Method for preparing bacterial expression liquid by using hyphantria cunea V-ATPase D gene hpRNA and application of bacterial expression liquid
By constructing the MS2+hpV-ATPase D expression vector to express the American white moth V-ATPase D gene hpRNA in bacteria and using MS2 protein to protect hpRNA, the problem of low internalization efficiency of RNAi technology in insect cells was solved, and efficient prevention and control of American white moth was achieved.
Patent Information
- Application Number
- CN202510319638.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-18
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2045-03-18
AI Technical Summary
The prior art has problems of environmental pollution, increased drug resistance and inefficiency in preventing and controlling American white moths. In particular, the RNAi technology has low internalization efficiency in insect cells, which limits its prevention and control efficiency.
By constructing the MS2+hpV-ATPase D expression vector, it was introduced into bacterial competent cells, and the hpRNA of the American white moth V-ATPase D gene was induced to express the bacterial expression solution, and the hpRNA was protected from degradation through MS2 protein, improving its stability and efficiency in insect cells.
It has achieved efficient lethality and development inhibition of American white moth, which is characterized by strong practicality, convenient operation, efficient and sensitiveness, and has significantly reduced the survival rate and larvae weight of American white moth.
Smart Images

Figure CN120173946A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preparing a bacterial expression solution by utilizing hpRNA of a V-ATPase D gene of the cunea Hyphantria cunea and an application thereof. Background Art
[0002] The American white moth (Hyphantria cunea) belongs to the Noctuidae family, subfamily Hyphantrinae of the Lepidoptera order. It is also called the fall curtain caterpillar and web curtain caterpillar. It has been listed as an international quarantine pest due to its strong reproductive ability, rapid spread, wide host range and serious damage. In view of the fact that the prevention and control of the gypsy moth is difficult, the current means of prevention and control of this pest include chemical prevention, manual prevention and biological prevention. Chemical prevention methods are characterized by rapid effectiveness and practicality. The prevention and control of the gypsy moth mainly include "eradicating" measures in the early stage of the outbreak and taking measures to spray a large amount of pesticides. However, the use of chemical prevention methods to prevent and control the gypsy moth will not only pollute the ecological environment, but also pose hidden dangers to the safety of humans and livestock. In addition, the long-term use of chemical agents will make the gypsy moth resistant to drugs, increasing the difficulty of future prevention and control. Manual prevention and control mainly includes manual deworming, grass trapping to lure pupae, manual pupae search and light trapping. Its advantages are simple and easy, with little pollution to the environment, but it is time-consuming and labor-intensive, and is not suitable for areas where large-scale outbreaks of gypsy moth occur. Biological control measures mainly include the use of natural enemies, biocontrol bacteria, Bacillus thuringiensis δ-endotoxin (Bt protein) and RNA interference (RNAi) for prevention and control. Research on biological control of the gypsy moth mainly focuses on natural enemies and the gypsy moth nuclear polyhedrosis virus HcNPV. In practical applications, certain results have been achieved in sex pheromones and biocontrol bacteria. Studies have found that natural enemies such as the parasitic wasp Zhou's gnawing wasp and baculovirus can effectively control the population of the gypsy moth, but there are few natural enemy species that can completely and effectively control the outbreak of the gypsy moth. When natural enemies are used to control the gypsy moth, it can only effectively prevent the outbreak of the gypsy moth, but the prevention and control cycle is long, and more natural enemy resources need to be discovered. Biocontrol bacteria are broad-spectrum insect pathogenic fungi, and their hosts include 15 orders such as Lepidoptera, Coleoptera, and Hymenoptera. Similar