Application of carbohydrate binding protein BnaCARB in regulation and control of thousand grain weight

Abstract

The invention discloses application of carbohydrate binding protein BnaCARB in regulation and control of thousand seed weight, and belongs to the technical field of genetic engineering. The invention provides an application of a carbohydrate binding protein BnaCARB or a coding gene thereof, or a related biological material of the coding gene in regulation and control of thousand seed weight of rape or cultivation of high-yield rape. Research finds that BnaCARB genes (BnaA09.CARB and BnaC08. CARB) in oilseed rape can regulate and control the thousand seed weight of the oilseed rape, the thousand seed weight of the oilseed rape can be remarkably increased by knockout mutants of the genes, the thousand seed weight of the oilseed rape can be increased by utilizing the genes, and high-yield oilseed rape germplasm can be obtained. The invention provides a theoretical basis for further in-depth study on the physiological mechanism of rape yield, also provides genetic resources and technical support for creation and cultivation of high-yield rape germplasm, and has very important application prospects in breeding and improvement of high-yield rape varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of the carbohydrate-binding protein BnaCARB in regulating the thousand-grain weight. Background Art

[0002] Rapeseed (Brassica napus L.) is an important crop for oil production. Research shows that the thousand-grain weight, as one of the three major factors of yield, is regulated by multiple genes and affected by the environment. At the same time, the redistribution of carbon sources during seed filling also plays a key role. At present, although more than a hundred QTLs related to the thousand-grain weight have been mapped in rapeseed, the number of genes that have been verified and cloned is still insufficient.

[0003] Carbohydrate-binding proteins are a class of proteins that contain a carbohydrate-binding module (CBM) domain but do not have catalytic activity. They assist the corresponding catalytic enzymes to enhance the binding efficiency with the substrate by specifically recognizing and binding to polysaccharide substrates, thereby regulating enzyme activity and localization. Existing research shows that CBM in microorganisms plays a key role in the degradation of plant cell walls. For example, CBM1 of Magnaporthe oryzae regulates the activity of glycoside hydrolase by binding to cellulose to destroy the host cell wall. In animals and plants, similar domains are involved in the recognition of exogenous polysaccharides and cell signal transduction, regulating various biological processes such as cell wall construction and metabolic regulation. However, the research on the specific regulation of carbohydrate metabolism and its spatial localization by CBM proteins is still relatively scattered and has not yet formed a systematic theoretical framework. Therefore, identifying key carbon source regulatory genes and analyzing their action mechanisms are of great significance for guiding the molecular breeding of high-yield rapeseed varieties.

[0004] Although existing research has revealed the important role of CBM proteins in plant cell wall regulation and carbohydrate degradation, their functions in seed filling and grain weight regulation are still unclear. For example, although the CBM48 mutant in rice shows a defect in starch accumulation, there is still a lack of research directly linking CBM proteins to seed development regulation. At present, the background art mainly focuses on analyzing the binding characteristics of CBM proteins to polysaccharide substrates, and there are still significant deficiencies in the aspects of carbon source redistribution, metabolic flux regulation, and their impact mechanisms on the thousand-grain weight of seeds. Therefore, in-depth analysis of the role of CBM proteins in rapeseed in regulating metabolic flux distribution and grain weight formation will provide a new breakthrough for revealing the molecular mechanism of rapeseed high yield. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of carbohydrate binding protein BnaCARB in regulating thousand-grain weight to solve the problems existing in the above-mentioned prior art. The present invention has found that the BnaCARB gene (BnaA09.CARB and BnaC08.CARB) in rapeseed can regulate the thousand-grain weight of rapeseed, and the gene knockout mutant can lead to a significant increase in the thousand-grain weight of rapeseed. The gene can be used to increase the thousand-grain weight of rapeseed and obtain high-yield rapeseed germplasm. The present invention provides a theoretical basis for further in-depth research on the physiological mechanism of rapeseed yield, and also provides genetic resources and technical support for the creation and cultivation of high-yield rapeseed germplasm, and has a very important application prospect in the selection and improvement of high-yield rapeseed varieties.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a carbohydrate binding protein BnaCARB or a gene encoding it, or an application of a related biological material of the gene encoding it in regulating the thousand-grain weight of rapeseed or cultivating high-yield rapeseed, wherein the carbohydrate binding protein BnaCARB comprises BnaA09.CARB with an amino acid sequence as shown in SEQ ID NO.3 and BnaC08.CARB with an amino acid sequence as shown in SEQ ID NO.4;

[0008] The encoding genes include the BnaA09.CARB gene whose nucleotide sequence is shown in SEQ ID NO.1 and the BnaC08.CARB gene whose nucleotide sequence is shown in SEQ ID NO.2.

