Primer, probe group and kit for multiplex nucleic acid mass spectrometry detection of porcine diarrhea pathogens and application of primer, probe group and kit

Abstract

The invention relates to the technical field of molecular biological detection, in particular to a primer, a probe group and a kit for multiplex nucleic acid mass spectrometry detection of porcine diarrhea pathogens and application. By adopting a matrix-assisted laser desorption / ionization time-of-flight nucleic acid mass spectrometry technology, eight main pathogens such as PEDV, TGEV, PDCoV, PoRV, SADS-CoV, PBoV, HEV and salmonella can be rapidly, sensitively and specifically detected at the same time. By designing the specific primer and the unexpanded probe and combining multiple PCR amplification and mass spectrometry, the method realizes high-throughput and multi-pathogen simultaneous detection. Experimental results show that the method has high sensitivity and high specificity, has no false positive reaction, and shows 100% repeatability in 60 repeated experiments. Compared with a qPCR method, the detection consistency is as high as 96.2%. The method has the advantages of being easy and convenient to operate, high in detection speed and high in adaptability, can be widely applied to efficient monitoring of porcine diarrhea pathogens, and provides important technical support for early diagnosis, prevention and control of porcine diseases.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and in particular to a primer and probe set, a kit and an application for multiplex nucleic acid mass spectrometry detection of swine diarrhea pathogens. Background Art

[0002] Swine gastrointestinal diseases, especially swine diarrhea, have become one of the most challenging health problems in the global swine industry. These diseases are mainly caused by viral and bacterial pathogens, and typical pathogens include porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), porcine rotavirus (PoRV), swine acute diarrhea syndrome coronavirus (SADS-CoV), porcine bocavirus (PBoV), hepatitis E virus (HEV), and Salmonella, etc. These pathogens not only cause growth retardation in swine herds, but also are accompanied by high mortality rates, and may affect public health through pork and its products, bringing huge economic losses to the global livestock industry.

[0003] Among them, it is worth noting porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), porcine rotavirus (PoRV), and swine acute diarrhea syndrome coronavirus (SADS-CoV). These gastrointestinal viruses are highly harmful. Their main clinical symptom of diarrhea is often difficult to distinguish, posing a major challenge to differential diagnosis in this field. In addition, fecal-oral pathogens such as Salmonella and hepatitis E virus (HEV) infect swine and cause serious public health problems due to their zoonotic potential. HEV and Salmonella excreted from the feces of infected swine can contaminate the environment, leading to cross-species transmission to humans and amplifying the risk of foodborne or waterborne outbreaks. Porcine bocavirus (PBoV) is a virus frequently detected in swine and has recently become a potential contributor to gastrointestinal diseases. Although PBoV genotypes G1, G2, and G3 have been identified, the investigation of its prevalence and significance in diarrheal swine remains limited. These pathogens often occur simultaneously in mixed infections, complicating the etiological diagnosis of swine diarrhea diseases and increasing the demand for laboratory-based precise pathogen identification diagnostic tools.

[0004] Currently, commonly used clinical detection methods include virus isolation and culture, serological detection, enzyme-linked immunosorbent assay (ELISA), reverse transcription polymerase chain reaction (RT-PCR) and other molecular biology methods. Although these methods have certain application values to a certain extent, there are still many problems. For example, virus isolation and culture requires a long time and is cumbersome to operate; serological detection may have cross-reactions for the detection of virus antibodies, making it difficult to make a clear diagnosis; ELISA and RT-PCR methods are often restricted by factors such as sensitivity, specificity, and operation complexity in the detection of multiple pathogens.

[0005] In terms of the detection of multiple pathogens, although the existing PCR technology can achieve the simultaneous detection of multiple targets, it still faces some challenges. For example, traditional RT-PCR methods usually have difficulties in primer optimization, and their sensitivity and specificity often cannot meet the requirements of high-throughput detection. At the same time, the analysis process of PCR products requires relying on equipment such as electrophoresis and fluorescence quantitative PCR, with cumbersome operation steps and high requirements for sample volume and time.

[0006] Chinese invention patent (Publication No.: CN117625854A) discloses a detection primer-probe composition, detection kit and application for porcine viral diarrhea, which can simultaneously detect 4 porcine viral diarrhea viruses, and the detection method is accurate, with high specificity and sensitivity, and good stability. However, this patent still has the problem that the detection specificity and sensitivity need to be further improved.

[0007] Chinese invention patent (Publication No.: CN108950083A) discloses a multiplex RT-PCR primer set for simultaneously detecting porcine Getah virus, porcine epidemic diarrhea virus, transmissible gastroenteritis virus of swine, porcine deltacoronavirus and porcine group A rotavirus. This detection method has strong specificity and high sensitivity, can simultaneously identify five viruses, with accurate detection results and high detection efficiency. However, this patent still has the problem that the primer sequences need to be further optimized to improve the detection sensitivity and specificity.

[0008] It can be seen that the existing detection methods have defects such as cumbersome operation, long cycle, insufficient sensitivity and specificity, and it is difficult to meet the requirements of rapid and accurate detection of multiple porcine diarrhea pathogens. At the same time, the primer sequences of the existing detection methods need to be further optimized to improve the detection sensitivity and specificity. Although the roles of HEV and PBoV in porcine gastrointestinal diseases have not been fully elucidated, due to their zoonotic potential, the existing detection methods are difficult to meet the requirements of reliable and high-throughput detection of these pathogens.