to the use of natural enemies to control the gypsy moth, the prevention and control cycle is long when biocontrol bacteria are used to control the gypsy moth, and it can only effectively prevent the outbreak of the gypsy moth. Bacillus thuringiensis is a Gram-positive soil bacillus that produces many proteins in the process of spore formation, which appear in the form of crystals, known as parasporal crystal proteins, which have specific insecticidal activity and have a good control effect on insects such as Lepidoptera, Diptera and Coleoptera. However, in recent years, more and more studies have reported that insects have developed resistance to it, resulting in a weakened control effect, and non-target pests such as blind bugs and spider mites have gradually become dominant pests due to the reduction in the amount of pesticides sprayed. As a new pest control method with strong target specificity, RNAi technology is a highly conserved self-defense mechanism in the process of eukaryotic evolution and is used to regulate gene expression in eukaryotic cells. It is a phenomenon of sequence-specific and transient gene silencing at the post-transcriptional level triggered by hpRNA, with high specificity and efficiency. At present, RNAi technology shows great potential in the prevention and control of various pests such as Lepidoptera, Hemiptera, Coleoptera, etc., and has also been proven to effectively reduce the expression level of target genes of the fall webworm, making it a potential means for fall webworm prevention and control. Similar to other Lepidoptera pests, the fall webworm intestine has highly active nucleases that can degrade hpRNA, and there may be problems with low efficiency of hpRNA internalization into insect cells. These two factors will severely limit the efficiency of RNAi in controlling Lepidoptera pests. Therefore, exploring the key target genes for RNAi control of the fall webworm and optimizing the hpRNA delivery method are crucial for the biological control of the fall webworm and the construction of future RNAi transgenic lines. Summary of the Invention
[0003] Technical problems to be solved: Aiming at the above technical problems, the purpose of the present invention is to provide a method for preparing a bacterial expression solution using the hpRNA of the fall webworm V-ATPase D gene. An MS2+hpV-ATPase D expression vector is constructed with the hpRNA fragment of the fall webworm V-ATPase D gene and the MS2 protein gene, and then it is introduced into bacterial competent cells. After IPTG induction, the hpRNA of the fall webworm V-ATPase D gene is continuously and highly expressed to obtain a bacterial expression solution. In the present invention, the MS2 protein gene can be expressed in bacterial competent cells to obtain the MS2 protein, which can protect the hpRNA of the fall webworm V-ATPase D gene from being degraded by nucleases and make it have good stability. In addition, by feeding the bacterial expression solution, it has a high lethality rate for the fall webworm and can significantly inhibit its development and reproduction. The present invention uses a bacterial expression solution containing the hpRNA of the fall webworm V-ATPase D gene to control the fall webworm, which has the characteristics of strong practicability, convenience, rapidity, high efficiency and sensitivity, and can provide a good theoretical basis for studying the control methods of the fall webworm.
[0004] Technical solution: An hpRNA of the fall webworm V-ATPase D gene, and the nucleotide sequence of the hpRNA of the fall webworm V-ATPase D gene is shown in SEQ ID NO.1. A method for preparing a bacterial expression solution using the hpRNA of the fall webworm V-ATPase D gene and its application, including the following steps: S1. Using the cDNA of the fall webworm as a template and dsV-ATPase-D primers for PCR amplification to obtain the hpRNA fragment of the fall webworm V-ATPase D gene; S2. Connect the hpRNA fragment of the Hyphantria cunea V-ATPase D gene to a plasmid to construct a hpV-ATPaseD expression vector; or connect the hpRNA fragment of the Hyphantria cunea V-ATPase D gene and the MS2 protein gene fragment to a plasmid to construct an MS2+hpV-ATPaseD expression vector. The plasmid maps of the hpV-ATPase D expression vector and the MS2+hpV-ATPase D expression vector are as Figure 1 shown; S3. Introduce the hpV-ATPase D expression vector