Nucleic acid aptamer for detoxification of fumonisins B1 and application of nucleic acid aptamer

Abstract

The invention relates to the technical field of agricultural biology, in particular to a nucleic acid aptamer for detoxification of fumonisins B1 and application of the nucleic acid aptamer. The nucleotide sequence of the nucleic acid aptamer provided by the invention is shown as any one or more sequences of SEQ ID NO.1 to SEQ ID NO.3. The invention also provides a preparation method of the nucleic acid aptamer. The nucleic acid aptamer has the advantages of high efficiency, convenience in operation, no need of specific professional equipment, no influence on nutrient substances of agricultural and sideline products, no generation of harmful substances in the detoxification process and no need of multi-enzyme synergistic degradation in the detoxification aspect of the fumonisins B1, and also has the advantages of no requirement on environmental conditions and the like; and the detoxification of the fumonisins B1 can be completed at room temperature. The nucleic acid aptamer provided by the invention can overcome part of defects and limitations of the antibody, and is low in immunogenicity, easy in-vitro synthesis, simple in modification and the like. The nucleic acid aptamer can be applied to agriculture, feed and other industries, and harm of FB1 to animal and human health is reduced.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biotechnology, and particularly to a nucleic acid aptamer for detoxifying fumonisin B1 and its application. Background Art

[0002] Mycotoxins are common contaminants in food and feed, seriously affecting global human and animal health. Mycotoxins are mainly produced by 4 common fungal genera such as Aspergillus and Fusarium. Among them, fumonisin B (FB) produced by Fusarium is the most toxic and the most toxin-producing toxin in this genus, seriously contaminating various food crops and their products such as corn, sorghum, and rice, resulting in a decrease in the nutritional value and grain yield of contaminated crops, endangering the health of humans and animals, and causing huge economic losses. Currently, 28 FB structural analogs have been discovered, which are usually divided into four categories: A, B, C, and P. The classification of FB mainly depends on three different substituents in its chemical structure, namely R1, R2, and R3. Among the four types of FB, the B-type fumonisin has the highest toxicity and mainly exists in the forms of FB1, FB2, and FB3. Among them, FB1 has the strongest toxicity and the most widespread contamination in the B-type toxins. FB1 accounts for about 70% - 80% of the total FB content and is the main toxin contaminating food and feed, thus attracting extensive attention. FB1 can cause various toxic effects on organisms, including neurotoxicity, immunotoxicity, reproductive toxicity, cytotoxicity, organ and tissue toxicity, and carcinogenicity, and has been identified as a Group 2B carcinogen by the World Health Organization. Therefore, conducting research on FB1 removal and control technologies to solve the contamination of toxins in food and feed is of great significance for improving animal production performance, protecting the "safety on the tip of the tongue" of people, and ensuring national food safety.

[0003] At present, the detoxification technologies of FB1 mainly include three categories: physical detoxification, chemical detoxification, and biological detoxification. Physical detoxification refers to the methods of removing FB1 by using physical technologies or characteristics, including sorting, washing, grinding, solvent extraction, heating, adsorption, and non-thermal physical treatment, etc. Among them, adsorption detoxification has the best effect and is also the most widely used in the feed industry. However, it not only has an effect on mycotoxins but also has an adsorption function on vitamins and some mineral trace elements required by the animal body, resulting in the loss of nutrients. Chemical detoxification mainly involves treatment with acids, alkalis, and strong oxidants. Although the effect is significant, its degradation products are not completely non-toxic, and the treatment with strong acids, strong alkalis, and oxidants will also cause secondary problems such as mutagenesis of nutrients, reagent residues, secondary environmental pollution, and poor palatability. Although a variety of physical and chemical methods have been used for the removal of FB1, most of these methods have limitations such as nutrient loss, affecting palatability, and low detoxification efficiency. The biological detoxification method has the advantages of mild action conditions, strong specificity, and minimal impact on the sensory properties and palatability of raw materials, etc. Biological detoxification refers to the method of achieving the detoxification purpose by using the adsorption and degradation effects of various microorganisms and enzymes. However, there are few strains that can degrade FB1, the degradation efficiency is low, and the degradation of FB1 often requires the synergistic action of two or more enzymes. When performing recombinant expression, it is necessary to consider the catalytic environment of the degradation enzyme in the original host; whether the stability, tolerance, etc. of the degradation enzyme are applicable to the industrial application scenario. At present, physical, chemical, and biological detoxification methods all have some advantages and disadvantages. Therefore, developing a new detoxification method that can simultaneously possess the above advantages and avoid their disadvantages is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0004] The object of the present invention is to provide a nucleic acid aptamer for detoxifying fumonisin B1 and its application to solve the problems existing in the above-mentioned prior art. The present invention provides a nucleic acid aptamer that can be highly efficient and does not affect the food quality, and has the advantages of simple operation, no need for specific professional equipment, no generation of harmful substances during the detoxification process, and no need for multi-enzyme synergistic degradation when using the nucleic acid aptamer provided by the present invention in the detoxification process of fumonisin B1.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a nucleic acid aptamer (Aptamer, Apt) for detoxifying fumonisin B1, and the nucleotide sequence of the nucleic acid aptamer is shown as any one or several sequences of SEQ ID NO.1-SEQ ID NO.3.