[0009] Based on this, in recent years, researchers have attempted to improve existing detection techniques in order to achieve rapid, accurate, and high-throughput multi-pathogen detection. Multiplex matrix-assisted laser desorption / ionization time-of-flight nucleic acid mass spectrometry (MALDI-TOF NAMS), as an emerging detection technique, has shown great potential in the field of pathogen detection in recent years. MALDI-TOF NAMS uses mass spectrometry technology to analyze PCR amplification products and identify target pathogens by detecting changes in molecular weight. The advantages of this technique include high sensitivity, low detection limit, high specificity, and rapid detection, etc., which can effectively improve the detection efficiency and accuracy. Especially in the context of complex pathogen co-infections, it has shown great advantages.

[0010] However, the current MALDI-TOF NAMS technology still faces some technical challenges in the multiplex detection of swine diarrhea pathogens, including the optimization of primer design, the improvement of pathogen recognition sensitivity, and the further enhancement of the multiplex target detection ability of the mass spectrometry analysis system. Therefore, there is an urgent need to develop an improved MALDI-TOF NAMS detection method that can simultaneously, rapidly, and accurately detect multiple swine diarrhea-related pathogens and overcome the problems of insufficient sensitivity and specificity in existing technologies, especially improving the detection accuracy and reliability in clinical samples with co-infections. Summary of the Invention

[0011] To solve the above technical problems, the purpose of the present invention is to provide a primer and probe set for multiplex nucleic acid mass spectrometry detection of swine diarrhea pathogens based on the MALDI-TOF NAMS method, which can simultaneously detect pathogens such as porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), swine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV), and Salmonella (Sal), etc., and has high sensitivity, specificity, and repeatability, providing strong technical support for the diagnosis and control of swine diarrhea.

[0012] To achieve the above purpose, the present invention adopts the following technical solutions: A primer and probe set for multiplex nucleic acid mass spectrometry detection of swine diarrhea pathogens based on the MALDI-TOF NAMS method, where the swine diarrhea pathogens are porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), swine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV), and Salmonella (Sal); the PCR primers and probes are as follows: PDCoV: The nucleotide sequence of the upstream primer is catatcctgtggcggatttc, the nucleotide sequence of the downstream primer is cagtcgttaagcatggcaag, and the nucleotide of the probe is cagtcgttaagcatggcaag; PEDV: The nucleotide sequence of the upstream primer is aaataaccagggtcgtggag, the nucleotide sequence of the downstream primer is tcttggactggttacgagac, and the nucleotide of the probe is cattattattgcctcctc; TGEV: The nucleotide sequence of the upstream primer is tgtgatggagtatgggtatc, the nucleotide sequence of the downstream primer is cattgtattgggattatgc, and the nucleotide of the probe is gggAACggttaaacgtagt; SADS-CoV: The nucleotide sequence of the upstream primer is ggcttactctaaacccagtc, the nucleotide sequence of the downstream primer is ttgggaaactggagtagctg, and the nucleotide of the probe is acactggggcatcagcattt; HEV: The nucleotide sequence of the upstream primer is tggttggatgaatataggg, the nucleotide sequence of the downstream primer is agtgccggcggtggtttctg, and the nucleotide of the probe is gtggtttctggggtgac; PoRV: The nucleotide sequence of the upstream primer is gtcaatcagactctacaag, the nucleotide sequence of the downstream primer is ggtcacatcctctcacta, and the nucleotide of the probe is cccagttactctacgtagcg; PBoV-G1: The nucleotide sequence of the upstream primer is gtgtttggttgtttgtccc, the nucleotide sequence of the downstream primer is gacacagtatggcaataccc, and the nucleotide of the probe is gggacccaatgcaagcatgga; PBoV-G2: The nucleotide sequence of the upstream primer is aaaagccacgctcatgcag, the nucleotide sequence of the downstream primer is ggtaacgccaaacgtgtttc, and the nucleotide of the probe is tgtttcccatcggta; PBoV-G3: The nucleotide sequence of the upstream primer is cccAACagttttcctctagc, the nucleotide sequence of the downstream primer is agtagtgtgaggcaggtaac, and the nucleotide of the probe is ccacaaggtccttgagcg; Sal: The nucleotide sequence of the upstream primer is tagaacgaccccataaacac, the nucleotide sequence of the downstream primer is tccattacctacctatctgg, and the nucleotide of the probe is acctatctggttgatt.

[0013] Preferably, the primer and probe set further includes a primer and probe set for detecting the porcine RPL4 gene as an internal control. The nucleotide sequence of the upstream primer of the internal control is tttggatctctgggcttttc, the nucleotide sequence of the downstream primer is ctgctaccctcaagagtaac, and the nucleotide of the probe is agatgctcaatacagaccttagc.

[0014] Preferably, a 10-base tag acggtggatg is added to the 5' end of each PCR primer.

[0015] Furthermore, the present invention also provides the application of the primer and probe set in the preparation of reagents for the multiplex detection of porcine diarrhea pathogens by the MALDI-TOF NAMS method.

