Citrus huanglongbing resistant protein CsALD1-1 and method for improving resistance of citrus plants to citrus huanglongbing

Abstract

The invention discloses a Citrus Huanglongbing resistant protein CsALD1-1 and a method for improving the resistance of citrus plants to Citrus Huanglongbing. The amino acid sequence of the CsALD1-1 protein is as shown in SEQ ID NO: 1, and the nucleotide sequence of the CsALD1-1 gene is as shown in SEQ ID NO: 1. According to the method for improving the resistance of citrus plants to citrus huanglongbing, ALD1 gene is utilized to encode lysine transaminase protein to promote the content of NHP in citrus, so that the whole-body immunity of citrus is activated, and the resistance to huanglongbing is enhanced. The CsALD1-1 overexpressed transgenic plant obtained by the invention has the advantages that the content of CLas is obviously lower than that of a wild type plant, and the attack degree of the citrus huanglongbing can be effectively and obviously reduced, so that the resistance of the citrus to the citrus huanglongbing is obviously improved, the phenotype of the transgenic plant is not influenced, and the CsALD1-1 overexpressed transgenic plant has a great application value for the citrus huanglongbing-resistant breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to a protein CsALD1-1 against Huanglongbing of citrus, and a method for improving the resistance of citrus plants to Huanglongbing of citrus. Background Art

[0002] Huanglongbing (HLB), also known as citrus greening disease, is caused by Candidatus Liberibacter in the phloem of citrus, and is the most destructive and devastating disease of citrus. Among them, Candidatus Liberibacter asiaticus (CLas) is the main pathogenic bacterium that harms the global citrus industry. In the field, it is mainly transmitted between plants by the citrus psyllid (Diaphorina citri), and under artificial conditions, it can be transmitted through grafting of diseased scions and transportation of diseased seedlings. CLas can infect the vast majority of citrus varieties, including sweet oranges, mandarins, lemons, and grapefruits, often resulting in symptoms such as yellowing of shoots, mottled leaves, raised leaf veins, premature fruit drop, and root rot. The profitable lifespan and yield of diseased citrus are significantly shortened. Seriously, the citrus yield can be reduced by more than 50%, and even the tree can die. At present, there is no effective treatment measure in the citrus industry, and mainly adopts the "three-pronged" prevention and control measures based on planting virus-free seedlings, chemically killing psyllids, and removing diseased trees.

[0003] Plants have basal disease resistance (i.e., innate immunity) and specific disease resistance controlled by disease resistance genes, which are respectively directed against the vast majority of microorganisms and specific pathogen species in the growth environment. At the same time, plants have also evolved a set of disease resistance mechanisms for induced immunity. This induced immunity is mainly to activate and regulate the plant's intrinsic immune response after treatment with external factors to resist the invasion and harm of pathogens. At present, the induced immunity that has been studied more thoroughly is systemic acquired resistance (SAR) and induced systemic resistance (ISR). SAR refers to that after a plant is locally stimulated by a pathogen or a chemical substance, its basal resistance is enhanced, and it can trigger a defense response to pathogen invasion earlier and faster. SAR involves the generation of mobile signals in the leaves of the primary infection. When transferred to distal tissues, the defense response is activated, thereby generating disease resistance. This signal is graft-transmissible and moves throughout the plant. ISR refers to the systemic resistance of the whole plant induced by the colonization of some non-pathogenic rhizosphere bacteria on the roots of plants. Compared with the disease resistance mediated by disease resistance genes, plant induced immunity has broad-spectrum, delayed, persistent, stable, and safe characteristics.