[0009] Furthermore, the related biological material is the CRISPR / Cas9 gene editing vector encoding the gene or a recombinant microorganism containing the CRISPR / Cas9 gene editing vector.

[0010] Furthermore, the method for regulating the thousand-grain weight of rapeseed is: using CRISPR / Cas9 gene editing technology to simultaneously edit the BnaA09.CARB gene and the BnaC08.CARB gene, so that the BnaA09.CARB gene and the BnaC08.CARB gene are functionally deficient, the content or activity of the carbohydrate binding protein BnaCARB is reduced, and the thousand-grain weight of rapeseed is increased.

[0011] Furthermore, the method for cultivating high-yield rapeseed is: using CRISPR / Cas9 gene editing technology to simultaneously edit the BnaA09.CARB gene and the BnaC08.CARB gene to obtain high-yield rapeseed plants with missing BnaA09.CARB gene and BnaC08.CARB gene functions and reduced carbohydrate binding protein BnaCARB content or activity.

[0012] The present invention also provides a CRISPR / Cas9 gene editing vector for the carbohydrate-binding protein BnaCARB encoding gene. The construction method of the CRISPR / Cas9 gene editing vector comprises the following steps:

[0013] (1) Screening out gene editing targets as shown in SEQ ID NO.5 and SEQ ID NO.6 according to the carbohydrate-binding protein BnaCARB encoding gene;

[0014] (2) Designing primers as shown in SEQ ID NO.7-10 according to the gene editing targets;

[0015] (3) Using the pCBC-DT1T2 plasmid as a template, amplifying the target gene by using the primers; connecting the target gene to the CRISPR / Cas9 vector to obtain the CRISPR / Cas9 gene editing vector;

[0016] The carbohydrate-binding protein BnaCARB encoding gene includes the BnaA09.CARB gene with a nucleotide sequence as shown in SEQ ID NO.1 and the BnaC08.CARB gene with a nucleotide sequence as shown in SEQ ID NO.2.

[0017] The present invention also provides a recombinant microorganism containing the above CRISPR / Cas9 gene editing vector.

[0018] The present invention also provides a method for increasing the 1000-seed weight of rapeseed, which comprises the step of introducing the above CRISPR / Cas9 gene editing vector or the above recombinant microorganism into rapeseed to cause the loss of function of the carbohydrate-binding protein BnaCARB encoding gene so as to increase the 1000-seed weight of rapeseed;

[0019] The carbohydrate-binding protein BnaCARB encoding gene includes the BnaA09.CARB gene with a nucleotide sequence as shown in SEQ ID NO.1 and the BnaC08.CARB gene with a nucleotide sequence as shown in SEQ ID NO.2.

[0020] The present invention also provides a method for cultivating high-yield rapeseed, which comprises the step of introducing the above CRISPR / Cas9 gene editing vector or the above recombinant microorganism into rapeseed to obtain a high-yield rapeseed plant with the loss of function of the carbohydrate-binding protein BnaCARB encoding gene;

[0021] The carbohydrate-binding protein BnaCARB encoding gene includes the BnaA09.CARB gene with a nucleotide sequence as shown in SEQ ID NO.1 and the BnaC08.CARB gene with a nucleotide sequence as shown in SEQ ID NO.2.

[0022] The present invention also provides a mutant gene of the carbohydrate-binding protein BnaCARB-encoding gene, and the mutant gene is carb-1 or carb-2;

[0023] The carb-1 includes the BnaA09.CARB mutant gene with a nucleotide sequence as shown in SEQ ID NO.21 and the BnaC08.CARB mutant gene with a nucleotide sequence as shown in SEQ ID NO.22;

[0024] The carb-2 includes the BnaA09.CARB mutant gene with a nucleotide sequence as shown in SEQ ID NO.23 and the BnaC08.CARB mutant gene with a nucleotide sequence as shown in SEQ ID NO.24.

[0025] The present invention also provides the application of the above mutant gene in regulating the 1000-grain weight of rapeseed or cultivating high-yield rapeseed.