[0016] Furthermore, the present invention also provides a kit containing the primer and probe set.

[0017] Preferably, the kit further includes a standard plasmid, and the standard plasmid is as described below: .

[0018] Preferably, the kit contains 2 μL of recombinant plasmid 10 4 copies / μL, 2.5 μL of 2×HU MP buffer, 0.3 μL of enzyme mixture, 0.2 μL of each target-specific PCR primer, shrimp alkaline phosphatase SAP, reaction buffer, 1 μL of probe mixture, 0.04 μL of Inplex enzyme, 0.2 μL of ddNTP termination mixture, 0.2 μL of Inplex buffer, and 0.56 μL of ddH2O.

[0019] Preferably, the PCR thermal cycling conditions of the kit are as follows: reverse transcription is carried out at 50°C for 10 min, initial denaturation is at 95°C for 5 min, and then 45 cycles: 95°C for 15 s, 60°C for 30 s, and finally 72°C for 5 min; after amplification, shrimp alkaline phosphatase SAP and reaction buffer are added to 2 μL of the PCR product for dNTP dephosphorylation; the mixture is incubated at 37°C for 40 min and then inactivated at 85°C for 5 min.

[0020] Preferably, in the extension reaction of the kit, the dephosphorylated product is mixed with 1 μL of UEP mixture, 0.04 μL of Inplex enzyme, 0.2 μL of termination mixture (containing ddNTP), 0.2 μL of Inplex buffer, and 0.56 μL of ddH2O; the extension program includes 40 cycles, 30 s at 95°C, followed by 40 cycles: 5 s at 95°C, 5 s at 52°C, 5 s at 80°C, and 3 s at 72°C.

[0021] Furthermore, the present invention also provides the application of the primer and probe set or the kit in the multiplex detection of porcine diarrhea pathogens in non-disease diagnosis based on MALDI-TOF NAMS method, and the porcine diarrhea pathogens are porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), swine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV), and Salmonella (Sal).

[0022] Due to the adoption of the above technical solution, the present invention has the following remarkable technical effects: 1. High-throughput and simultaneous detection of multiple pathogens: The method of the present invention can simultaneously, quickly, and accurately detect 8 major porcine diarrhea pathogens, including porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), porcine rotavirus (PoRV), swine acute diarrhea syndrome coronavirus (SADS-CoV), porcine bocavirus (PBoV), hepatitis E virus (HEV), and Salmonella. This method overcomes the problem that traditional detection methods need to be performed separately multiple times, greatly improves the detection efficiency, and meets the requirements of high-throughput and simultaneous detection of multiple pathogens in clinical practice.

[0023] 2. High sensitivity and high specificity: Using MALDI-TOF NAMS technology for pathogen detection has extremely high sensitivity and specificity. The sensitivity range of this method is 12.20 - 33.59 copies / μL, which can detect low-concentration pathogen nucleic acids and ensure efficient detection in complex samples. At the same time, the specificity has been significantly improved, without false positive reactions, and can accurately distinguish target pathogens from non-target microorganisms, avoiding the common cross-reaction problems in traditional methods.

[0024] 3. High repeatability and reliability: The method of the present invention has good repeatability and reliability under multiple experimental conditions. In 60 repeated experiments, the within-batch and between-batch repeatability reached a 100% detection rate, ensuring stability and consistency in routine use. This high repeatability makes the detection method of the present invention suitable for large-scale sample detection, especially having important application value in the clinical environment.

[0025] 4. High consistency with traditional methods: By comparing the MALDI-TOF NAMS method of the present invention with the qPCR method, it is found that the overall consistency rate reaches 96.2%. This result indicates that the method provided by the present invention has comparable or even higher accuracy with traditional methods in the detection of clinical samples, and has strong clinical application prospects.

[0026] 5. Fast and simple detection process: The detection method of the present invention does not require complex operation steps, can complete the detection of multiple pathogens in a short time, reduces the detection time, and does not require cumbersome electrophoresis analysis or additional equipment support. The operation is simple and suitable for large-scale application.

[0027] 6. Strong scalability and adaptability: This method uses a MALDI-TOF mass spectrometer and has strong adaptability, and can be easily extended for the detection of other pathogens. By appropriately adjusting the primer and probe design, it can be quickly applied to the detection of other swine pathogens or different types of samples, and has broad application potential.

[0028] 7. Of great significance for the early monitoring of cross-species transmission pathogens: Since porcine bocavirus (PBoV) and hepatitis E virus (HEV) have potential zoonotic risks, the high-throughput detection method provided by the present invention can achieve the early monitoring of these pathogens, providing an effective technical means for preventing the cross-species transmission of pathogens, and having important public health significance.

[0029] In summary, through innovative multiplex detection technology, the present invention overcomes the deficiencies of traditional detection methods in sensitivity, specificity, and high-throughput detection, provides a fast, accurate, and efficient detection solution, and has important technical and application value for the early diagnosis and control of swine diarrhea. Brief Description of the Drawings

[0030] Figure 1- Figure 10 Are respectively 10 3 Overlay graph of MALDI-NAMS of copies / μL plasmid (black) and blank control (red) with added unextended probe (UEP). Figure 1 For HEV-3&HEV-4, Figure 2 For PBoV-G1, Figure 3 For PBoV-G2, Figure 4is PBoV-G3, Figure 5 is PDCoV, Figure 6 is PEDV, Figure 7 is PoRV, Figure 8 is TGEV, Figure 9 is SADS-CoV, Figure 10 is Salmonell; the blank control for each target only shows the unextended probe (UEP) peak, and no single-base extension product (SEP) peak is detected. In contrast, the plasmid shows a completed SEP peak, based on which it is possible to clearly distinguish whether the target nucleic acid fragment is present in the sample.