or the MS2+hpV-ATPase D expression vector into competent bacterial cells for culture, induce the culture with IPTG and collect the bacterial liquid, which is the bacterial expression liquid. Furthermore, in step S1, the dsV-ATPase-D primers are dsV-ATPase-D-F and dsV-ATPase-D-R. Furthermore, the nucleotide sequence of the dsV-ATPase-D-F is as shown in SEQ ID NO.2. Furthermore, the nucleotide sequence of the dsV-ATPase-D-R is as shown in SEQ ID NO.3. Furthermore, the nucleotide sequence of the MS2 protein gene in step S2 is as shown in SEQ ID NO.4. Use of the bacterial expression liquid described in any one of the above in controlling Hyphantria cunea. Furthermore, control of Hyphantria cunea is achieved by spraying or feeding the bacterial expression liquid. Beneficial effects: 1. In the present invention, an important RNAi target gene, the V-ATPase D gene of Hyphantria cunea, is screened and obtained. Based on the hpRNA of the Hyphantria cunea V-ATPase D gene, a hpV-ATPase D expression vector is constructed by connecting it to a recombinant plasmid, and then it is introduced into competent Escherichia coli cells and successfully expressed the hpRNA of the Hyphantria cunea V-ATPase D gene by IPTG induction to obtain a bacterial expression liquid. Smearing it on leaves and feeding Hyphantria cunea can significantly reduce the survival rate and larval weight of Hyphantria cunea, thereby achieving the purpose of efficiently controlling Hyphantria cunea. 2. While ligating the hpRNA of the Hyphantria cunea V-ATPase D gene to the recombinant plasmid, the present invention can also ligate the MS2 protein gene to the plasmid to construct an MS2+hpV-ATPase D expression vector, which is introduced into competent Escherichia coli cells and successfully expresses the hpRNA of the Hyphantria cunea V-ATPase D gene and the MS2 protein after IPTG induction. Since there are highly active nucleases in the intestine of Hyphantria cunea that can degrade hpRNA, and the efficiency of hpRNA internalization into insect cells may be low, the hpRNA of the Hyphantria cunea V-ATPase D gene contains a PAC site and can be encapsulated by the MS2 protein inside it. Moreover, the MS2 protein self-assembles into nanoparticles, effectively preventing the degradation of the hpRNA of the Hyphantria cunea V-ATPase D gene and causing an effective RNAi response in Hyphantria cunea cells. 3. The method for controlling Hyphantria cunea using the bacterial expression solution containing the hpRNA of the Hyphantria cunea V-ATPase D gene of the present invention has strong practicability, convenient operation, high efficiency and sensitivity, and high insecticidal efficiency, which helps to expand new reference ideas for the control methods of Hyphantria cunea. Description of the Drawings Figure 1 Plasmid maps of the hpV-ATPase D expression vector and the MS2+hpV-ATPase D expression vector; Figure 2 Expression of the hpRNA of the Hyphantria cunea V-ATPase D gene induced by IPTG in Example 4 and Example 5; Figure 3 Expression of the MS protein induced by IPTG in Example 4 and Example 5; Figure 4 Relative expression levels of the Hyphantria cunea V-ATPase D gene in Example 4 and Example 5; Figure 5 Survival rates of Hyphantria cunea in Example 4 and Example 5; Figure 6 Weights of Hyphantria cunea larvae in Example 4 and Example 5; Figure 7 Phenotypic differences of Hyphantria cunea larvae in Example 4 and Example 5. Detailed Embodiments The present invention will be further described below in conjunction with embodiments. The following embodiments are explanations of the present invention and the present invention is not limited to the following embodiments: Example 1 Synthesis of the hpRNA of the Hyphantria cunea V-ATPase D gene Step 1. Using the cDNA of Hyphantria cunea as a template, specific primers for the V-ATPase D gene sequence of Hyphantria cunea were designed through Primer Premier 5 software, and T7 promoter sequences were added to both ends. The dsV-ATPase-D primers were dsV-ATPase-D-F and dsV-ATPase-D-R. The nucleotide sequence of dsV-ATPase-D-F is TAATACGACTCACTA TAGGG TTGTGCTGCAGAACGTCACT; the nucleotide sequence of dsV-ATPase-D-R is TAATACGACTCACTATAGGG GGAGTTGCCTGGGTCTTGAG; Step 2. The V-ATPase D gene was amplified from the cDNA of Hyphantria cunea by PCR. The ApexHF HS DNA polymerase premix-FS high-fidelity enzyme from Aikerui Company was used for the PCR amplification reaction of the