Application of KASP molecular marker and primer composition thereof in detection of wheat grain filling rate
By developing the KASP labeled AX-110915909-KASP and related primer compositions, the problem of difficult to detect and select high wheat grain grouting rate varieties in the prior art is solved, and the effect of effectively assisting selection and breeding in multiple environments is achieved and the wheat yield is improved.
Patent Information
- Application Number
- CN202510247771.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-04
- Publication Date
- 2025-06-17
AI Technical Summary
The prior art is difficult to effectively detect and select varieties with high wheat grain grouting rates, especially when facing adverse meteorological conditions, which affect wheat yield and commerciality.
A KASP molecular marker was developed, using the 660K SNP chip marker AX-110915909 to convert to the KASP marker AX-110915909-KASP, combined with specific primer compositions and kits, for detecting the genotype of base 746360186 on the wheat 3A chromosome, thereby assisting in the selection of varieties with high grouting rates.
By verifying the phenotype data of grain grouting rate of wheat varieties in multiple environments, the results showed that materials with genotype TT were significantly higher than materials with genotype GG, proving that the KASP marker AX-110915909-KASP can be used for effective assisted selection breeding and improve wheat yield.
Smart Images
Figure CN120158544A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular genetic breeding, and particularly relates to the application of a KASP molecular marker and its primer composition in detecting the high or low grain filling rate of wheat grains. Background Art
[0002] Improving wheat yield per unit has always been an important goal of wheat breeding. The grain filling rate (GFR) is a key factor affecting the grain filling process and determining the final grain weight. Therefore, improving GFR is an important way to increase wheat yield per unit. In production, during the late growth stage of wheat, it is prone to adverse meteorological conditions such as dry hot winds or high-temperature forcing ripening, which can lead to insufficient grain filling of wheat grains, ultimately resulting in wheat yield reduction and decreased grain commerciality. In recent years, with global warming and frequent extreme weather, the wheat growth period will be more vulnerable to adverse meteorological factors such as high temperature and drought. Therefore, in future wheat breeding, more attention should be paid to the selection of varieties with higher grain filling rates to ensure that wheat grains complete the grain filling process at a faster speed, thereby avoiding the influence of adverse meteorological factors in the later stage of grain filling.
[0003] The wheat grain filling rate is a typical quantitative genetic trait controlled by multiple genes. Aggregating multiple excellent grain filling rate genes is of great significance for increasing wheat yield. Molecular marker-assisted selection is an auxiliary breeding method that uses molecular markers linked or co-segregating with functional genes to conduct directional selection on specific traits. It can quickly detect and track key gene loci of target traits, accelerate the breeding process, and shorten the breeding cycle. Therefore, exploring more molecular markers closely linked or co-segregating with wheat grain filling rate regulatory genes or quantitative trait loci (QTL) is the key to realizing the genetic improvement of wheat GFR.
[0004] Previous studies have mapped multiple QTL loci controlling traits related to grain filling rate through methods such as linkage analysis or genome-wide association analysis. For example, Yu et al. (2022) and Sun Xiaoxiao (2018) used an RIL population and a natural population to conduct linkage analysis and association analysis on wheat GFR and grain traits such as grain weight, and mapped two QTLs regulating the average grain filling rate (GFR mean ) on chromosome 4B, and one QTL regulating the maximum grain filling rate (GFR max ) on chromosome 2B. Hu Wenjing et al. (2020) used a four-parent RIL population and combined with a wheat 15K SNP chip to conduct QTL mapping of GFR-related gene loci in materials such as Yangmai 16, and mapped 5 GFR-related QTLs on chromosomes 3AL, 4DL, 6AL, and 7AL. Among them, the QTL located on chromosome 3A regulating GFR meanQTL QGFR Mean -yaas-3AL is associated with the regulation of GFR max QTL QGFR Max -yaas-3AL are genetically located at 576.2 and 576.1 cM respectively, with flanking linked markers AX108872401 and AX86165946, and the physical interval corresponding to the Chinese Spring reference genome version V1.0 is 659.4 - 660.4 Mb.