[0007] The present invention provides the application of the above nucleic acid aptamer in the preparation of a product for detoxifying fumonisin B1.

[0008] Preferably, the product includes a detoxifying agent or a detoxifying drug.

[0009] The present invention provides a fumonisin B1 detoxifying agent, and the fumonisin B1 detoxifying agent comprises the above-mentioned aptamer.

[0010] Preferably, the fumonisin B1 detoxifying agent further comprises excipients.

[0011] The present invention provides the application of the above-mentioned aptamer or the above-mentioned fumonisin B1 detoxifying agent in reducing fumonisin B1 in food.

[0012] The present invention provides a method for reducing fumonisin B1 in food, which comprises the step of treating the food contaminated with fumonisin B1 by using the above-mentioned aptamer or the above-mentioned fumonisin B1 detoxifying agent.

[0013] The present invention provides the application of the above-mentioned aptamer or the above-mentioned fumonisin B1 detoxifying agent in reducing the toxicity of fumonisin B1 for non-diagnostic and therapeutic purposes.

[0014] The present invention provides a drug for reducing the toxicity of fumonisin B1, and the drug comprises the above-mentioned aptamer.

[0015] Preferably, the drug further comprises excipients.

[0016] The present invention discloses the following technical effects:

[0017] 1. The present invention provides an aptamer for detoxifying fumonisin B1 and its application. The nucleotide sequence of the aptamer is shown as any one or several sequences of SEQ ID NO.1-SEQ ID NO.3. The aptamer provided by the present invention can effectively reduce the toxicity of fumonisin B1 and improve the cell survival rate, and the highest cell survival rate can reach 79.84%. Thus, the aptamer provided by the present invention provides a new idea for the detoxification of fumonisin B1.

[0018] 2. The aptamer provided by the present invention has the advantages of high efficiency, convenient operation, no need for specific professional equipment, no influence on the nutrients of agricultural and sideline products, no generation of harmful substances during the detoxification process, and no need for multi-enzyme synergistic degradation in the aspect of fumonisin B1 detoxification. At the same time, it also has the advantages of no requirement for environmental conditions, etc. The detoxification of fumonisin B1 can be completed at room temperature. When the fumonisin B1 solution reacts with the aptamer at a concentration ratio of 1:1.2 for 40 min, the highest cell survival rate can reach 79.84%. Thus, it can be seen that the cell toxicity of fumonisin B1 is effectively reduced by the aptamer provided by the present invention.

[0019] 3. The aptamers provided by the present invention can overcome some of the disadvantages and limitations of antibodies. They have low immunogenicity, are easy to synthesize in vitro, and are simple to modify, etc. As new detection probes and small molecule inhibitors, aptamers have received increasing attention. The aptamers of the present invention can be applied to industries such as agriculture and feed to reduce the harm of FB1 to the health of animals and humans.

[0020] In summary, the present invention provides aptamers for the detoxification of fumonisin B1 and their applications. The aptamers provided by the present invention provide a new idea for the method of fumonisin B1 detoxification. The aptamers provided by the present invention can be applied to industries such as agriculture and feed to reduce the harm of fumonisin B1 to the health of animals and humans. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or in the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0022] Figure 1 is the typical conformation of the interaction between fumonisin B1 and the nucleic acid aptamer;

[0023] Figure 2 is the 2D diagram of the typical conformation of the interaction between fumonisin B1 and the nucleic acid aptamer;

[0024] Figure 3 is the binding energy analysis of fumonisin B1 and the nucleic acid aptamer;

[0025] Figure 4 is the effect of different concentrations of fumonisin B1 on the viability of HepG2 cells;

[0026] Figure 5 is the effect of the fumonisin B1 detoxification product solution at different times on the viability of HepG2 cells;

[0027] Figure 6 is the effect of the fumonisin B1 detoxification product solution with different ratios on the viability of HepG2 cells. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0028] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0029] It should be understood that the terms used in the present invention are only for describing particular embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0030] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0031] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0032] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0033] In the following embodiments, if the specific test conditions are not indicated, they are generally in accordance with conventional test conditions or in accordance with the test conditions recommended by the reagent company. The materials, reagents, etc. used, unless otherwise specified, are all reagents and materials obtained through commercial channels.

[0034] The fumonisin B1 used in the present invention is purchased from Tianjin Solomon Biotechnology Co., Ltd.