target gene. The reaction system (50 μL) is shown in Table 1 as follows: Table 1 Composition of the reaction system components Component Name Dosage Added Added Quantity 2X Apex HF FS PCR Master Mix 1x 25 μL Template ≤200 ng - Primer F (10 μM) 0.2 μM 1 μL Primer R (10 μM) 0.2 μM 1 μL RNase-free water - Up to 50 μL The PCR amplification program was: pre-denaturation at 94 °C for 1 min, denaturation at 98 °C for 10 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min. 30 cycles were set, and a final extension at 72 °C for 2 min was carried out. Agarose gel electrophoresis and a gel imaging system were used for detection to check if there was a single band at the target position, and the agarose gel at the target band was cut off. Then, the target gene DNA fragment was recovered using the gel extraction kit from Novizan Company; Step 3. Then, the T7 RiboMAX TM Express RNAi System (Promega) kit was used for in vitro synthesis of hpRNA, including the following procedures: ① Set up a reaction system of appropriate size for the target gene DNA fragment at room temperature. The T7 reaction system is shown in Table 2; Table 2 Composition of the T7 reaction system components ② Gently mix and incubate at 37 °C for 30 minutes; ③ When annealing the RNA strands, first mix equal volumes of the complementary RNA reaction solutions, then incubate at 70 °C for 10 min and slowly cool to room temperature (about 20 min) to achieve annealing of the double-stranded RNA; ④ Add 1 μL of RNase to 199 μL of nuclease-free water to dilute the accompanying RNase solution (1:200). For every 20 μL of reaction volume, add 1 μL of freshly diluted RNase solution and 1 μL of RQ1 RNase-Free DNase, and incubate at 37 °C for 30 min to remove all remaining single-stranded RNA and DNA templates, leaving only double-stranded RNA; ⑤ Add 0.1 volume of 3 M sodium acetate (pH 5.2) and 1 volume of isopropanol, mix well, and place on ice for 5 min; ⑥ Place in a microcentrifuge and centrifuge at the maximum speed for 10 min. Carefully pour out or aspirate the supernatant, and wash the pellet with 0.5 mL of 70% cold ethanol; ⑦ Carefully aspirate all the ethanol, air-dry the pellet at room temperature for 15 min, then resuspend the RNA sample in nuclease-free water and store at -80 °C to obtain the hpRNA fragment of the V-ATPase D gene of Hyphantria cunea, and the nucleotide sequence of the hpRNA fragment of the V-ATPase D gene of Hyphantria cunea is shown in SEQ ID NO.1. Example 2 Construction of the hpV-ATPase D expression vector Ligate the hpRNA fragment of the V-ATPase D gene of Hyphantria cunea synthesized in Example 1 to a plasmid to construct the hpV-ATPase D expression vector, as follows: (1) Select pet28a and check whether the sequence of V-ATPase D has three restriction endonuclease sites, XhoI, BamHI, and HindIII, in the SnapGene software. Then redesign the primers for the predicted gene fragment using Primer Primer 5 and add the sequences of the XhoI, BamHI, and HindIII restriction endonuclease sites to the primers; (2) Use PCR to introduce the XhoI and BamHI restriction endonuclease sites into a single target sequence fragment, and then use overlapping PCR to connect the target sequence with an intron (intron sequence from GA2024) and introduce the BamHI and HindIII restriction endonuclease sites; (3) Use the gel extraction kit from Novizan to recover the target sequence fragment and the target sequence + intron fragment with the corresponding restriction endonuclease sites introduced; (4) Insert the recovered fragments into a TA / Blunt-Zero cloning vector and transfer them into Escherichia coli. Use colony PCR and plasmid sequencing to screen for the correct plasmid for subsequent experiments. The plasmid digestion system is shown in Table 3; Table 3 Composition of plasmid digestion system components of hpV-ATPase D expression vector in Example 2 After gently mixing, centrifuge instantaneously and incubate at 37 °C for 1 h. Detect by agarose gel electrophoresis to check whether the plasmid is completely cut. Cut and recover the target gene fragment and vector fragment respectively; (5) Ligate the double-digested target fragment and the gel recovery product of vector pET-28a(+) using DNA Ligation Kit. The ligation system is shown in Table 4. Table 4 Composition of ligation system components Component Name Dosage Added Solution I 9 μL pET-28a(+) after double digestion 4 μL Target DNA fragment 