[0004] Huanglongbing (HLB) is a systemic disease that cannot be eradicated by conventional control methods such as pruning diseased branches and foliar spraying of pesticides. Currently, multiple studies have demonstrated that modulating systemic acquired resistance (SAR) in citrus is effective against pathogens with phloem-parasitic characteristics such as HLB. Studies by Aritua et al. and Li et al. have shown that CLas infection in citrus suppresses systemic acquired resistance, thereby promoting the colonization of CLas in the phloem. The HLB-tolerant pummelo shows a strong systemic acquired resistance response to CLas infection. According to Zou et al., the regulatory PR genes downstream in the SAR pathway all respond positively to Huanglongbing bacterium infection and show significant differences among different tolerance varieties. NPR1, as a key regulatory gene activating systemic acquired resistance, overexpression of AtNPR1 and CsNPR1 in citrus can enhance the resistance of citrus to HLB, further confirming that the SAR pathway is an important targeted pathway for Huanglongbing bacterium.

[0005] Similar to SA / MeSA, Pipecolic Acid (Pip) / N-Pipecolic Acid (NHP) has been newly discovered as a signal molecule in the past five years. It belongs to non-protein amino acids, and its role in the SAR signal has been continuously revealed and has become an accepted mobile signal for SAR. The precursor of Pip, L-lysine, is catalyzed by Agd2-Like Defense Response Protein 1 (ALD1) to become Δ1-piperidine-2-carboxylic acid (P2C), and P2C is further catalyzed by SAR-Deficient 4 (SARD4) to become L-Pip. Subsequently, through Flavin-Dependent Monooxygenase 1 (FMO1), it is hydroxylated to form NHP. During the activation of SAR, the amino acid derivative N-hydroxy pipecolic acid (NHP) derived from L-lysine and its biosynthetic precursor pipecolic acid (Pip) are synthesized in the leaves inoculated with pathogens, and NHP and SA coordinate the establishment of SAR by accumulating in systemic leaves. It has been found that the content of Pip in ald1 mutants is not induced by pathogens at all, so ald1 mutants show weakened basal resistance and SAR. Thus, it can be seen the important role of ALD1 in plant SAR resistance. However, currently, there is no research and application on regulating the resistance of citrus to Huanglongbing using the NHP biosynthetic protein ALD1.

[0006] In view of this, the present application is specifically proposed. Summary of the Invention

[0007] The present invention provides an NHP biosynthesis protein CsALD1-1 resistant to citrus huanglongbing to improve the resistance of citrus to citrus huanglongbing, and provides a method for improving the resistance of citrus plants to citrus huanglongbing. By integrating the overexpression vector of the CsALD1-1 gene of citrus into the hairy roots of citrus through Agrobacterium rhizogenes, the expression level of CsALD1-1 in the hairy roots of citrus is up-regulated or down-regulated, which can significantly change the resistance of citrus to citrus huanglongbing, and the typical symptoms appear later, having great application value in the breeding of citrus resistant to citrus huanglongbing, and can be used as a candidate gene for resistance breeding of citrus huanglongbing with multiple resistant and susceptible genes.

[0008] The present invention adopts the following technical solutions:

[0009] The first object of the present invention is to provide a protein CsALD1-1 resistant to citrus huanglongbing, and the amino acid sequence of the CsALD1-1 protein is shown in SEQ ID NO: 1.

[0010] The CsALD1-1 protein of the present invention participates in the key enzymatic reaction in the NHP biosynthesis pathway, that is, ALD1, as the enzyme for the first step of lysine catabolism, directly catalyzes the transfer of the α-amino group of L-lysine to an oxaloacetic acid, preferentially forming pyruvate, followed by ε-amino-α-ketocaproic acid (KAC) and alanine. Through the spontaneous intramolecular cyclization and dehydration of the KAC intermediate, dehydropipecolic acid (DP) and ketoimine 1,2-DP are formed, and then isomerized to the more stable enamine tautomer 2,3-DP. By regulating the expression level of the CsALD1-1 protein in citrus plants, the resistance of citrus plants to citrus huanglongbing is improved.

[0011] The second object of the present invention is to provide a nucleotide sequence encoding the above-mentioned CsALD1-1 protein resistant to citrus huanglongbing, as shown in SEQ ID NO: 2, that is, the CsALD1-1 gene.

