyces cerevisiae) and Saccharomyces cerevisiae added with the bacterial sludge with the above primers.

[0048] Refer to Figure 4 , the gene expression level of Saccharomyces cerevisiae added with the bacterial sludge of Lactobacillus paracasei ZY is relatively higher, proving that the bacterial sludge of Lactobacillus paracasei ZY can promote the increase in the content of Saccharomyces cerevisiae.

[0049] In summary, Lactobacillus paracasei ZY has the ability to promote the growth of Saccharomyces cerevisiae.

[0050] Example 4

[0051] Mix Lactobacillus paracasei ZY with 1% and Saccharomyces cerevisiae for mixed fermentation to obtain a mixed bacterial seed solution. Inoculate the mixed bacterial seed solution into ordinary feed and ferment at room temperature above 20 °C for 48 hours to make the finished feed.

[0052] The finished feed has better palatability and digestion promotion than the feed fermented only with Saccharomyces cerevisiae. It can enhance the body's immunity by maintaining the balance of intestinal flora and has a better flavor.

[0053] Example 5

[0054] In addition to the above characteristics, Lactobacillus paracasei ZY of the present invention also has acid tolerance, bile salt tolerance, colonization in the animal body, good probiotic potential, strong inhibitory effects on pathogenic microorganisms such as Escherichia coli and Salmonella, the ability to produce acid, strong antioxidant capacity, promotion of feed digestion, and promotion of intestinal health.

[0055] 1. Acid tolerance ability:

[0056] Adjust six MRS liquid media to pH concentrations of 1, 2, 3, 4, 5, and 6 with hydrochloric acid respectively. Inoculate the Lactobacillus paracasei ZY seed solution at 1% into 30 - 50 mL of sterilized acidic MRS liquid medium and place it in an anaerobic bag. Incubate it in a constant temperature incubator at 37 °C. Take out 100 - 200 μL / plate of the bacterial solution for plate coating and viable cell counting respectively.

[0057] Results: Lactobacillus paracasei ZY can grow for 4 hours at acidic concentrations with pH of 4, 5, and 6. When pH is 3, Lactobacillus paracasei ZY can tolerate for 4 hours with a survival rate of 10.87%; when pH is 2, it can tolerate for 3 hours with a survival rate of 13.04%; when pH is 1, it can tolerate acid for 2 hours with a survival rate of 14.70%.

[0058] The results show that Lactobacillus paracasei ZY has acid tolerance.

[0059] 2. Bile salt tolerance:

[0060] Add porcine bile salt to the MRS liquid medium at concentrations of 0.1%, 0.2%, 0.3% (0.1, 0.2, 0.3 g / mL), place it in an anaerobic bag, and incubate it in a constant temperature incubator at 37 °C. Take it out for plate coating and viable cell counting after 2, 3, and 4 hours of incubation, and record the tolerance results.

[0061] The results are shown in Table 1 below:

[0062] Table 1 Bile salt tolerance results

[0063]

[0064] Referring to Table 1, Lactobacillus paracasei ZY can tolerate 0.1% bile salt for 4 hours. The results show that Lactobacillus paracasei ZY has a certain bile salt tolerance.

[0065] 3. Acid production capacity:

[0066] The Lactobacillus paracasei ZY seed liquid was inoculated into 30-50 mL of sterilized MRS liquid medium at 1%, and placed in an anaerobic bag in a constant temperature incubator at 37° C. The bag was taken out every 1.5-2 hours, shaken well, and 100-200 μL of the bacterial liquid was taken for measurement with a pH meter.

[0067] Results: Lactobacillus paracasei ZY produced acid uniformly from 4 to 16 hours, which gradually reduced the pH of the MRS medium. After 16 hours, the pH dropped very slowly and remained almost unchanged, with the pH fluctuating between 0.8 and 1.0.