5 μL After mixing, centrifuge briefly and react at 16 °C for 30 min. After the reaction, add 2 μL of SolutionIII to improve the transformation efficiency. Transform the reaction solution into competent cells of HT115(DE3), and perform plaque sequencing to screen out the strains with correct sequencing for subsequent use. Example 3 Construction of MS2+hpV-ATPase D expression vector Ligate the hpRNA fragment of Hyphantria cunea V-ATPase D gene and the MS2 protein gene fragment synthesized in Example 1 onto a plasmid to construct an MS2+hpV-ATPase D expression vector, as follows: (1) Select pMS2 as the vector for expressing hpV-ATPase D. Check whether the sequence of V-ATPase D has three restriction endonuclease sites, XhoI, BamHI, and HindIII, in the SnapGene software. Then redesign the primers for the predicted gene fragment using Primer Primer 5 and add the sequences of XhoI, BamHI, and HindIII restriction endonuclease sites to the primers; (2) Introduce the two restriction endonuclease sites, XhoI and BamHI, into a single target sequence fragment using PCR. Then connect the target sequence with intron (intron sequence from GA2024) using overlapping pcr and introduce the two restriction endonuclease sites, BamHI and HindIII; (3) Use the gel recovery kit from Novizan to recover the target sequence fragment and the target sequence+intron fragment introduced with the corresponding restriction endonuclease sites; (4) Insert the recovered fragments into a TA / Blunt-Zero cloning vector and transfer them into Escherichia coli. Use colony PCR and plasmid sequencing to screen out the correct plasmids for subsequent experiments. The plasmid digestion system is shown in Table 5; Table 5 Composition of plasmid digestion system components of MS2+hpV-ATPase D expression vector in Example 3 Component Name Dosage Added 10× QuickCut Green Buffer 5 μL Plasmid 5 μL QuickCut BamHI 1 μL QuickCut XhoI / HindIII 1 μL Sterilized water up to 50 μL After gently mixing and briefly centrifuging, incubate at 37 °C for 1 h, and detect by agarose gel electrophoresis to check whether the plasmid is completely cut. Recover the target gene fragment and vector fragment by cutting the gel respectively; (5) Ligate the double-digested target fragment and the gel recovery product of vector pET-28a(+) using DNA Ligation Kit. The ligation system is shown in Table 6, Table 6 Composition of ligation system components Component Name Dosage Added Solution I 9 μL pET-28a(+) after double digestion 4 μL Target DNA fragment 5 μL After mixing and briefly centrifuging, react at 16 °C for 30 min. After the reaction, add 2 μL of SolutionIII to improve the transformation efficiency. Transform the reaction solution into competent cells of HT115(DE3), and perform plaque sequencing to screen out the strains with correct sequencing for subsequent use. Example 4 A method for preparing a bacterial expression solution expressing hpRNA of Hyphantria cunea V-ATPase D gene, comprising the following steps: S1. Introduce the hpV-ATPase D expression vector prepared in Example 2 into Escherichia coli competent cells for culture to form transformed colonies, S2. Culture the transformed colonies in LB medium containing 50 μg / mL kanamycin, and shake culture at 37 °C and 200 rpm for 16 h to obtain a culture solution; S3. Add 1 mL of the culture solution to 100 mL of fresh LB medium containing 50 μg / mL kanamycin, and shake culture at 37 °C and 200 rpm until the bacterial exponential growth stage is reached (i.e., OD 600 = 0.6 - 0.8); then add IPTG with a final concentration of 0.6 mM and culture at 37 °C for 5 h. Collect the bacterial solution, which is the bacterial expression solution, denoted as hpV-ATPase D. Example 5 A method for preparing a bacterial expression solution expressing hpRNA of Hyphantria cunea V-ATPase D gene, comprising the following steps: S1. Introduce the MS2+hpV-ATPase D expression vector prepared in Example 3 into Escherichia coli competent cells for culture to form transformed colonies; S2. Culture the transformed colonies in LB medium containing 50 μg / mL kanamycin, and shake culture at 37 °C and 200 rpm for 16 h to obtain a culture solution; S3. Add 1 mL of the culture solution to 100 mL of fresh LB medium containing 50 μg / mL kanamycin, and culture it with shaking at 37 °C and 200 rpm until the bacterial exponential growth stage is reached (i.e., OD 600 = 0.6 - 0.8); then add IPTG with a final