[0012] The third object of the present invention is to provide a method for improving the resistance of citrus plants to citrus huanglongbing. Using the ALD1 gene to encode a lysine transaminase protein to promote the content of NHP in citrus, thereby activating the systemic immunity of citrus and enhancing the resistance to citrus huanglongbing;

[0013] The ALD1 gene is the CsALD1-1 gene encoding the above-mentioned CsALD1-1 protein.

[0014] Preferably, up-regulating the expression level of the CsALD1-1 protein activates the related signal pathways of systemic acquired resistance.

[0015] In the present invention, the method for regulating the NHP level in citrus plants is to overexpress the CsALD1-1 gene in citrus cells to control the accumulation of NHP content in citrus.

[0016] Preferably, Agrobacterium rhizogenes-mediated transformation is used to transform citrus to increase the expression level of CsALD1-1 protein in citrus roots, thereby increasing the NHP content in citrus plants.

[0017] Preferably, it includes the following steps:

[0018] (1) Clone the coding sequence of the citrus CsALD1-1 gene;

[0019] (2) Construct an overexpression vector;

[0020] (3) The overexpression vector is transformed into citrus branches mediated by Agrobacterium rhizogenes to obtain transgenic plants.

[0021] Preferably, in step (1), the method for cloning the coding sequence of the citrus CsALD1-1 gene is: extract the total RNA of citrus, then reverse transcribe it into cDNA, and finally use high-fidelity enzyme PCR to amplify the DNA fragment of the coding sequence of the CsALD1-1 gene;

[0022] The PCR primers used for cloning the coding sequence of the citrus CsALD1-1 gene are OE-F and OE-R, and their nucleotide sequences are shown in SEQ ID No: 3 and SEQ ID No: 4 respectively.

[0023] Preferably, in step (2), the method for constructing the overexpression vector is: using pNmGFPer as the vector, the pNmGFPer vector carries the CaMV 35S promoter, the CaMV 35S promoter is the cauliflower mosaic virus promoter, and has the nucleotide sequence shown in SEQ ID NO: 5. After digesting the target fragment with SalⅠ and BamHⅠ, it is ligated to the vector recovered by digesting with SalⅠ and BamHⅠ to construct the overexpression vector pNmGFPer-CsALD1-1.

[0024] Preferably, in step (3), the method for transforming citrus with the overexpression vector is: the overexpression vector is transformed into Agrobacterium rhizogenes by heat shock method, and then Agrobacterium rhizogenes is used to mediate the transformation of citrus explants. The transgenic plants are obtained after the genetically transformed explants are cultured in vermiculite and identified by GFP fluorescence.

[0025] Preferably, it also includes verifying the transgenic plants by PCR and detecting the expression level of the CsALD1-1 gene by real-time fluorescence quantitative PCR.

[0026] When verifying transgenic plants by PCR, the primers used are ID-F and ID-R. ID-F is a sequence of CaMV 35S taken from the pNmGFPer vector, and ID-R is designed according to the CsALD1-1 gene sequence. The primers are nucleotide sequences shown in SEQ ID No: 6 and SEQ ID No: 7 respectively.

[0027] When detecting gene expression levels by real-time fluorescence quantitative PCR, the primers used are RT-F and RT-R, and their nucleotide sequences are shown in SEQ ID No: 8 and SEQ ID No: 9 respectively. The internal reference for real-time fluorescence quantitative PCR is the citrus CsGAPDH gene, and the primers used are GA-F and GA-R, and their nucleotide sequences are shown in SEQ ID No: 10 and SEQ ID No: 11 respectively.

[0028] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0029] 1. An NHP biosynthetic protein CsALD1-1 resistant to citrus huanglongbing and a method for improving the resistance of citrus plants to citrus huanglongbing provided by the embodiments of the present invention. By cloning the coding sequence of the citrus CsALD1-1 gene, constructing an overexpression vector, and then transforming citrus, the content of CLas in the CsALD1-1 overexpression transgenic plants obtained is significantly lower than that of the wild type, and it can effectively and significantly reduce the incidence of huanglongbing.