[0031] Figure 11 shows that the black signal peak uses the mixed plasmid at 10 3 copies / μL as a template to simulate the presence of all targets. Among them, the red signal peak uses ddH2O as a template. The UEP and SEP of each target are marked with their respective colors, and the SEP is represented by the base (A, C, or T) extended by the target. The SEP peak and UEP peak can be clearly distinguished in the NAMS image.

[0032] Figure 12 verifies the specificity of MALDI-TOF NAMS by detecting target and non-target pathogens. Among them, the X-axis: the specific targets of the primers and UEPs used in this detection. The Y-axis: the mixed standard plasmid (positive control), target and non-target pathogen samples, negative pork (negative control), and water (blank control). The Z-axis: the signal-to-noise ratio (SNR) value.

[0033] Figure 13 HEV-3 and HEV-4 detected in different samples. Among them, there is no interference between the SEPs of HEV-3 (A) and HEV-4 (C).

[0034] Figures 1-11 and Figure 13 in: A, C, and T are bases, UEP.HEV is the unextended probe of swine hepatitis E virus, UEP.PEDV is the unextended probe of porcine epidemic diarrhea virus, UEP.PBoV-G1 is the unextended probe of porcine bocavirus type 1, UEP.PBoV-G2 is the unextended probe of porcine bocavirus type 2, UEP.PBoV-G3 is the unextended probe of porcine bocavirus type 3, UEP.PDCoV is the unextended probe of porcine deltacoronavirus, UEP.Sal is the unextended probe of Salmonella, UEP.PoRV is an unextended probe for porcine rotavirus, UEP.SADS-CoV is an unextended probe for swine acute diarrhea syndrome coronavirus, UEP.TGEV is an unextended probe for transmissible gastroenteritis virus, UEP.RPL4 is an unextended probe for porcine RPL4 gene. Detailed implementation manners

[0035] Combined with the embodiments of the present invention below, the technical solutions in the embodiments will be clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0036] 1. Materials and methods 1.1 Viruses and positive templates The strain, bacteria and virus nucleic acid samples used in the present invention are mainly used for specificity evaluation. Inactivated virus strains, including porcine epidemic diarrhea virus (PEDV, CV777 strain), transmissible gastroenteritis virus (TGEV, WH-1R strain), porcine reproductive and respiratory syndrome virus (PRRSV, HuN4 strain), pseudorabies virus (PRV, Bartha strain) and porcine circovirus type 2 (PCV-2, JH-SRJ strain); porcine deltacoronavirus (PDCoV, P25 GH7DQ0301 strain), swine acute diarrhea syndrome coronavirus (SADS-CoV), porcine rotavirus (PoRV), porcine bocavirus (PBoV), porcine hepatitis E virus (HEV), classical swine fever virus (CSFV, C strain), foot-and-mouth disease virus (FMDV, OHM / 02 and AKT-111 strains), Japanese encephalitis virus (JEV, SA14-14-2 strain), PEDV+TGEV bivalent live vaccine (WH-1R+AJ1102-R) and nucleic acid samples of Salmonella enterica (ATCC 9842, ATCC 13076, ATCC 35640) are positive.

[0037] 1.2 Preparation of virus nucleic acid templates Using TaKaRa MiniBEST Virus RNA / DNA Extraction Kit (TaKaRa, Japan), according to the manufacturer's protocol, extract and purify virus nucleic acid. The obtained DNA and RNA templates are stored at -20°C for subsequent use.

[0038] 1.3 Primer and UEP design and synthesis Based on the genomic sequences of the above-mentioned pathogens retrieved from the NCBI database, primers for the conserved regions of these genes and corresponding unextended probes (UEPs) were designed. Sequence analysis and multiple sequence alignment were performed using CLC Genomics Workbench 23 (Qiagen, Germany) and MEGA-X (New Zealand). Primer and UEP design was carried out using the Primer3Plus and MassARRAY Assay Design Suite (Agena, USA). For TGEV, we specifically designed primers for the S gene to ensure specificity by avoiding the consensus region of its PRCV variant. For HEV, we designed a single-base extension site to distinguish HEV-3 (A, 5560.6 Da) and HEV-4 (C, 5536.6 Da) based on 3'-terminal single nucleotide polymorphisms (SNPs). The PBoV UEPs were designed based on the variations in the NS1 and VP1 genes in genotypes G1, G2, and G3 to ensure inclusivity for all genotypes. In addition, the porcine RPL4 gene (XM_005659862) was used as an internal control in the present invention.