concentration of 0.6 mM and culture at 37 °C for 6 h, and collect the bacterial liquid as the bacterial expression solution, denoted as MS2 + hpV-ATPaseD. Performance test (1) Expression of the hpRNA of the Hyphantria cunea V-ATPase D gene in the IPTG-induced expression vector Centrifuge the bacterial expression solutions prepared in Example 4 and Example 5 at 7000 g for 10 min to extract total RNA. Extract the total bacterial RNA using the TRNzol Universal reagent according to the instructions. Treat the extracted RNA with RNase at 37 °C for 30 min to remove single-stranded RNA; and electrophorese on a 1% agarose gel to confirm the expression of hpRNA, and at the same time use real-time fluorescence quantitative PCR to detect the content of hpRNA in the bacterial expression solution; and culture the bacterial culture without adding IPTG under the same conditions and use it as a control group. It can be seen from Figure 2 that after IPTG induction, the bacterial solutions expressing hpGFP, MS2 + hpGFP, hpV-ATPase D, and MS2 + hpV-ATPase can all successfully induce the expression of hpRNA, and the fragment sizes are consistent with the expectations. The results show that the transformed colonies in Example 4 and Example 5 successfully express the hpRNA of the Hyphantria cunea V-ATPase D gene in Escherichia coli after IPTG induction. (2) Expression of the MS2 protein gene in the IPTG-induced expression vector Centrifuge the bacterial expression solution prepared in Example 5 at 7000 g for 10 min to extract total protein. Extract the total bacterial protein using the RIPA lysis buffer according to the instructions. Add SDS-PAGE protein loading buffer to the extracted total protein and treat it at 95 °C for 5 min to denature the protein, and confirm the expression of the MS2 protein by SDS-PAGE; culture the bacterial culture without adding IPTG under the same conditions and use it as a control group. It can be seen from Figure 3 that after IPTG induction, the bacterial solutions expressing MS2 and MS2 + hpV-ATPase can both successfully induce the expression of MS2, and the fragment sizes are consistent with the expectations. While the bacterial solutions without IPTG induction and without the MS2 expression cassette do not express the MS2 protein. The results show that the transformed colonies in Example 5 successfully express the MS2 virus protein in Escherichia coli after IPTG induction. (3) Verification test on the control effect of the bacterial expression solution against Hyphantria cunea The control effects of the bacterial expression liquids prepared in Example 4 and Example 5 against Hyphantria cunea were determined. A negative control group (denoted as hpGFP) and an MS2 group (denoted as MS2) were set up. The preparation method of the hpGFP expression vector is as follows: ① Select pet28a as the vector for expressing hpGFP. Check whether the sequence of green fluorescent protein (GFP) has three restriction enzyme sites, namely XhoI, BamHI, and HindIII, in the SnapGene software. Then redesign the primers for the predicted gene fragment using Primer Primer 5, and add the sequences of XhoI, BamHI, and HindIII restriction enzyme sites to the primers; ② Use PCR to introduce the two enzyme digestion sites XhoI and BamHI into a single target sequence fragment, and then use overlapping pcr to connect the target sequence with intron (intron sequence from GA2024), and introduce the two enzyme digestion sites BamHI and HindIII; ③ Use the gel extraction kit from Novizan Company to recover the target sequence fragment and the target sequence + intron fragment into which the corresponding enzyme digestion sites have been introduced. Insert the recovered fragments into the TA / Blunt-Zero cloning vector and transfer them into Escherichia coli. Use colony PCR and plasmid sequencing to screen out the correct plasmids for subsequent experiments; ④ Use enzyme digestion to recover the fragment on the T vector and the backbone of pet28a, and then use ligase to connect the two gene fragments and the vector backbone fragment together. Perform transformation and pick colonies for sequencing, and screen out the plasmids with correct sequencing, denoted as the hpGFP expression vector; the nucleotide sequence of hpGFP is shown in SEQ ID NO.5; The expression vector of the MS2 protein in the MS2 group is the pMS2 vector previously constructed in the laboratory. It can be seen from