[0030] 2. By integrating the overexpression vector of the citrus ALD1-1 gene into citrus, the present invention can significantly improve the resistance of citrus to huanglongbing without affecting the phenotype of transgenic plants.

[0031] 3. By overexpressing the CsALD1-1 gene, the present invention can greatly improve the resistance of transgenic plants to huanglongbing, which has great application value for the breeding of citrus resistant to huanglongbing, and can be used as a candidate gene for huanglongbing resistance breeding with multiple huanglongbing-resistant and -susceptible genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the drawings required for the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, other related drawings can also be obtained based on these drawings without creative efforts. In the drawings:

[0033] Figure 1Domain alignment analysis diagram of citrus CsALD1-1 in Example 1 of the present invention: The red box represents "pyridoxal 5'-phosphate binding site" and "polypeptide binding site".

[0034] Figure 2 Diagram of differential expression analysis of citrus CsALD1-1 gene in different tolerant varieties in response to Huanglongbing in Example 2 of the present invention; The asterisks on the data bars indicate significant differences (*, P<0.05; **, P<0.01); Leaf represents leaf, Stem represents stem, Root represents root. WJC represents Jincheng orange, MFG represents Mahonggan, and Clas-WJC represents Jincheng orange with Huanglongbing.

[0035] Figure 3 Diagram for identifying positive plants in Example 3 of the present invention:

[0036] Figure A is the flow chart for constructing the pNmGFPer-CsALD1-1 vector: CaMV 35S, a plant constitutive promoter derived from cauliflower mosaic virus; NOS, the terminator of the nopaline synthase gene;

[0037] Figure B is the PCR detection diagram of transgenic plants: where P represents the pNmGFPer-CsALD1-1 vector plasmid; WT represents the wild-type control; OE-5, OE-7, and OE-8 respectively represent three transgenic plants;

[0038] Figure C is the qRT-PCR detection diagram of transgenic plants.

[0039] Figure D shows the content changes of NHP and Pip compared with the control. *, indicates significant difference compared with the wild type (P = 0.05), the same below.

[0040] Figure 4 Diagram for evaluating the resistance of CsALD1-1 overexpressing transgenic citrus to Huanglongbing in the embodiment of the present invention. Detailed implementation manners

[0041] To make the objectives, technical solutions, and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with the embodiments. The illustrative embodiments of the present invention and their descriptions are only used to explain the present invention and are not intended to limit the present invention.

[0042] Example 1: Bioinformatics analysis of citrus CsALD1-1

[0043] Bioinformatics analysis shows that the CDS length of CsALD1-1 is 1,386 bp and it consists of 462 amino acids.Figure 1 The protein sequence alignment analysis shown below indicates that CsALD1-1 contains the domain modules of "pyridoxal 5'-phosphate binding site" and "polypeptide binding site", and these modules are conserved in both Citrus hystrix DC. and Citrus sinensis Osbeck.

[0044] The amino acid sequence of the CsALD1-1 protein is shown in SEQ ID NO.1:

[0045] MSSRSVPLALLLQPKQTWLSVTVSFIPSYLKYLSISVYVYWVAYSSKSNNGSKLGHSTEVPRNVNMESLQSGYLFPEISMRESEHIRKHPDARLIRLGIGDTTQPIPDIITSAMAEHAFALSTVKGYKGYGAEQGNMALRTAIADKFYKDMGIEGDEIFISDGAQSDISRLQMLLGSNVTVAVQDPSFPAYIDTSVIVGQAGKFLKETGKYRNIVYMNCRPENNFFPDLSTTSRTDIIFFCSPNNPTGHAATWQQLKKLVEFAKANGSIIVYDSAYAAYITDPSPRSIYEIPGAREVAIEISSFSKFAGFTGVRLGWTVVPEELRYSNGYPVIKDFNRIVCTCFNGASNIVQAGGLACLSPDGFQALRTVIDYYKENAKIIVDAFQSLGLKVNGGKNAPYVWVQFPGSSSWDVFAEILEKTHILTIPGSGFGPGGNEHIRVSAFGHREYISEACRRLKNFL.