[0039] To prevent possible peak interference of multiple primers in mass spectrometry, a 10-base tag (acggtggatg, shown in bold in Table 1) was attached to the 5'-end of each PCR primer. Primer and probe sequences were designed by Primer-Blast and MFEprimer 4. The sequences of all primers and UEPs are shown in Table 1. All oligonucleotides were synthesized and purified by Sangon Biotech (China). qPCR primers and probes were obtained and synthesized from existing studies or commercial kits. The limit of detection (LOD) for all qPCR assays was less than 100 copies / µL.

[0040] Table 1 Primers and UEPs for MALDI-TOF NAMS

[0041] Sorted by the molecular weight of the single-base extension product SEP. The single-base extension of the UEP is marked with an uppercase letter and an underline.

[0042] 1.4 Construction of standard plasmids The target gene sequences corresponding to the primer design regions of each virus were synthesized and cloned into the pUC57 plasmid vector (Sangon, China). These recombinant plasmids were used as standard templates to evaluate the performance of the detection system in the present invention. The details of the standard plasmids are listed in Table 2. The copy number of each plasmid was quantified using Qubit4 (ThermoFisher, USA). Each standard plasmid was first diluted to 10 8 copies / μL, and then serially diluted 10-fold to form a series from 10 8 to 10 0Copy / μL concentration range. In subsequent experiments, a mixed plasmid solution was prepared as a positive control at each gradient concentration (10 7 ~10 0 copies / μL). Aliquots of these plasmid mixtures were stored for downstream assays.

[0043] Table 2 Plasmids used in the present invention

[0044] 1.5 Optimization of the reaction system and reaction conditions To optimize the reaction system, the primers and UEPs listed in Table 1 were used to detect a 10 4 copies / μL plasmid template for each target. Subsequently, a mixed plasmid sample containing 10 4 copies / μL at equal concentrations of 11 targets was used to optimize the multiplex conditions. The initial concentrations of all primers and UEPs were set at 5 μmol / L and adjusted to achieve uniform UEP peak intensity and E SEP / UEP ≥ 0.8. Optimization included fine-tuning the primer and UEP concentrations, annealing temperature (55°C - 60°C), and annealing time (20 - 35 s) in the multiplex PCR system. All experiments included a negative control using ddH2O, and the correct mass spectrometry peaks were used to evaluate the results.

[0045] PCR settings and reaction conditions: Each reaction mixture contained 2 μL of recombinant plasmid (10 4 copies / μL), 2.5 μL of 2×HU MP buffer, 0.3 μL of enzyme mixture (Yeasen, China), and 0.2 μL of each target-specific primer. The thermal cycling conditions were as follows: Reverse transcription was carried out at 50°C for 10 min, initial denaturation at 95°C for 5 min, followed by 45 cycles: 95°C for 15 s, 60°C for 30 s, and finally 72°C for 5 min. After amplification, shrimp alkaline phosphatase (SAP) and reaction buffer (Agena, USA) were added to 2 μL of the PCR product for dNTP dephosphorylation. The mixture was incubated at 37°C for 40 min and then inactivated at 85°C for 5 min. In the extension reaction, the dephosphorylated product was mixed with 1 μL of UEP mixture, 0.04 μL of Inplex enzyme, 0.2 μL of termination mixture (containing ddNTP), 0.2 μL of Inplex buffer (Agena, USA), and 0.56 μL of ddH2O. The extension program included 40 cycles at 95°C for 30 s, followed by 40 cycles: 95°C for 5 s, 52°C for 5 s, 80°C for 5 s, and 72°C for 3 s. The UEP will specifically bind to the target sequence in the PCR product, and the chain termination reaction using ddNTPs generates SEP.

[0046] Transfer the SEPs onto a 384-well plate, dilute to 25 μL with ddH₂O, and centrifuge at 8000 rpm for 2 min. Load the prepared plate together with the inert matrix chip into a DP-TOF mass spectrometer (Digena, China). Import the pre-edited analysis file containing the molecular weight information of each UEP and SEP into the instrument software. After completing the sample and plate settings, set the addition of resin to purify the product. The results will be evaluated based on the correct positioning of the peaks in the mass spectrum, and the UEP and SEP peaks corresponding to each target will be detected to confirm the success of amplification and extension.

[0047] 1.6 Specificity, sensitivity, and reproducibility of MALDI-TOF NAMS The performance of the method was determined by analyzing the consistency of the results for each target. To evaluate the specificity of the MALDI-TOF NAMS method, we detected the genomic nucleic acids extracted from inactivated target virus cultures or vaccines. Non-target nucleic acids of inactivated CSFV, FMDV, PRRSV, PRV, and PCV-2 were used as negative controls, a plasmid mixture at 10 4 copies / μL was used as a positive control, and ddH₂O was used as a blank control.

[0048] To evaluate the sensitivity of NAMS, a series of concentrations were generated by preparing two consecutive dilutions of the plasmid mixture (initial concentration: 100 copies / μL), including 50, 25, 12.5, 12.5, 6.2, 3.1, and 1.6 copies / μL. Each diluted plasmid was detected 10 times with the optimized primers and UEPs, and the LOD for each target was determined.

[0049] For reproducibility evaluation, we used plasmid mixtures at high, medium, and low concentrations (10 6 , 10 4 , and 10 2 copies / μL, respectively) as templates. Each dilution was repeated 20 times to evaluate the reproducibility within the assay method. Additionally, two independent experiments (with a 7-day interval between experiments) were conducted, and the results of three independent batches of experiments were analyzed. The reproducibility between different batches was evaluated based on the detection results of different target primers at different plasmid concentrations.