[0068] 4. Antibacterial ability:

[0069] (1) In vitro antibacterial assay: Escherichia coli K88 / K99, Salmonella typhimurium SL1344, and Staphylococcus aureus 25923 were selected as pathogen indicator bacteria. The antibiotic used was 0.5 mg / mL of doxycycline. The control was physiological saline (0.9% sodium chloride). Lactobacillus paracasei ZY was cultured to 10 8 CFU / mL was used for the Oxford cup antibacterial test.

[0070] The results are shown in Table 2:

[0071] Table 2 Antibacterial results (antibacterial diameter, mm)

[0072]

[0073] Table 2 shows the antibacterial effects of Lactobacillus paracasei ZY and doxycycline, which are shown in terms of antibacterial diameter (mm). The results show that Lactobacillus paracasei ZY can inhibit the growth of Escherichia coli, Salmonella typhimurium and Staphylococcus aureus.

[0074] (2) Inhibition of intestinal pathogens in mice in vivo: Lactobacillus paracasei ZY was orally administered to 5-week-old C57BL / 6 mice for 14 days, and the feces of the mice were collected, diluted with sterile PBS, and then spread on MacConkey medium and cultured in a 37°C incubator for 24-48 hours. The large red colonies that grew were Escherichia coli, and the small black colonies were Salmonella.

[0075] The number of Salmonella and Escherichia coli in the fecal suspension of mice gavaged with saline (control group) and mice gavaged with Lactobacillus paracasei ZY (Lactobacillus paracasei ZY group) at the same concentration, see Figure 5, The results showed that Lactobacillus paracasei ZY could inhibit the colonization and growth of Escherichia coli and Salmonella in vivo, and reduce the colony counts of Escherichia coli and Salmonella in feces.

[0076] 5. The common Lactobacillus paracasei with the same sequence as Lactobacillus paracasei ZY was used as a control strain, and prokaryotic transcriptome sequencing was carried out respectively.

[0077] Refer to Figure 6 a. Compared with Lactobacillus casei, Lactobacillus paracasei ZY had higher transcriptional levels of antioxidant enzyme genes and detoxification-related genes. The genes encoding NADH oxidoreductase and flavoprotein oxidoreductase regulated the intracellular redox state, and flavoprotein oxidoreductase maintained the normal progress of various metabolic processes in the cell. The results showed that Lactobacillus paracasei ZY had stronger antioxidant ability.

[0078] Refer to Figure 6 b. Compared with common Lactobacillus paracasei, Lactobacillus paracasei ZY had a lower malondialdehyde level, indicating that Lactobacillus paracasei ZY had stronger antioxidant ability.

[0079] The above results showed that Lactobacillus paracasei ZY had stronger antioxidant ability. This Lactobacillus paracasei ZY could withstand the complex intestinal environment, was more likely to colonize and inhibit the growth of pathogenic bacteria, and had the potential to resist the dysbiosis caused by the imbalance of intestinal homeostasis.

[0080] Although the specific embodiments of the present invention have been described above, those skilled in the art of this technology should understand that the specific embodiments we described are illustrative rather than used to limit the scope of the present invention. Effective modifications and changes made by those skilled in the art in accordance with the spirit of the present invention should be covered by the scope protected by the claims of the present invention.

Claims

1. A Lactobacillus paracasei ZY, characterized in that: The deposit number of the Lactobacillus paracasei ZY is CGMCC No.30303.

2. Use of Lactobacillus paracasei ZY according to claim 1 in regulating intestinal iron balance.

3. The use according to claim 2, characterized in that: Application of the Lactobacillus paracasei ZY in preparing animal feed.

4. The use according to claim 2, characterized in that: The application of the Lactobacillus paracasei ZY as an animal feed additive.

5. Use of Lactobacillus paracasei ZY according to claim 1 in promoting the growth of Saccharomyces cerevisiae.

6. The use according to claim 5, characterized in that: Application of the Lactobacillus paracasei ZY in the preparation of fermented products.

7. The use according to claim 6, characterized in that: Application of the Lactobacillus paracasei ZY in the preparation of fermented feed products.

Images