Figure 4 that at a bacterial solution concentration of 5×10 9 cfu / mL, the down-regulation amount of the target gene in the group fed with the bacterial solution expressing MS2 + hpV-ATPase D was significantly higher than that in the treatment group fed with the bacterial solution expressing only hpV-ATPase D; it can be seen from Figure 5 that at a bacterial solution concentration of 5×10 9 cfu / mL, feeding the bacterial solution expressing MS2 + hpV-ATPase D had a better insecticidal effect than feeding the bacterial solution expressing only hpV-ATPase D; it can be seen from Figure 6 and Figure 7 that at a bacterial solution concentration of 5×10 9At a concentration of cfu / mL, the larval weight of the group fed with the bacterial liquid expressing MS2+hpV-ATPase D was significantly lower than that of the treatment group fed with the bacterial liquid expressing only hpV-ATPase D. In summary, the bacterial expression liquid containing MS2+hpV-ATPase D prepared in Example 5 can better control Hyphantria cunea, indicating that the MS2 protein expressed by the MS2 protein gene protects the hpRNA of the Hyphantria cunea V-ATPase D gene from being degraded by nucleases through encapsulation, making it have good stability and further improving the control effect of the hpRNA of the Hyphantria cunea V-ATPase D gene. The above are only the preferred embodiments of the present invention and do not impose any formal limitations on the present invention. Any person skilled in the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above, or modify it into equivalent embodiments with equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the technical solution of the present invention still fall within the scope of protection of the technical solution of the present invention.
Claims
1. A hpRNA of the V-ATPase D gene of the nymphalidae, characterized in that: The nucleotide sequence of the hpRNA of the V-ATPase D gene of the cunea gypsophila is shown in SEQ ID NO.
1.
2. A method for preparing a bacterial expression solution using hpRNA of the V-ATPase D gene of the cunea cunea, characterized in that: The following steps are involved: S1. Using the cDNA of the nymphalidae as a template, PCR amplification was performed using dsV-ATPase-D primers to obtain the hpRNA fragment of the V-ATPase D gene of the nymphalidae; S2. Connecting the hpRNA fragment of the V-ATPase D gene of the American cunea to a plasmid to construct an hpV-ATPaseD expression vector; or connecting the hpRNA fragment of the V-ATPase D gene of the American cunea and the MS2 protein gene fragment to a plasmid to construct an MS2+hpV-ATPaseD expression vector; S3. Introduce the hpV-ATPase D expression vector or the MS2+hpV-ATPase D expression vector into bacterial competent cell culture, induce the culture with IPTG and collect the bacterial solution, which is the bacterial expression solution.
3. The method for preparing bacterial expression solution using hpRNA of the V-ATPase D gene of Hyphantria cunea according to claim 2, characterized in that: In step S1, the dsV-ATPase-D primers are dsV-ATPase-DF and dsV-ATPase-DR.
4. The method for preparing bacterial expression solution using hpRNA of the V-ATPase D gene of Hyphantria cunea according to claim 3, characterized in that: The nucleotide sequence of the dsV-ATPase-DF is shown in SEQ ID NO.
2.
5. The method for preparing bacterial expression solution using hpRNA of the V-ATPase D gene of Hyphantria cunea according to claim 3, characterized in that: The nucleotide sequence of the dsV-ATPase-DR is shown in SEQ ID NO.
3.
6. The method for preparing bacterial expression solution using hpRNA of the V-ATPase D gene of Hyphantria cunea according to claim 2, characterized in that: The nucleotide sequence of the MS2 protein gene in step S2 is shown in SEQ ID NO.
4.
7. Use of the bacterial expression solution prepared by the method according to any one of claims 2 to 6 in controlling the gypsy moth.
8. The use according to claim 7, characterized in that: Control of the gypsy moth is achieved by spraying or feeding bacterial expression solutions.
Citation Information
Patent Citations
Preparation method of virus-like particles for preventing and treating cotton bollworms, method for resisting cotton bollworms and application of virus-like particles
CN111387213A
Hyphantria cunea vATPase A gene dsRNA and bacterial expression liquid and application thereof
CN113430200A