[0005] Single nucleotide polymorphism (SNP) is the most common form of genetic variation in plants and an ideal molecular marker type for plant genetic research. Currently, there are various SNP genotyping methods, such as sequencing, solid-phase chip, CAPS marker, KASP (Kompetitive Allele Specific PCR) marker, STARP marker, etc. Among them, the solid-phase chip method integrates a large number of SNP flanking sequences as probe sequences into a solid-phase probe array, which can simultaneously determine the genotypes of a large number of SNP markers in one experiment, but its detection cost is relatively high. Currently, commonly used solid-phase SNP chips in wheat include 820K, 660K, 90K, 55K, 15K and other chips. Among them, the 660K SNP chip contains more than 660,000 SNP marker information. KASP markers are based on the principle of competitive allele-specific PCR. By designing primer pairs with different bases at the 3' end, the semi-conservative replication property of Taq enzyme is used to achieve allelic competitive amplification. Its characteristics include: only requiring a small amount of DNA (ng level), fast genotyping speed (2 - 4 h), low cost, flexible polymorphism detection, and it can achieve high-throughput detection of a single SNP marker in a single experiment, suitable for SNP genotyping and genetic diversity research, especially suitable for the field of plant molecular breeding.
[0006] A large number of studies have shown that during the wheat grain filling process, the dry matter accumulation shows an "S" - shaped curve change characteristic, which can be fitted by the Logistic equation. According to the "S" - shaped curve characteristic of grain filling, the whole filling process can be divided into three periods: the gradual increase period, the rapid increase period, and the slow increase period. The average grain filling rate (GFR mean ) is an important index to measure the speed of grain filling. Wang Wenwen et al. (2012) showed that GFR mean has a very high correlation with the thousand - grain weight. The rapid increase period is the period with the fastest dry matter accumulation rate of grains. Miao Yongjie et al. (2018) showed that the speed of the grain filling rate (GFR2) in the rapid increase period is the main reason for the difference in grain weight among varieties. During the whole filling process, the grain filling rate can reach the maximum value in the rapid increase period, that is, the maximum grain filling rate (GFR max), which is highly positively correlated with GFR2.
[0007] Yangmai 16 is a spring mid-maturing variety bred by the Lixiahe Area Agricultural Science Research Institute of Jiangsu Province, which has the characteristics of fast grain filling, good maturity appearance, and high yield. Zhongmai 895 is a semi-winter multi-ear mid-late maturing variety jointly bred by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences and the Institute of Cotton Research, Chinese Academy of Agricultural Sciences, which has the characteristics of long leaf functional period, strong tillering ability, fast grain filling speed, high temperature tolerance at the later stage, and high yield. Exploring the excellent gene loci regulating GFR carried by these two materials and developing related molecular markers are of great significance for molecular breeding of wheat yield. Summary of the Invention
[0008] Object of the Invention: The first object of the present invention is to provide an application of a KASP molecular marker in detecting the high or low wheat grain filling rate. The second object of the present invention is to provide a primer composition for detecting the above KASP marker and a kit containing the primer composition. The third object of the present invention is to provide the application of the above KASP marker primer composition and kit in detecting the high or low wheat grain filling rate and wheat breeding. The fourth object of the present invention is to provide a method for detecting the high or low wheat grain filling rate.
[0009] Technical Solution: The present invention provides an application of a KASP molecular marker in detecting the high or low wheat grain filling rate. The KASP molecular marker corresponds to the base at position 746360186 on the sense strand of chromosome 3A of the Chinese Spring wheat reference genome version V1.0. There are two allelic variations at this position base, namely T and G;
[0010] If the detected genotype is TT, it means the wheat contains a relatively high grain filling rate. If the detected genotype is GG, it means the wheat contains a relatively low grain filling rate.