[0026] The present invention discloses the following technical effects:

[0027] The present invention studies and discovers that the BnaCARB gene (BnaA09.CARB and BnaC08.CARB) in rapeseed can regulate the 1000-grain weight of rapeseed. The gene knockout mutant can cause a significant increase in the 1000-grain weight of rapeseed. By using this gene, the 1000-grain weight of rapeseed can be increased, and high-yield rapeseed germplasm can be obtained. The present invention reveals the regulatory mechanism of the rapeseed BnaCARB gene in regulating the 1000-grain weight and yield, provides a theoretical basis for further in-depth study of the physiological mechanism of rapeseed yield, and also provides genetic resources and technical support for the creation and cultivation of high-yield rapeseed germplasm, and has very important application prospects in the breeding and improvement of high-yield rapeseed varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0029] Figure 1 It is an analysis diagram of the expression pattern of the BnaCARB gene in different development stages of rapeseed seeds;

[0030] Figure 2 It is a target position diagram of the BnaCARB gene and a gene structure diagram of the BnaCARB mutant material; wherein, A is the target position of the BnaCARB gene; B is the gene structure diagram of the BnaCARB mutant material;

[0031] Figure 3 This is a graph showing the statistical analysis results of the 1000-seed weight of wild-type rapeseed (WT) and rapeseed BnaCARB mutant materials (carb-1 and carb-2). Specific Embodiments

[0032] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0033] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0034] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0035] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.

[0036] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0037] The experimental methods involved in the following examples are all conventional experimental methods in the art unless otherwise specified; the materials or reagents involved can be purchased from conventional channels unless otherwise specified.

[0038] Example 1 Expression Pattern of BnaCARB Gene

[0039] The BnaCARB gene family shows a multi-copy distribution pattern in the Brassica napus genome. A total of four paralogous genes were identified: BnaA09.CARB (BnaA09G0531600WE) located on chromosome A09, BnaC08.CARB (BnaC08G0361500WE) on chromosome C08, and BnaC06.CARB-1 (BnaC06G0262000WE) and BnaC06.CARB-2 (BnaC06G0262100WE) tandemly arranged on chromosome C06. In the rapeseed genome, the BnaCARB family genes are distributed on three chromosomes, namely A09, C08, and C06. To systematically investigate their expression dynamics during seed development, developing seed samples were collected every other day from 14 days to 64 days after seed development. Three biological replicates were set at each time point, and total RNA was extracted and sequencing libraries were constructed according to the standard protocol. The obtained clean reads were first aligned to the WESTAR reference genome by the HISAT2 software, and then the StringTie software was used to quantitatively analyze the gene expression levels based on the TPM (Transcripts Per Million) metric. Finally, the time-series expression data of BnaA09.CARB and BnaC08.CARB were visualized as line charts based on the obtained TPM matrix to intuitively reveal the expression patterns of the target genes during the entire seed development process. The results are as Figure 1 shown. The members of this gene family exhibit a significant tissue-specific expression pattern - BnaA09.CARB and BnaC08.CARB show high-abundance expression during the seed development stage (FPKM value > 50), while the expression levels of BnaC06.CARB-1 and BnaC06.CARB-2 are always below the detection threshold (FPKM < 1). Based on this expression feature, the present invention focuses on these two functional candidate genes, BnaA09.CARB and BnaC08.CARB. The nucleotide sequences (genomic sequences) of these two genes are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively, consisting of 7055 bp and 7494 bp; the protein sequences encoded by these genes are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively, encoding 1197 and 1197 amino acids.

[0040] SEQ ID NO.1:

[0041]

[0042] SEQ ID NO.2:

[0043]

[0044] SEQ ID NO.3:

[0045]

[0046] SEQ ID NO.4:

[0047]

[0048] Example 2 Construction of Brassica napus BnaCARB Mutant Materials

[0049] 1. Construction of BnaCARB-CRISPR Vector

[0050] The BnaCARB-CRISPR vector of Brassica napus was created using the sgRNA-Cas9 system of the team led by Chen Qijun from the College of Biology, China Agricultural University. The specific operation process is as follows:

[0051] (1) Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / , and screen out the target sgRNAs sgRNA1 and sgRNA2, which are located in the 5th and 25th exon regions of genes BnaA09.CARB and BnaC08.CARB respectively, targeting BnaA09.CARB and BnaC08.CARB (these two genes are highly expressed in developing seeds), as shown in Figure 2 A of.

[0052] sgRNA1: TATTAACTTCCGCTTCACG (SEQ ID NO.5);

[0053] sgRNA2: CCACTGGTTACTGGCATTG (SEQ ID NO.6).