[0050] 1.7 Evaluation of clinical sample results by MALDI-TOF NAMS To verify the ability of the MALDI-TOF NAMS method to detect multiple pathogens in clinical samples, we evaluated a total of 242 different types of diarrhea samples using MALDI-TOF NAMS and qPCR methods. Some inconsistent samples were verified by dPCR.

[0051] For sample preparation, nucleic acid extraction was directly performed using blood samples (1 - 2 mL). The fecal specimens (1 - 2 g) were diluted 10 - fold with PBS, thoroughly vortexed, centrifuged at 10000 rpm for 5 min, and then the supernatant was collected. The tissue samples (1 - 2 g) were homogenized in 5 - 10 mL of 10 mM phosphate - buffered solution (PBS, pH 7.2) at a mass - to - volume ratio of 1:5. The homogenate was processed with a tissue grinder, centrifuged at 10000 rpm for 5 min, and the supernatant was collected.

[0052] Nucleic acid extraction and purification were carried out using a MagNA Pure 24 instrument and the corresponding total nucleic acid extraction kit (Roch, Switzerland). Subsequently, optimized conditions for multiplex reverse transcription PCR, SAP digestion, and UEP extension were employed. Each sample was tested in 3 replicates, using ddH2O and a 10 4 copy / μL plasmid mixture as negative and positive controls, respectively.

[0053] 2. Results 2.1 Single - target MALDI - TOF NAMS detection Mass spectrometry analysis using a single plasmid as a template ( Figures 1-10 shown) revealed that each tested standard plasmid generated an obvious SEP peak (black) at the predicted mass position, while only the UEP peak (red) was detected in the corresponding blank control. Based on the specific mass of each target, the UEP peak and SEP peak could be clearly distinguished. The positions of these two peaks were consistent with those shown in Table 1, confirming the specificity and functionality of the designed primers and UEPs.

[0054] 2.2 Multiplex detection of 11 targets Using a mixed plasmid template (10 4 copies / μL for each target), the ability of the system to detect multiple targets simultaneously was evaluated. Figure 11 The mass spectra obtained under the optimized reaction conditions are shown. All 11 SEP peaks were detected at their expected mass positions with minimal overlap or interference, indicating successful multiplex amplification and extension of UEPs. In addition, no irrelevant peaks or significant changes in peak heights were observed, confirming the compatibility of the detection method in a multiplex environment. To ensure uniform signal detection, the initial concentrations of the primers and UEPs were adjusted during the optimization process (Table 3).

[0055] Table 3 Final concentrations of primers and UEPs used in MALDI - TOF NAMS

[0056] 2.3 Specificity of MALDI - TOF NAMS Using the genomic DNA or cDNA of 10 target pathogens and 5 non-target controls as templates, after amplification, mass spectrometry analysis was performed on the extension reaction products. As Figure 12 shown, the SEP peaks corresponding to PDCoV, PEDV, TGEV, SADS-CoV, HEV, PoRV, PBoV-G1 / G2 / G3, and Sal were detected in the reactions using their respective target pathogens or mixed plasmids as templates. In addition, according to the extended bases, HEV-3 and HEV-4 can be distinguished by a single UEP ( Figure 1 ). In contrast, no amplification occurred for non-target pathogens (including CSFV, FMDV, PRRSV, PRV, and PCV 2) and the blank control. The mass spectra of these non-target samples only showed UEP peaks, confirming the high specificity of MALDI-TOF NAMS detection for the selected target pathogens. This specificity ensures that the detection method can reliably distinguish target pathogens in complex biological samples without cross-reacting with non-target microorganisms, highlighting its robustness and accuracy in diagnostic applications.

[0057] 2.4 Sensitivity of MALDI-TOF NAMS Using serial dilutions of a mixed plasmid with concentrations ranging from 100 copies / μL to 1.6 copies / μL, the sensitivity of MALDI-TOF NAMS detection was evaluated. All targets were reliably detected at 12.5 copies / μL. Then, Probit regression analysis was performed to calculate the LoD (99% detection probability) and its 95% confidence interval based on 10 replicates at each concentration. The results are shown in Table 4, and the LoD values for all targets ranged from 12.20 copies / μL to 33.59 copies / μL, indicating the high sensitivity and reliable performance of this method at low nucleic acid concentrations.

[0058] Table 4 Results of sensitivity test

[0059] 2.5 Reproducibility of MALDI-TOF NAMS The reproducibility of MALDI-TOF NAMS detection was evaluated using a mixed plasmid template at high, medium, and low concentrations. At each concentration, the detection rate of all targets was 100% (20 / 20 per concentration, 60 / 60 in total). In two subsequent independent experiments, all targets were also detected with a 100% positive rate (60 / 60 per batch). These results indicate that the method has good within-batch and between-batch reproducibility, ensuring the reliability of its routine detection.