[0011] This patent uses a doubled haploid (DH) population derived from the hybrid combination "Yangmai 16 / Zhongmai 895" as the material, and constructs a high-density genetic map for QTL mapping of wheat GFR-related traits using the genotype data of the wheat 660K SNP chip. A stable major QTL regulating wheat GFR was mapped on the long arm of chromosome 3A, named QGFR.yzu-3AL. The flanking markers on both sides are AX-111464109 and AX-110915909 respectively. The allelic variations of the two markers are located at the 745520914th and 746360186th bases on chromosome 3A in the Chinese Spring wheat reference genome version V1.0. On this research basis, this patent transformed the 660K SNP chip marker AX-110915909 within the QGFR.yzu-3AL genetic interval into a KASP marker AX-110915909-KASP that can achieve high-throughput, low-cost, and low error rate genotype identification, and verified the effectiveness and reliability of this KASP marker-assisted discrimination of high and low wheat grain filling rates using a natural population material composed of wheat materials from the Huang-Huai wheat region.
[0012] The SNP marker AX-110915909 described in the present invention is a marker in the wheat 660K SNP chip, and its flanking sequence is SEQ ID NO.1 in the sequence listing. The 36th base is A or C. This flanking sequence is the reverse complementary sequence of the base sequence from the 746360151st to 746360221st on the sense strand of chromosome 3A in the Chinese Spring wheat reference genome version V1.0. This molecular marker locus corresponds to the 746360186th base on the sense strand of chromosome 3A in the Chinese Spring wheat reference genome version V1.0, and the corresponding allelic variations in the sense strand are T or G.
[0013] The present invention also provides a KASP marker primer composition, which is used to detect the genotype corresponding to the 746360186th base on the sense strand of chromosome 3A in the Chinese Spring wheat reference genome version V1.0, and includes primer sequences with nucleotide sequences as shown in SEQ ID NO.2-4.
[0014] Furthermore, the primer composition can also be the single-stranded DNA of the 22nd-52nd positions of SEQ ID NO.2, the single-stranded DNA of the 22nd-52nd positions of SEQ ID NO.3, and SEQ ID NO.4.
[0015] The present invention also provides a kit, which contains the above-mentioned KASP marker primer composition.
[0016] Furthermore, the kit also contains KASP 2×Master Mix and sterile water.
[0017] The present invention also provides the application of the above-mentioned KASP marker primer composition and kit in detecting the high or low grain filling rate of wheat grains.
[0018] The present invention also provides the application of the above-mentioned KASP marker primer composition and kit in wheat breeding, and the wheat breeding is to cultivate wheat with a high grain filling rate.
[0019] Further, the application is to use a wheat material with a genotype of TT as a parent to hybridize with a material with a genotype of TT or TG or GG, and then detect again in the segregating generation, and select a material with a genotype of TT or TG until a single plant or line or strain or variety with a genotype of TT is selected.
[0020] The present invention also provides a method for detecting the high or low grain filling rate of wheat grains, which includes the following steps: using the genomic DNA of the wheat to be tested as a template, performing PCR amplification with the above-mentioned KASP marker primer composition, and detecting the genotype types corresponding to the base at position 746360186 on the sense strand of chromosome 3A of wheat. If the detected genotype is TT, it indicates that the wheat has a relatively high grain filling rate; if the detected genotype is GG, it indicates that the wheat has a relatively low grain filling rate.
[0021] Further, the reaction program of the PCR amplification is pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s, annealing and extension at 65–57°C for 60 s, with a decrease of 1°C in each cycle, for a total of 9 cycles; denaturation at 95°C for 20 s, annealing and extension at 57°C for 1 min, for 32 cycles.