[0054] (2) Design primers

[0055] DT1-BsF: ATATATGGTCTCGATTGTATTAACTTCCGCTTCACGGTT (SEQ ID NO.7);

[0056] DT1-F0: TGTATTAACTTCCGCTTCACGGTTTTAGAGCTAGAAATAGC (SEQ ID NO.8);

[0057] DT2-R0: AACCTGGTTACTGGCATTGCGGCAATCTCTTAGTCGACTCTAC (SEQ ID NO.9);

[0058] DT2-BsR: ATTATTGGTCTCGAAACCTGGTTACTGGCATTGCGGCAA (SEQ ID NO.10).

[0059] (3)PCR amplification: Use the pCBC-DT1T2 diluted 100 times as the template for four-primer PCR amplification. DT1–BsF and DT2-BsR are at normal primer concentrations; DT1-F0 and DT2-R0 are diluted 20 times. The amplification system is shown in Table 1. The PCR amplification program is as follows: total denaturation at 94°C for 2 min; denaturation at 98°C for 15 sec, annealing at 56°C for 30 sec, extension at 68°C for 30 sec, for 34 cycles; total extension at 68°C for 5 min.

[0060] Table 1 Amplification system

[0061]

[0062] (4)Purify and recover the PCR product, and establish the digestion-ligation system shown in Table 2. After the reaction ends, collect the recombinant vector.

[0063] Table 2 Digestion-ligation system

[0064]

[0065] (5)Transform Escherichia coli DH5α: Take 5 μL of transformed Escherichia coli competent cells and transfer the recombinant vector into Escherichia coli. Screen positive clones on the Kan plate, and identify and sequence them by PCR. The vector with correct sequencing is the BnaCARB-CRISPR vector.

[0066] (6)Introduce the correctly constructed BnaCARB-CRISPR vector into the Agrobacterium strain GV3101, and select positive monoclonal clones for storage in an -80°C refrigerator. The introduction method is as follows:

[0067] a. Take 50 μL of Agrobacterium competent cells GV3101;

[0068] b. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of competent cells;

[0069] c. Place the washed and dried electroporation cuvette on ice for pre-cooling, and then pipette the above mixture along the wall of the cuvette;

[0070] d. Set the electroporator to 1800 V;

[0071] e. Put the electroporation cuvette into the instrument for electroporation;

[0072] h. After successful electroporation, add 400 μL of antibiotic-free LB to the electroporation cuvette and transfer it to a sterile centrifuge tube;

[0073] i. Activate at 28°C for about 2 h, take 100 μL and spread it on a plate containing double antibiotics, seal it with a sealing film, invert it and culture it in a 28°C incubator for 2 days, and pick colonies for detection.

[0074] (7)Agrobacterium colony detection

[0075] Pick colonies and culture them in double-antibiotic LB at 28 °C for 2 hours. Take an appropriate amount of the bacterial solution for PCR detection, and preserve the positive Agrobacterium bacterial solution.

[0076] 2. Genetic transformation experiment

[0077] (1)Genetic transformation of rapeseed

[0078] Using Brassica napus Westar as the recipient plant, the positive Agrobacterium (containing the BnaCARB-CRISPR vector) constructed in the above process was transferred into the recipient plant by the Agrobacterium-mediated genetic transformation method. For the specific operation process, please refer to the reference (Dai C, Li Y, Li L, et al. An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus[J]. Molecular Breeding, 2020, 40(10). DOI: 10.1007 / s11032-020-01174-0.).

[0079] (2)Identification of CRISPR-transformed single plants

[0080] The obtained rapeseed CRISPR-transformed single plants were sequenced to screen for rapeseed mutants. First, the Cas9 protein was identified using the primer pair Cas9-570-F / Cas9-570-R. Then, the primer pairs CARB(A09)-CRISPR-F1 / CARB(A09)-CRISPR-R1, CARB(A09)-CRISPR-F2 / CARB(A09)-CRISPR-R2 were used to amplify the BnaA09.CARB gene in the Cas9 protein-positive single plants, and the primer pairs CARB(C08)-CRISPR-F1 / CARB(C08)-CRISPR-R1, CARB(C08)-CRISPR-F2 / CARB(C08)-CRISPR-R2 were used to amplify and sequence the BnaC08.CARB gene in the Cas9 protein-positive single plants.