[0060] 2.6 Evaluation of MALDI-TOF NAMS for three types of samples Using 242 clinical samples, including feces (=97), tissue (=132), and serum (=13) specimens, the performance of the MALDI-TOF NAMS method was further verified. To evaluate the accuracy of MALDI-TOF NAMS, we used qPCR as the reference method and analyzed the concordance rate between the two methods (Table 5). Statistical data for HEV included HEV-3 and HEV-4, and for PBoV included the combined results of all genotypes. The results showed that the overall concordance rate for individual targets was 92.6% - 100.0% (except for TGEV). When the data for all targets were combined, the overall concordance rate for different sample types was 93.2% - 98.3%, and the overall concordance rate for all 242 samples was 96.2%. These findings indicate a high degree of concordance between MALDI-TOF NAMS and qPCR, supporting the reliability and accuracy of the newly developed method for detecting multiple pathogens in clinical diarrhea samples.

[0061] Table 5 Results of detecting 242 clinical samples using NAMS and their concordance rates with qPCR

[0062] *: The overall concordance rate of PBoV was calculated based on the detection results of genotypes G1, G2, and G3; Positive concordance rate (%) = P NAMS &P qPCR / P qPCR ×100% Negative concordance rate (%) = N NAMS &N qPCR / N qPCR ×100% Overall concordance rate (%) = (P NAMS &P qPCR +N NAMS &N qPCR ) / total × 100%.

[0063] N: Negative; P: Positive.

[0064] 3. Discussion Porcine diarrhea syndrome (PDS) poses a serious threat to the health of global swine populations and the development of the world's swine industry, causing significant economic losses, especially in terms of import and export trade. The complex landscape of diarrhea pathogens in pigs, combined with the emergence of new pathogens, has increased the challenges of disease prevention and control. Therefore, there is an urgent need for new diagnostic technologies that can handle mixed infections and effectively detect various pathogens. The present invention aims to evaluate the performance of nucleic acid mass spectrometry (NAMS) for the detection of PDS-related pathogens. Our research results show that NAMS enables high-sensitivity, high-specificity, high-throughput, and multiplex pathogen detection, addressing some limitations of existing diagnostic methods such as ELISA, qPCR, and NGS. These results highlight the potential of NAMS as a powerful tool for large-scale pathogen surveillance and disease control.

[0065] PEDV, TGEV, SADS-CoV, and PDCoV all belong to the Coronaviridae family. Coronaviruses have received extensive attention due to their broad host range and potential for cross-species transmission. The emergence of coronaviruses such as MERS-CoV, SARS-CoV, and SARS-CoV-2 has starkly reminded of the risks associated with interspecies spillover. For example, phylogenetic analysis indicates that PDCoV, first discovered in 2012, is thought to have originated from an interspecies transmission event involving avian and mammalian coronaviruses. Studies have shown that PDCoV uses its spike (S) protein to bind to host aminopeptidase N (APN), enabling it to infect cells from pigs, chickens, and humans. The high conservation of APN across species may have played a key role in facilitating the cross-species infectivity of PDCoV. Notably, PDCoV is not the only enteric coronavirus that utilizes APN; PEDV and TGEV also rely on this receptor, suggesting potential commonalities in the host-switching mechanisms of coronaviruses. In addition, studies have shown that SADS-CoV can effectively replicate in a variety of mammalian cell lines, including primary human lung and intestinal cells, further emphasizing the potential for cross-species transmission. Similar to HEV and PBoV, the widespread distribution and zoonotic potential of porcine coronaviruses require a comprehensive investigation of their epidemiology and transmission dynamics. These efforts are crucial for assessing and mitigating the potential public health risks associated with these pathogens.

[0066] The present invention utilizes the advantages of NAMS for SNP genotyping of HEV-3 and HEV-4 genes, such as Figure 13HEV-3 and HEV-4 detected in different samples are shown. There is no interference between the SEPs of HEV-3 (A) and HEV-4 (C). Similarly, SNP genotyping can be further used to distinguish pathogen variations, such as virulent strains from attenuated strains, and wild-type strains from vaccine strains. On the other hand, the successful detection of Salmonella targets indicates that the NAMS method is capable of simultaneously detecting RNA viruses, DNA viruses, and bacteria. This greatly broadens the scope of pathogen detection and its application scenarios, especially in diagnosing syndromes of unknown etiology. This ability depends on the selection of a suitable nucleic acid extraction method.

[0067] 4. Conclusions In summary, the present invention demonstrates the potential of nucleic acid mass spectrometry (NAMS) as a tool suitable for the detection and genotyping of swine diarrhea pathogens. Although the method shows strong sensitivity and specificity, it is still an emerging technology that complements traditional diagnostic methods such as qPCR and NGS. The ability to multiplex detect these pathogens in a single assay not only improves the accuracy of diagnosis but also provides a comprehensive understanding of coinfections, which are common in clinical settings. This is particularly useful for complex mixed infections because traditional single-target methods often complicate the diagnosis. The broader potential of NAMS lies in its application to pathogen surveillance, especially in epidemiological surveillance, for the early detection of emerging infectious diseases in animal populations and potentially incorporating them into the entry-exit quarantine process. It provides a new means for more effective and accurate pathogen screening, which is crucial for controlling the cross-border spread of animal diseases.