[0022] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: The present invention uses the phenotypic data of wheat grain filling rate of a set of wheat materials in the Huanghuai wheat region under multiple different environments (4 different environments and the best linear unbiased estimator based on the phenotypic data of each environment) to verify the effectiveness and reliability of the KASP marker AX-110915909-KASP. The test results show that in all environments, the grain filling rate (including: the maximum grain filling rate GFR max 、the average grain filling rate GFR mean 、the grain filling rate GFR2 during the rapid increase period) of the materials with a genotype of TT of AX-110915909 is significantly (P<0.01 or P<0.001) higher than that of the materials with a genotype of GG. The KASP molecular marker AX-110915909-KASP of the present invention can be effectively used for molecular marker-assisted selection breeding of the major QTL QGFR.yzu-3AL for wheat grain filling rate. Description of the Drawings
[0023] Figure 1 It is a genetic linkage map near the QTL QGFR.yzu-3AL for grain filling rate in the Yangmai 16 / Zhongmai 895 DH population constructed using wheat 660K SNP chip markers. The values on the left side of the figure represent the genetic distances between adjacent markers, with the unit of cM; the cyan block represents the genetic interval of QGFR.yzu-3AL, and the markers marked in red font are the flanking markers of QTL detected in multiple environments.
[0024] Figure 2 It is a schematic diagram of the multiple sequence alignment results of the flanking sequences of the SNP marker AX-110915909 and its homologous sequences, as well as the position of the sequence-specific binding section of the primer set of the KASP marker AX-110915909-KASP. For the convenience of sequence alignment, the flanking sequence of the SNP marker AX-110915909 uses the reverse complementary sequence with the 36th base being C in SEQ ID NO.1 in the sequence listing. The base sequences of sequences 5, 6, 7, 8, 9, 10, and 11 in the figure are the same as the corresponding sequences in the sequence listing.
[0025] Figure 3 It is the detection result of the KASP marker AX-110915909-KASP on Zhongmai 895, Yangmai 16, and some DH population families.
[0026] Figure 4 It is the detection result of the KASP marker AX-110915909-KASP on some wheat varieties in the natural population.
[0027] Figure 5 It is the T-test result of the phenotypic values of grain filling rate of two genotype materials in 154 wheat varieties in the natural population detected by the KASP marker AX-110915909-KASP under different environments. E1 and E2 are the experimental sites in Yangzhou and Hai'an in the 2021-2022 year, and E3 and E4 are the experimental sites in Yangzhou and Suqian in the 2022-2023 year; BLUE is the best linear unbiased estimation (Best Linear Unbiased Estimation) of the phenotypic values in 4 environments. GFR max 、GFR mean 、GFR2 represent the maximum grain filling rate, average grain filling rate, and grain filling rate during the rapid increase period of grains, respectively. ** and *** indicate significant differences at P<0.01 and P<0.001 conditions, respectively. Specific implementation manners
[0028] The technical solutions of the present invention will be further described below with reference to the accompanying drawings.
[0029] The following embodiments describe the principles and features of the present invention. The examples are given to better understand the present invention, but do not limit the scope of the present invention.
[0030] In the experimental methods in the following embodiments, unless otherwise specified, they are all conventional methods.
[0031] The test materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0032] The primers used were synthesized by Beijing Tsingke Biotechnology Co., Ltd.
[0033] The wheat varieties used can all be obtained from the National Wheat Improvement Center.
[0034] In the following quantitative tests, the number of grains and grain weight were measured using the Wanshen SC-G automatic seed counting and thousand-grain weight instrument developed by Hangzhou Wanshen Detection Technology Co., Ltd.
[0035] In the quantitative tests in the following embodiments, three biological replicate experiments were set, and the results were averaged.
[0036] Example 1: Obtaining of SNP marker AX-110915909 of the major-effect QTL QGFR.yzu-3AL for wheat grain filling rate and its KASP marker primer set
[0037] Test materials: Zhongmai 895 and Yangmai 16 are respectively one of the main promoted varieties in the Huanghuai wheat region and the middle and lower reaches of the Yangtze River winter wheat region in China, with excellent comprehensive agronomic traits. In this study, Yangmai 16 was used as the female parent and Zhongmai 895 as the male parent, and a DH population containing 174 families was constructed using wheat-maize hybridization technology.