[0046] The nucleotide sequence of the CsALD1-1 gene is shown in SEQ ID NO.2:

[0047]

[0048] Example 2: Expression analysis of citrus CsALD1-1

[0049] 1. Expression analysis of the CsALD1-1 gene in citrus varieties with different resistance to Huanglongbing

[0050] Compared with Jincheng, Mafenggan is more resistant to Huanglongbing. The CLas content in Mafenggan was significantly lower than that in Jincheng after 4 months of infection. Therefore, this experiment further used RT-qPCR to compare and analyze the expression characteristics of CsALD1-1 in Jincheng and Mafenggan after 6 months of infection. Figure 2 From the differential expression analysis of the citrus CsALD1-1 gene in response to different resistant varieties of Huanglongbing, it can be seen that the CsALD1-1 gene was significantly upregulated in the roots of both varieties and downregulated in the leaves, suggesting that CsALD1-1 is closely related to citrus Huanglongbing resistance.

[0051] Example 3: Genetic transformation of late orange using citrus OE-CsALD1-1 gene to improve citrus Huanglongbing resistance

[0052] 1. Cloning of Citrus CsALD1-1 Gene

[0053] RNA was extracted from Late Jin Orange using an RNA extraction kit (Adlai, CAT: RN09). cDNA was synthesized using Recombinant DNaseI (TAKARA). Primers OE-F (SEQ ID No: 3) and OE-R (SEQ ID No: 4) were used to amplify the CsALD1-1 fragment from citrus cDNA. The length of the fragment was 1,386 bp, and the sequence was shown in SEQ ID NO: 2. The amplified DNA fragment was sequenced and analyzed to be the coding sequence of the citrus CsALD1-1 gene.

[0054] The nucleotide sequence of primer OE-F is SEQ ID No: 3:

[0055] GGTACCATGTCATCACGCAGTGTACCACTT.

[0056] The nucleotide sequence of primer OE-R is SEQ ID No: 4:

[0057] GTCGACCTACAAAAAATTTTTAAGCCGTCTACA.

[0058] Amplification system: 10X PCR mix: 2.5 μL; Primer OE-F (5 μmol / L): 1 μL; Primer OE-R (5 μmol / L): 1 μL; cDNA about 60 ng; add ddH2O to 25 μL.

[0059] Amplification program: 94°C for 5 min; 94°C for 30 s, 56°C for 30 s, 72°C for 1.5 min, 35 cycles; extension at 72°C for 10 min.

[0060] DNA fragment recovery: Under ultraviolet light, cut out the agarose gel block containing the target fragment with a clean blade. Use a kit (Aidlab) to recover the fragment.

[0061] 2. Construction of the CsALD1-1 overexpression vector and transformation of Agrobacterium rhizogenes

[0062] The vector structure is as Figure 3 shown in A. All restriction endonucleases were purchased from (THERMO) company and operated according to the instructions.

[0063] The specific operation is as follows: The CsALD1-1 gene fragment and the overexpression vector pNmGFPer were double-digested with restriction endonucleases SalⅠ and BamHⅠ and then recovered for ligation. The pNmGFPer vector carries the CaMV 35S promoter, and the CaMV 35S promoter is a cauliflower mosaic virus promoter with the nucleotide sequence shown in SEQ ID NO: 5. Ligation was performed using the T4 DNA Ligase kit (TAKARA). The ligation product was transformed into Escherichia coli DH5α, and the positive clone was used to extract the plasmid to obtain the CsALD1-1 overexpression vector pNmGFPer-CsALD1-1. Plasmid extraction was performed using a kit (Aidlab).