[0068] The above is the description of the embodiments of the present invention. Through the above description of the disclosed embodiments, those skilled in the art can implement or use the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown herein, but rather will be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer and probe set for multiplex nucleic acid mass spectrometry detection of porcine diarrhea pathogens based on MALDI-TOF NAMS method, wherein the porcine diarrhea pathogens are porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV) and Salmonella ( Salmonella ); characterized in that, Primers and probes are as follows: PDCoV: the nucleotide sequence of the upstream primer is catatcctgtggcggatttc, the nucleotide sequence of the downstream primer is cagtcgttaagcatggcaag, and the nucleotides of the probe are cagtcgttaagcatggcaag; PEDV: the nucleotide sequence of the upstream primer is aaataaccagggtcgtggag, the nucleotide sequence of the downstream primer is tcttggactggttacgagac, and the nucleotides of the probe are cattattattgcctcctc; TGEV: the nucleotide sequence of the upstream primer is tgtgatggagtatgggtatc, the nucleotide sequence of the downstream primer is cattgtattgggattatgc, and the nucleotides of the probe are gggaacggttaaacgtagt; SADS-CoV: the nucleotide sequence of the upstream primer is ggcttactctaaacccagtc, the nucleotide sequence of the downstream primer is ttgggaaactggagtagctg, and the nucleotides of the probe are acactggggcatcagcattt; HEV: the nucleotide sequence of the upstream primer is tggttggatgaatataggg, the nucleotide sequence of the downstream primer is agtgccggcggtggtttctg, and the nucleotides of the probe are gtggtttctggggtgac; PoRV: the nucleotide sequence of the upstream primer is gtcaatcagactctacaag, the nucleotide sequence of the downstream primer is ggtcacatcctctcacta, and the nucleotides of the probe are cccagttactctacgtagcg; PBoV-G1: the nucleotide sequence of the upstream primer is gtgtttggttgtttgtccc, the nucleotide sequence of the downstream primer is gacacagtatggcaataccc, and the nucleotides of the probe are gggacccaatgcaagcatgga; PBoV-G2: the nucleotide sequence of the upstream primer is aaaagccacgctcatgcag, the nucleotide sequence of the downstream primer is ggtaacgccaaacgtgtttc, and the nucleotide sequence of the probe is tgtttcccatcggta; PBoV-G3: the nucleotide sequence of the upstream primer is cccaacagttttcctctagc, the nucleotide sequence of the downstream primer is agtagtgtgaggcaggtaac, and the nucleotides of the probe are ccacaaggtccttgagcg; Salmonella : The nucleotide sequence of the upstream primer is taggaacgaccccataaacac, the nucleotide sequence of the downstream primer is tccattacctacctatctgg, and the nucleotide sequence of the probe is acctatctggttgatt.

2. The primer and probe set according to claim 1, characterized in that: The primer and probe set also includes a primer and probe set for detecting pig RPL4 gene as an internal control, the nucleotide sequence of the upstream primer of the internal control is tttggatctctgggcttttc, the nucleotide sequence of the downstream primer is ctgctaccctcaagagtaac, and the nucleotide sequence of the probe is agatgctcaatacagaccttagc.

3. The primer and probe set according to claim 1 or 2, characterized in that: A 10-base tag acggtggatg was appended to the 5' end of each PCR primer.

4. Use of the primer and probe set according to any one of claims 1 to 3 in preparing reagents for multiplex detection of swine diarrhea pathogens using a MALDI-TOF NAMS method.

5. A kit comprising the primer and probe set according to any one of claims 1 to 3.

6. The kit according to claim 5, characterized in that The kit also includes standard plasmids, which are described below: 。 7. The kit according to claim 5, characterized in that The kit contains 2 μL of recombinant plasmid 10 4 copies / μL, 2.5 μL 2× HU MP buffer, 0.3 μL enzyme mix, 0.2 μL of each target-specific PCR primer, shrimp alkaline phosphatase SAP, reaction buffer, 1 μL probe mix, 0.04 μL Inplex enzyme, 0.2 μL terminator mix with ddNTPs, 0.2 μL Inplex buffer, and 0.56 μL ddH2O.

8. The kit according to claim 7, characterized in that The PCR thermal cycling conditions of the kit were as follows: reverse transcription at 50°C for 10 min, initial denaturation at 95°C for 5 min, and then 45 cycles of 95°C for 15 s, 60°C for 30 s, and finally 72°C for 5 min; after amplification, shrimp alkaline phosphatase SAP and reaction buffer were added to 2 μL of PCR product for dNTP dephosphorylation; the mixture was incubated at 37°C for 40 min and then inactivated at 85°C for 5 min.

9. The kit according to claim 8, characterized in that In the extension reaction, the dephosphorylated product was mixed with 1 μL UEP mixture, 0.04 μL Inplex enzyme, 0.2 μL termination mixture containing ddNTPs, 0.2 μL Inplex buffer, and 0.56 μL ddH2O; the extension schedule included 40 cycles at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 52°C for 5 s, 80°C for 5 s, and 72°C for 3 s.

10. Use of the primer and probe set according to any one of claims 1 to 3 or the kit according to any one of claims 5 to 9 for multiplex detection of porcine diarrhea pathogens in non-disease diagnosis based on MALDI-TOF NAMS, wherein the porcine diarrhea pathogens are porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV) and Salmonella ( Salmonella ).

Images