[0035] Example 1 Nucleic acid aptamer for detoxifying fumonisin B1

[0036] The nucleotide sequences of the nucleic acid aptamers (Apt) for detoxifying fumonisin B1 provided by the present invention are as described in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3, specifically as follows:

[0037] SEQ ID NO.1: AGCAGCACAGAGGTCAGATGCGATCTGGAAATTATTTTTGACACCC CTTTGGGGTGACATCCTACGCGTGCTACCGTGAA;

[0038] SEQ ID NO.2: AGCAGCACAGAGGTCAGATGCGATCTGGATATTATTTTTGATACCCC TTTGGGGAGACATCCTATGCGTGCTACCGTGAA;

[0039] SEQ ID NO.3: AGCAGCATAGAGGTTAGATGCGATCTGGATATTGTTTTTGATACCCC TTTGGGGAGACATCCTACGCGTGATACCGCGAA;

[0040] The nucleic acid aptamer for fumonisin B1 detoxification was synthesized by Genewiz.

[0041] Example 2 Molecular dynamics simulation of the nucleic acid aptamer in Example 1 with FB1

[0042] In this example, the applicant preliminarily explored the interaction mechanism between fumonisin B1 (which can be called FB1 or toxin molecule) and the candidate nucleic acid aptamer by molecular dynamics simulation. By analyzing the binding stability and interaction mode of the nucleic acid aptamer with FB1, a nucleic acid aptamer with good binding characteristics was found, showing good inhibitory effect on FB1 toxicity. Among them, Figure 1 is a typical conformation for the interaction between the toxin molecule and the nucleic acid aptamer, and the formation of the complex mainly depends on hydrogen bonds and hydrophobic interactions. In this conformation, the toxin molecule forms 2 hydrophobic interactions with cytosine 58 and guanine 56, and at the same time forms 3 hydrogen bond interactions with guanine 2 and guanine 56. These two interactions bind the toxin molecule and the nucleic acid aptamer firmly together. To more clearly show this interaction, a 2D schematic diagram of the interaction between the toxin molecule and the nucleic acid aptamer was drawn, and the results are as Figure 2 shown. To explore the interaction strength between the nucleic acid aptamer and the toxin molecule, gmx_MMPBSA was used to calculate the binding energy between the nucleic acid aptamer and the toxin molecule in the last 10 ns during the simulation, and the results are shown in Table 1.

[0043] Table 1 Binding energy between Apt and FB1 in the last 10 ns during the simulation

[0044]

[0045]

[0046] Note: ΔG complex is the change in energy during the formation of the complex; ΔG receptoris the change in Gibbs free energy when the receptor exists alone; ΔG ligand is the change in Gibbs free energy when the ligand molecule exists alone; ΔG bind is the change in Gibbs free energy when the receptor and ligand bind to form a complex.

[0047] The results in Table 1 show that FB1 binds well to the aptamer. Therefore, the mechanism by which the aptamer inhibits FB1 may be that the aptamer binds to FB1, thereby preventing FB1 from binding to other biomolecules that play important physiological functions to a certain extent and causing adverse reactions. Further binding energy analysis shows that bases 1, 2, 36, 57, and 58 on the aptamer are the key sites for binding to the toxin molecule, and these sites play an important role in inhibiting the toxicity of FB1 ( Figure 3 ).

[0048] In summary, bases 1, 2, 36, 57, and 58 of the aptamer are the key sites for binding FB1. Through hydrogen bonds and hydrophobic interactions, the aptamer tightly adsorbs FB1, thereby preventing the toxin molecule from interacting with other biomolecules with important physiological functions, and finally achieving the inhibition of the toxicity of FB1.

[0049] Example 3 Evaluation of the effect of FB1 on cell viability

[0050] The CCK-8 method was used to detect cell viability: HepG2 cells in the logarithmic phase were seeded at 1×10 5 cells / well in a 96-well cell culture plate and cultured for 24 h. Subsequently, FB1 solutions at 0, 0.05, 0.5, 5, and 50 μmol / L were added and cultured for 48 h respectively. Then, 10 μL of CCK-8 solution was added to each well. After culturing for 4 h, the absorbance of each well was measured at 450 nm, and the cell survival rate (RGR) was calculated according to the following formula. The results are as Figure 4 shown.

[0051] Cell survival rate (RGR) = (OD of experimental group - OD of blank group) / (OD of control group - OA of blank group) × 100%.

[0052] From Figure 4 it can be seen that as the concentration of FB1 increases, its cytotoxicity continuously increases. When the concentration of FB1 is 0.05 μmol / L, the cell survival rate is 99.10%. When the concentration increases to 50 μmol / L, the cell survival rate is only 28.56%. After analysis by the prism software using analysis, the IC 50 of FB1 = 21.12 μmol / L.