[0038] Field experiments: The DH population was planted in the experimental bases in Yangzhou and Hai'an, Jiangsu in 2021–2022, and in the experimental bases in Yangzhou and Suqian, Jiangsu in 2022–2023. The field experiments were all designed in a randomized block design, with three replicates, and were planted in a plot sowing method. Each plot had 4 rows, with a row length of 1.5 m and a row spacing of 25 cm (Yangzhou and Hai'an test sites) or 20 cm (Suqian test site). Field management was carried out with reference to the local test management methods.
[0039] Record the flowering period of all materials in the field in detail. When visible anthers appear on 50% of the spikes, record the specific flowering date, and label more than 40 flowering spikes with the same growth status for each family. Collect samples on the 10th, 15th, 20th, 25th, 30th, 35th day after flowering and at maturity, and randomly select 5 labeled spikes in each plot. As soon as the spikes are taken off, blanch them at 105 °C for 30 min, and then dry them at 80 °C for 20 h until constant weight. Thresh manually to avoid grain loss. Use the Wanshen SC-G type full-automatic seed analyzer and thousand-grain weight meter (Hangzhou Wanshen Testing Technology Co., Ltd.) to measure the total grain weight, total grain number and thousand-grain weight of each sample, and operate according to the instrument operation procedures. In this study, the ProcNLIN program in SAS 9.2 software was used to fit the Logistic filling curve for the dry weight of thousand-grain weight at different time points, and the filling parameters of each family were calculated according to the fitted Logistic curve. The Logistic equation is Y = k / (1 + ae –bX )), where X is the time after flowering, Y is the dry weight of thousand-grain weight corresponding to time point X, e is the base of the natural logarithm function, and a, b, k are parameters to be determined. By taking the derivative of the equation and performing related calculations, GFR max , GFR mean , GFR2 and other filling parameters can be obtained. Among them, the maximum grain filling rate GFR max = bk / 4; the average grain filling rate GFR mean is the dry weight of thousand-grain weight at maturity divided by the filling duration; the grain filling rate (GFR2) during the rapid increase period is the difference in the dry weight of thousand-grain weight between two time points obtained by the first-order derivative divided by this period.
[0040] Genetic map construction: The genetic linkage map of the Yangmai 16 / Zhongmai 895 DH population in this study refers to the map constructed by Xu et al. (2019). The map contains a total of 148,179 SNP markers, with a total genetic distance of 3681.73 cM and an average distance between adjacent markers of 0.25 cM. Based on this map, the markers between marker AX-109297719 and marker AX-109015144 on chromosome 3A were optimized. That is, using the map function of Ici Mapping V4.0 software, sort each marker according to its physical position (which can be obtained from the wheat multi-omics database website http: / / 202.194.139.32 / ), and then calculate the genetic distance between each marker using the default parameters.
[0041] QTL mapping and discovery of linked marker AX-110915909: Using QTL IciMapping V4.0 software (Meng et al., 2015), the inclusive composite interval mapping method (ICIM) was adopted to map QTLs for grain filling rate of 174 DH population families grown in different environments. An LOD value of 3.0 was selected as the threshold. The mapping results showed that there was a major QTL ([ Figure 1 ) controlling grain filling rate on the long arm of chromosome 3A, with flanking markers AX-111464109 and AX-110915909 respectively. The positions of the allelic variations of the two markers on the Chinese Spring wheat reference genome version V1.0 were the 745520914th and 746360186th base pairs on chromosome 3A. The allele increasing the effect of this QTL came from Zhongmai 895, with an LOD value of 3.6–5.4, explaining 3.7%–5.6% of the phenotypic variation. This locus was designated as QGFR.yzu-3AL. Through a large number of sequence analyses, alignments and preliminary experiments, it was found that the flanking sequence of SNP marker AX-110915909 was specific on chromosome 3A. Therefore, an attempt was made to convert it into a KASP marker for molecular marker-assisted selection breeding.