[0081] The sequences of each primer are as follows:

[0082] Cas9-570-F: 5’ -AGACCGTGAAGGTTGTGGAC-3’ (SEQ ID NO.11);

[0083] Cas9-570-R: 5’-TAGTGATCTGCCGTGTCTC-G-3’ (SEQ ID NO.12);

[0084] CARB(A09)-CRISPR-F1: 5’- CCTCCACCGTCTACAAC-3’ (SEQ ID NO.13);

[0085] CARB(A09)-CRISPR-R1: 5’- CTCCATCAGAAGACAGTAAT-3’ (SEQ ID NO.14);

[0086] CARB(A09)-CRISPR-F2: 5’-CAAGGATCCGTCTCTCCC-3’ (SEQ ID NO.15);

[0087] CARB(A09)-CRISPR-R2: 5’-TCTCTTGGTAGATGATGCAC-3’ (SEQ ID NO.16);

[0088] CARB(C08)-CRISPR-F1: 5’-GGCGTTTCCGCGGATTT-3’ (SEQ ID NO.17);

[0089] CARB(C08)-CRISPR-R1: 5’- CGATGTGAGAACAGAAGCAATT-3’ (SEQ ID NO.18);

[0090] CARB(C08)-CRISPR-F2: 5’-CCAAGCTGCTGTTTCTG-3’ (SEQ ID NO.19);

[0091] CARB(C08)-CRISPR-R2: 5’- CTCTTGGTAGATGATGCTG-3’ (SEQ ID NO.20).

[0092] The amplification method is as follows:

[0093] The PCR system is: 2×Taq Master Mix 20 μL, DNA template 2 μL, F primer 1.6 μL, R primer 1.6 μL, supplemented with ddH2O to 40 μL. PCR conditions: total denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, extension at 72°C for 30 sec, 34 cycles; total extension at 72°C for 5 min.

[0094] The PCR products of the amplified target fragments were sequenced, and the sequencing results were analyzed using the online website DSDecode (http: / / skl.scau.edu.cn / dsdecode / ) to determine the editing status of the target sites. Finally, two independent mutant lines in which both homologous genes of BnaCARB (BnaA09.CARB and BnaC08.CARB) were edited were obtained, named carb-1 and carb-2 respectively. The sequencing results are shown as Figure 2 shown in B. By sequencing, the nucleotide sequence of the BnaA09.CARB gene in carb-1 is shown in SEQ ID NO.21, and the nucleotide sequence of the BnaC08.CARB gene is shown in SEQ ID NO.22. The nucleotide sequence of the BnaA09.CARB gene in carb-2 is shown in SEQ ID NO.23, and the nucleotide sequence of the BnaC08.CARB gene is shown in SEQ ID NO.24. The two independent mutant lines are loss-of-function mutants of the BnaCARB gene.

[0095] SEQ ID NO.21:

[0096]

[0097] SEQ ID NO.22:

[0098]

[0099] SEQ ID NO.23:

[0100]

[0101] SEQ ID NO.24:

[0102]

[0103] Example 3 Phenotypic Analysis of Wild-Type and Mutant Materials

[0104] To evaluate the regulatory effect of the BnaCARB gene on rapeseed grain weight, wild-type (WT) and two gene-edited mutants (carb-1, carb-2) were selected in this experiment. Both of these mutant materials were obtained by CRISPR / Cas9 technology. Seeds were sown in the field experiment station of Huazhong Agricultural University in September 2024. A completely randomized block design was adopted, with three rows (each row was 1.5 m wide and 5 m long) for each material, and the plant spacing was 30 cm × 10 cm. Other field management measures were the same.

[0105] At the seed maturity stage, materials from each row were harvested uniformly, air-dried to a moisture content of 15%, and then kept in a constant dry state at room temperature. After harvesting, 100 representative seeds (removing broken and deformed seeds) from each row of materials were taken, and the thousand-seed weight was measured using the SC-G type automatic seed analyzer (model: SC-G2000) provided by the National Rapeseed Engineering and Technology Research Center of Huazhong Agricultural University. Each sample was measured five times in the same batch, and the average value was taken as the thousand-seed weight of the sample. Finally, three groups of independent data for each material in three rows were obtained.

[0106] The experimental data were statistically analyzed using GraphPad Prism 9.0 software. First, the thousand-seed weight data were tested for normality and homogeneity of variance; then, one-way analysis of variance (One-way ANOVA) was performed, followed by Dunnett's multiple comparison test, with the wild-type WT as the control to test the significant differences between the mutants and WT. The results were expressed as mean ± standard deviation, and differences were considered statistically significant when P < 0.05.