[0053] Example 4 Evaluation of the effect of FB1 detoxification products at different times on cell viability

[0054] A 21.12 μmol / L FB1 solution was mixed and degraded with an aptamer (SEQ ID NO.2) solution at a concentration ratio of 1:1.2. After reacting at room temperature for 0, 10, 20, 40, and 60 min respectively, the resulting supernatant was the FB1 detoxification product solution; at the same time, a 21.12 μmol / L FB1 solution without adding the aptamer solution was used as a control.

[0055] The CCK-8 method was used to detect cell viability: HepG2 cells in the logarithmic phase were inoculated into a 96-well cell culture plate at 1×10 5 cells / well and cultured for 24 h. Subsequently, the mixed FB1 detoxification product solutions after 0, 10, 20, 40, and 60 min were added and cultured for 48 h respectively. Then, 10 μL of CCK-8 solution was added to each well. After culturing for 4 h, the absorbance of each well was measured at 450 nm, and the cell survival rate was calculated. The results are as Figure 5 shown. Figure 5 It can be seen that with the increase of the incubation time, its cytotoxicity continued to decrease. When the FB1 solution was not incubated with the aptamer, the cell survival rate was 63.18%. When the FB1 solution was incubated with the aptamer at a concentration ratio of 1:1.2 for 40 min, the cell survival rate could reach up to 99.81%. It can be seen that after incubation with the aptamer, the cytotoxicity of FB1 was effectively reduced.

[0056] Example 5 Evaluation of the effect of FB1 detoxification products with different ratios on cell viability

[0057] A 50 μmol / L FB1 solution was mixed and degraded with an aptamer (SEQ ID NO.2) solution at concentration ratios of 1:0.3, 1:0.6, 1:0.9, and 1:1.2 respectively. After reacting at room temperature for 40 min, the resulting supernatant was the FB1 detoxification product solution; at the same time, a 50 μmol / L FB1 solution without adding the aptamer solution was used as a control.

[0058] The CCK-8 method was used to detect cell viability: HepG2 cells in the logarithmic phase were inoculated into a 96-well cell culture plate at 1×10 5 cells / well and cultured for 24 h. Subsequently, the FB1 detoxification product solutions degraded by mixing at concentration ratios of 1:0.3, 1:0.6, 1:0.9, and 1:1.2 were added and cultured for 48 h respectively. Then, 10 μL of CCK-8 solution was added to each well. After culturing for 4 h, the absorbance of each well was measured at 450 nm, and the cell survival rate was calculated. The results are as Figure 6 shown.

[0059] As Figure 6It can be seen that as the ratio of the FB1 solution to the aptamer increases, its cytotoxicity continuously decreases. When the cells are not incubated with the aptamer, the cell survival rate is 46.21%. When the cells are incubated with the FB1 solution and the aptamer at a concentration ratio of 1:1.2 for 40 minutes, the highest cell survival rate can reach 79.84%. It can be seen that after incubation with the aptamer, the cytotoxicity of FB1 is effectively reduced.

[0060] In summary, it can be known that the aptamer provided by the present invention can be effectively used for detoxifying fumonisin B1 and improving the cell survival rate, and the highest cell survival rate can reach 79.84%. The cytotoxicity of fumonisin B1 is effectively reduced by the aptamer provided by the present invention.

[0061] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A nucleic acid aptamer for detoxification of fumonisin B1, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in any one or several sequences of SEQ ID NO.1-SEQ ID NO.

3.

2. Use of the nucleic acid aptamer according to claim 1 in preparing a fumonisin B1 detoxified product.

3. The product according to claim 2, characterized in that The products include detoxifying agents or medicines.

4. A fumonisin B1 detoxification agent, characterized in that: The fumonisin B1 detoxifying agent comprises the nucleic acid aptamer according to claim 1.

5. The fumonisin B1 detoxifying agent according to claim 4, characterized in that: The fumonisin B1 detoxifying agent also includes auxiliary materials.

6. Use of the nucleic acid aptamer according to claim 1 or the fumonisin B1 detoxification agent according to claim 4 or 5 in detoxification of fumonisin B1 in food.

7. A method for detoxifying fumonisin B1 in food, characterized in that: The method comprises the step of treating food contaminated with fumonisin B1 by using the nucleic acid aptamer according to claim 1 or the fumonisin B1 detoxifying agent according to claim 4 or 5.

8. Use of the nucleic acid aptamer according to claim 1 or the fumonisin B1 detoxification agent according to claim 4 or 5 in reducing the toxicity of fumonisin B1 for non-diagnostic and therapeutic purposes.

9. A drug for reducing the toxicity of fumonisin B1, characterized in that: The drug comprises the nucleic acid aptamer according to claim 1.

10. The drug according to claim 9, characterized in that The medicine also includes excipients.

Images