[0042] Obtaining the primer set for the KASP marker AX-110915909-KASP: The flanking sequence of the SNP marker AX-110915909 is shown as SEQ ID NO.1: 5’–ATCAAACAATGGGAATAGCTTTGACTTCAATAATAATCTCTGAATGGTACAATGTGTTCACCGATATGCTC–3’. There are two polymorphic single nucleotides A or C at the 36th nucleotide of this sequence, that is, the base at this position is A or C in actual wheat materials. An extended sequence (SEQ ID NO.5) containing the reverse complementary sequence of the flanking sequence of the SNP marker AX-110915909 was obtained from the Wheat Omics database website (WheatOmics 1.0, http: / / 202.194.139.32 / ). This extended sequence is the base sequence from the 746360151st to the 746360273rd of the plus strand of chromosome 3A in the Chinese Spring reference genome version V1.0. Using SEQ ID NO.5 for BLAST search in the International Wheat Genome Sequencing Consortium (IWGSC; https: / / wheat-urgi.versailles.inra.fr / ), 6 homologous sequences with high identity to SEQ ID NO.5 were obtained, which are SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11 respectively, and they are located on wheat chromosomes 1B, 2A, 4B, 4D, 5D, and 7D respectively. Multiple sequence alignment was performed on the above homologous sequences ( Figure 2 ), and according to the general principles of chromosome specificity and KASP primer design, a set of KASP primers was designed, which consists of primer A (SEQ ID NO.2), primer B (SEQ ID NO.3), and primer C (SEQ ID NO.4). The third base from the end of the 3’ end of the two competitive primers (primer A and primer B) (the penultimate G base of primer A; the penultimate T base of primer B) corresponds to the allelic variant bases C or A of the flanking sequence of the SNP marker AX-110915909, and the common primer (primer C) ensures the chromosome 3A specificity of PCR amplification. Fluorescent tag sequences are connected to the 5’ ends of the two competitive primers. Among them, the 5’ end of primer A is connected with the FAM fluorescent tag sequence: 5’–GAAGGTGACCAAGTTCATGCT–3’, and the 5’ end of primer B is connected with the HEX fluorescent tag sequence: 5’–GAAGGTCGGAGTCAACGGATT–3’. The KASP marker AX-110915909-KASP and its primer set developed based on the SNP marker AX-110915909 within the major QTL interval for wheat grain filling rate consist of primer A, primer B, and primer C.
[0043] Example 2: Establishment of a method for detecting the genotype of SNP marker AX-110915909 using KASP markers
[0044] Detecting the parents and some families of the Yangmai 16 / Zhongmai 895 DH population using the primer set of KASP marker AX-110915909-KASP
[0045] 1. Extract the genomic DNA of the parents and some families of the Yangmai 16 / Zhongmai 895 DH population by the CTAB method, and dilute it to obtain a template solution with a DNA concentration of about 30 ng / μL.
[0046] 2. Using the genomic DNA extracted in step 1 as a template, perform PCR amplification with the KASP marker primer set described in Example 1 for detecting the SNP marker AX-110915909 in wheat to obtain an amplification product.
[0047] Preparation of the KASP marker primer working solution:
[0048] Take 12 μL (100 μM) of each of the two competitive primers (primer A and primer B), take 30 μL (100 μM) of the common primer (primer C), and supplement it to 100 μL with sterile ultrapure water, and mix well to prepare the primer working solution of the KASP marker for standby.