[0107] The results showed that ( Figure 3 ), the thousand-seed weight of wild-type WT was 3.48 ± 0.50 g, and those of carb-1 and carb-2 were 4.07 ± 0.61 g and 4.23 ± 0.68 g, respectively; compared with WT, the thousand-seed weights of carb-1 and carb-2 were significantly increased (P < 0.01), indicating that the increase in rapeseed thousand-seed weight was significantly caused by the mutation of BnaCARB.

[0108] This example verified the key role of BnaA09.CARB and BnaC08.CARB in regulating rapeseed grain weight, providing a solid experimental basis for further analysis of its molecular mechanism and the creation of new high-yield rapeseed varieties.

[0109] The above examples are only the preferred embodiments of the present invention and should not limit the protection scope of the present invention. Those skilled in the art can make various equivalent substitutions or modifications based on this, and all should fall within the protection scope of the claims of the present invention.

Claims

1. Use of the carbohydrate-binding protein BnaCARB or its coding gene, or related biological material of the coding gene, in regulating the 1000-seed weight of rapeseed or cultivating high-yield rapeseed, characterized in that, The carbohydrate-binding protein BnaCARB includes BnaA09.CARB with the amino acid sequence shown in SEQ ID NO.3 and BnaC08.CARB with the amino acid sequence shown in SEQ ID NO.4; The encoding genes include the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that, The related biological material is the CRISPR / Cas9 gene editing vector of the encoding gene or a recombinant microorganism containing the CRISPR / Cas9 gene editing vector.

3. The use according to claim 1, characterized in that, The regulation of the thousand-seed weight of rapeseed is gene negative regulation, which causes the loss of function of the BnaA09.CARB gene and the BnaC08.CARB gene, and increases the thousand-seed weight of rapeseed.

4. The use according to claim 1, characterized in that, The cultivation of high-yield rapeseed is to cause the loss of function of the BnaA09.CARB gene and the BnaC08.CARB gene, and increase the yield of rapeseed.

5. A CRISPR / Cas9 gene editing vector for the carbohydrate-binding protein BnaCARB coding gene, characterized in that, The construction method of the CRISPR / Cas9 gene editing vector includes the following steps: (1) Screening out gene editing targets shown in SEQ ID NO.5 and SEQ ID NO.6 according to the carbohydrate-binding protein BnaCARB encoding gene; (2) Designing primers shown in SEQ ID NO.7-10 according to the gene editing targets; (3) Using the pCBC-DT1T2 plasmid as a template, amplifying the target gene with the primers; connecting the target gene to the CRISPR / Cas9 vector to obtain the CRISPR / Cas9 gene editing vector; The carbohydrate-binding protein BnaCARB encoding gene includes the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.

2.

6. A recombinant microorganism containing the CRISPR / Cas9 gene editing vector according to claim 5.

7. A method for increasing the 1000-seed weight of rapeseed, characterized in that, It includes the step of introducing the CRISPR / Cas9 gene editing vector described in claim 5 or the recombinant microorganism described in claim 6 into rapeseed to reduce or eliminate the function of the carbohydrate-binding protein BnaCARB encoding gene, so as to increase the thousand-seed weight of rapeseed; The carbohydrate-binding protein BnaCARB encoding gene includes the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.

2.

8. A method for cultivating high-yield rapeseed, characterized in that, It includes the step of introducing the CRISPR / Cas9 gene editing vector described in claim 5 or the recombinant microorganism described in claim 6 into rapeseed to obtain a high-yield rapeseed plant with the loss of function of the carbohydrate-binding protein BnaCARB encoding gene; The carbohydrate-binding protein BnaCARB encoding gene includes the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.

2.

9. A mutant gene of the carbohydrate-binding protein BnaCARB coding gene, characterized in that, The mutant gene is carb-1 or carb-2; The carb-1 includes the BnaA09.CARB mutant gene with the nucleotide sequence shown in SEQ ID NO.21 and the BnaC08.CARB mutant gene with the nucleotide sequence shown in SEQ ID NO.22; The carb-2 includes the BnaA09.CARB mutant gene with the nucleotide sequence shown in SEQ ID NO.23 and the BnaC08.CARB mutant gene with the nucleotide sequence shown in SEQ ID NO.

24.

10. Use of the mutant gene according to claim 9 in regulating the 1000-seed weight of rapeseed or cultivating high-yield rapeseed.

Images