[0064] SEQ ID NO: 5:

[0065] TGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCGTAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCACGACACGCTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGTAATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAG。

[0066] Take the K599 Agrobacterium competent cells stored in an -80°C refrigerator and insert them into ice until completely melted. Take 1 μL of the plasmid and add it to the bottom of 100 μL of K599 competent cells, and gently stir to mix evenly. Incubate on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min in sequence. Add 500 μL of LB liquid medium, and shake at 220 rpm in a 28°C constant temperature shaker for 2 h - 3 h. Centrifuge the resuscitated bacterial solution at 5000 g for 1 min, discard the supernatant, leave 100 μL of the resuspended bacterial solution, pipette and mix evenly, and spread it on the LK plate. Incubate it upside down at 28°C for 2 d. Pick the bacterial colonies and culture them by shaking in the LK liquid medium. Screen the positive clones and store them at -80°C for later use.

[0067] 3. Genetic transformation of citrus (Jincheng orange)

[0068] (1) Preparation and resuspension of bacterial solution: Melt the Agrobacterium rhizogenes K599 stored at -80°C and streak it on an LB plate with a coating stick. After inverting and culturing at 28°C for 2 days, pick up 4-6 single colonies with a pipette tip, add 50 ml of LB liquid, and shake and culture overnight on a shaker at 220 r / min and 28°C. Measure the OD600 value of the bacterial solution with a UV spectrophotometer. When the OD600 value is 0.8, place the bacterial solution in a centrifuge tube and centrifuge it at 5000 r / min for 10 minutes. Discard the supernatant, collect the bacteria, and add an equal volume of MS solution to the supernatant to resuspend them.

[0069] (2) Collect diseased citrus branches from the greenhouse, wash them with clean water, and cut them into stem segments about 5 cm long with one or more nodules. Put a large amount of vermiculite in the culture pot, add an appropriate amount of tap water, mix well, and keep the humidity moderate.

[0070] (3) Vacuum infiltration transformation: immerse the cut part of the branch in the resuspended liquid and vacuum infiltrate for 30 minutes.

[0071] (4) Insert the infected branches into moist vermiculite and place them vertically, with the stem segments inserted into the vermiculite and the leaves exposed to the air. Place them in a constant temperature incubator at 26°C, 16h / d to induce rooting. After one month, most plants will grow roots of 5-10cm.

[0072] Example 4: Identification of OE-CsALD1-1 transgenic plants

[0073] 1. Identification of OE-CsALD1-1 transgenic plants

[0074] (1) GFP green fluorescence identification of transgenic plants

[0075] Use LUYOR portable excitation light source, wear LUV-30A yellow glasses for observation, and choose blue light to irradiate the roots of the plants. Positive plants will appear green, and the roots of negative plants will appear yellow.

[0076] (2) PCR detection of exogenous gene integration

[0077] 100 mg of plant leaves obtained from the initial screening were used to extract genomic DNA using a DNA extraction kit (Adlai, CAT: DN15), and PCR was used to detect the integration of the CsALD1-1 gene in the citrus genome. PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min. The detection primers were ID-F (SEQ ID No: 6) and ID-R (SEQ ID No: 7). The PCR results are shown in Figure 2. Figure 3 As shown in B, the positive plants have amplified fragments, while the WT plants have no amplification.

[0078] The nucleotide sequence of primer ID-F, SEQ ID No: 6:

[0079] CTTAGTAGTTGGTAACCTGA.

[0080] The nucleotide sequence of primer ID-R, SEQ ID No: 7:

[0081] AGCCGTATCAACCTTGCATCT.

[0082] (3) Analysis of CsALD1-1 gene expression

[0083] Total RNA of citrus leaves was extracted (Aidlab, CAT No: RN09), and cDNA was synthesized using Recombinant DNase I. The expression level of the target gene was detected by qRT-PCR, and the detection primers were RT-F (SEQ ID No: 8) and RT-R (SEQ ID No: 9); the detection primers for the internal reference gene GAPDH were RT-F (SEQ ID No: 10) and RT-R (SEQ ID No: 11).