[0049] PCR amplification reaction system: containing 2 μL (about 30 ng / μL) of DNA template, 0.08 μL of primer working solution, 2.5 μL of KASP 2× Master Mix (LGC, catalog number: KBS-1016-002), and supplement it to 5 μL with sterile ultrapure water. Among them, KASP 2× Master Mix consists of fluorescent probe A, fluorescent probe B, quenching probe A and quenching probe B, as well as high-fidelity Taq enzyme, dNTP, Mg 2+ etc. The nucleotide sequence of fluorescent probe A is: 5’–GAAGGTGACCAAGTTCATGCT–3’, and a FAM fluorescent group is connected to its 5’ end; the nucleotide sequence of fluorescent probe B is: 5’–GAAGGTCGGAGTCAACGGATT–3’, and a HEX fluorescent group is connected to its 5’ end; the nucleotide sequence of quenching probe A is: 5’–AGCATGAACTTGGTCACCTTC–3’, and a quenching group BHQ is connected to its 3’ end; the nucleotide sequence of quenching probe B is: 5’–AATCCGTTGACTCCGACCTTC–3’, and a quenching group BHQ is connected to its 3’ end;
[0050] The PCR reaction procedure is as follows: In the first step, pre-denaturation is performed at 95°C for 15 min; in the second step, denaturation is carried out at 95°C for 20 s, annealing and extension are performed at 65–57°C (decreasing by 1°C per cycle) for 60 s, with a total of 9 cycles; in the third step, denaturation is carried out at 95°C for 20 s, annealing and extension are performed at 57°C for 1 min, with 32 cycles; and it is stored at 10°C.
[0051] 3. Fluorescence signal scanning of PCR amplification products:
[0052] The PCR amplification products are scanned using a multifunctional microplate reader. The excitation wavelength of FAM is 485 nm and the emission wavelength is 520 nm; the excitation wavelength of HEX is 535 nm and the emission wavelength is 556 nm, and the excitation wavelength of the system reference fluorescence ROX is 575 nm and the emission wavelength is 610 nm.
[0053] 4. Allele genotyping:
[0054] The Kluster Caller software is used to analyze the data scanned by the microplate reader (for the specific method, refer to the KlusterCaller software instruction manual, which can be obtained by the public from LGC Company). According to the analysis results, the genotype of the wheat SNP marker AX-110915909 to be detected is determined as follows: The fluorescence signal data of the amplification products of the wheat to be detected, after being analyzed by the Kluster Caller software and clustered, the genotype of the samples near the X-axis and far from the coordinate origin in the fluorescence signal coordinate system of the genotyping result is the allele genotype linked to the FAM fluorescence tag sequence; the genotype of the samples near the Y-axis and far from the coordinate origin is the allele genotype linked to the HEX fluorescence tag sequence.
[0055] The above KASP marker primer set is used to detect the genotypes of the parents and some families of the Yangmai 16 / Zhongmai 895 DH population. The genotyping results are as Figure 3 shown. Specifically: The fluorescence signal data of the amplification products of the wheat to be detected, after being analyzed by the Kluster Caller software and aggregated, the samples near the X-axis and far from the coordinate origin ( Figure 3 sample set 1 in it), have the genotype GG, including the parent Yangmai 16; the fluorescence signal data of the amplification products, after being analyzed by the Kluster Caller software and aggregated, the samples near the Y-axis and far from the coordinate origin ( Figure 3 sample set 2 in it), have the genotype TT, including the parent Zhongmai 895.
[0056] Example 3. Application of using the KASP marker AX-110915909-KASP to assist in identifying the grain filling rate of wheat in breeding
[0057] 1. Test materials and phenotypic determination
[0058] The experimental materials included 154 wheat varieties from the Huanghuai wheat region (Table 1).
[0059] Determination of grain filling rate: The 154 wheat varieties were planted in the experimental bases of Yangzhou and Hai'an in Jiangsu Province during 2021–2022, and in the experimental bases of Yangzhou and Suqian in Jiangsu Province during 2022–2023. The field experiments were all designed in a randomized block design with three replicates. The plot sowing method was adopted for planting. Each plot had 4 rows, with a row length of 1.5 m and a row spacing of 25 cm (Yangzhou and Hai'an experimental sites) or 20 cm (Suqian experimental site). The field management referred to the local experimental management methods. The method described in Example 1 was used to analyze and determine the grain filling rate of each experimental material (the maximum grain filling rate GFR max of grains, the average grain filling rate GFR mean of grains, and the grain filling rate GFR2 during the rapid increase period). The mean values of three replicates were taken for statistical analysis.
[0060] 2. Detection of each experimental material with the KASP marker AX-110915909-KASP primer set:
[0061] According to the method described in Example 2, the genomic DNA of each experimental material was extracted, and the genotype of each experimental material was analyzed using the above high-throughput molecular marker detection system. The detection results are as Figure 4 shown. Specifically, the genotype results of 154 wheat varieties are listed in Table 1, among which the genotypes of 80 wheat varieties are GG, and the genotypes of 74 wheat varieties are TT. The BLUE values (Best Linear Unbiased Estimates) of the grain filling rate phenotypes of 154 wheat varieties in 4 environments (Yangzhou and Hai'an in 2021 - 2022; Yangzhou and Suqian in 2022 - 2023) are also listed in Table 1. The PROCTTEST program in the internationally common SAS 9.2 statistical software was used to conduct a T-test analysis on the phenotypic data and BLUE values of 154 wheat varieties in 4 environments. The results showed that in 4 environments and when analyzed using BLUE values, the grain filling rate (GFR max , GFR mean , GFR2) of the materials with the genotype TT was significantly (P<0.01 or P<0.001) higher than that of the materials with the genotype GG( Figure 5 ), indicating that the above KASP marker AX-110915909-KASP primer set and genotype detection system can be effectively used for molecular-assisted selection breeding aiming at improving the grain filling rate of wheat.
[0062] Table 1. Genotypes of 154 wheat varieties detected with the KASP marker AX-110915909-KASP and the Best Linear Unbiased Estimates of their grain filling rate phenotypic values in 4 different environments
[0063]
[0064]
[0065]
[0066]
[0067]
Claims
1. An application of KASP molecular marker in detecting the filling rate of wheat grains, characterized in that: The KASP molecular marker corresponds to the 746360186th base on the positive strand of chromosome 3A of the Chinese spring wheat reference genome V1.0, and there are two allelic variations of the base at this position, namely T and G; If the detected genotype is TT, the detected wheat has a relatively high grain filling rate, and if the detected genotype is GG, the detected wheat has a relatively low grain filling rate.
2. A KASP labeled primer composition, characterized in that: The primer combination is used to detect the genotype of the 746360186th base on the positive strand of wheat chromosome 3A, and comprises primer sequences whose nucleotide sequences are shown as SEQ ID NOs. 2-4.
3. A kit, characterized in that: The kit contains the KASP labeling primer composition as claimed in claim 2.
4. The kit according to claim 3, characterized in that The kit also contains KASP 2x Master Mix and sterile water.
5. Use of the KASP labeled primer composition according to claim 2 and the kit according to any one of claims 3 to 4 in detecting the filling rate of wheat grains.
6. Use of the KASP labeled primer composition according to claim 2 and the kit according to any one of claims 3 to 4 in wheat breeding, characterized in that: The wheat breeding is to cultivate wheat with a high grain filling rate.
7. The use according to claim 6, characterized in that: The application is to use a wheat material with a detected genotype of TT as a parent to hybridize with a material with a genotype of TT, TG or GG, detect again in the separation generation, and select the material with a genotype of TT or TG, until a single plant or plant line or strain or variety with a genotype of TT is bred.
8. A method for detecting the filling rate of wheat grains, characterized in that: The method comprises the following steps: using the wheat genomic DNA to be tested as a template, performing PCR amplification using the KASP marker primer composition according to claim 2, detecting the genotype type corresponding to the 746360186th base on the positive strand of the wheat 3A chromosome, if the detected genotype is TT, the detected wheat has a relatively high grain filling rate, and if the detected genotype is GG, the detected wheat has a relatively low grain filling rate.
9. The method for detecting the filling rate of wheat grains according to claim 8, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s, 65–57°C for 60 s, decreasing by 1°C in each cycle, for a total of 9 cycles; denaturation at 95°C for 20 s, annealing and extension at 57°C for 1 min, for a total of 32 cycles.