[0084] The nucleotide sequence of primer RT-F, SEQ ID NO: 8:

[0085] ACTTGGCTCAGCGTTACTGT.

[0086] The nucleotide sequence of primer RT-R, SEQ ID NO: 9:

[0087] CCGCGGTACTTCTGTGGAAT.

[0088] The nucleotide sequence of primer RT-F, SEQ ID NO: 10:

[0089] GCTTTCCGTGTACCCACTGT.

[0090] The nucleotide sequence of primer RT-R, SEQ ID NO: 11:

[0091] CTCTGACTCCGCCTTGATGG.

[0092] The reaction volume was 20 μL, and the reaction conditions were: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min. The experiment was repeated three times.

[0093] Using 2 -△△CtMethod for calculating the relative expression level of the CsALD1-1 gene in transgenic plants: Define the sample treated with water as the reference factor, that is, the expression level of CsALD1-1 in it is 1, and then calculate the multiple of the gene expression in transgenic citrus relative to the reference factor gene expression 2 -△△Ct , which is its relative expression level. The detection results are as Figure 3 shown in C, and the control content change is as Figure 3 shown in D. EV represents wild-type plants, and OE-5, OE-7, and OE-8 represent transgenic plants. The results show that the CsALD1-1 gene has a high-level expression in transgenic plants compared to wild-type plants.

[0094] 4. Detection of NHP and Pip contents in transgenic plants

[0095] After chopping 100 mg of citrus tissue, it was quickly frozen in liquid nitrogen, and then ground in a tissue grinder at 50 Hz for 2 minutes. The ground tissue was resuspended in 500 mL of 80% MeOH:H2O (v / v), shaken and mixed at 4°C for 12 h, then centrifuged at 13,000 rpm for 10 minutes. After collecting the supernatant with a 1 mL syringe, it was filtered through a 0.22 μm polyvinylidene fluoride filter membrane, and the UPLC-MS / MS was used to detect the changes in NHP and Pip contents in transgenic plants. The detection results are as Figure 3 shown in D. The results show that in CALD1-1 transgenic plants, the NHP content is significantly increased in both leaves and roots compared to the empty vector control group, and the Pip content is significantly increased in roots.

[0096] Example 5: Evaluation of the Huanglongbing resistance of OE-CsALD1-1 transgenic plants

[0097] 1. Evaluation of the Huanglongbing resistance of OE-CsALD1-1 transgenic plants

[0098] Extract the vein DNA, design primers O11 / O12C for conventional PCR (see Tables 1 and 2) to detect the Huanglongbing virus source. The determined virus source was used to graft and transmit the virus to the obtained transgenic plants by the leaf disc grafting method. The specific grafting method refers to Xie et al. (Comparative Analysis of Wanjincheng Orange Leaf And Root Responses to 'Candidatus Liberibacter asiaticus' Infection Using Leaf-Disc Grafting; Xie Z, Zhao K, Long J, Chen SJ Yuanying; 2021).

[0099] The inoculated materials were cultured in an improved central light incubator, watered, and the symptom changes were regularly observed and recorded. The pathogen content of Huanglongbing in transgenic plants was detected by quantitative PCR (qPCR)-probe method. At 40, 60, and 80 days after CLas inoculation, 3 inoculated leaves (including transgenic plants and wild-type plants) were picked, DNA was extracted, the DNA concentration and quality were detected, and quantified to 10 ng / μL. The CLas content was detected by qPCR.

[0100] Table 1 qPCR reaction system

[0101]

[0102]

[0103] Table 2 qPCR reaction program

[0104]

[0105] Symptom observation As shown in the evaluation diagram of Huanglongbing resistance of CsALD1-1 overexpressing transgenic citrus in Figure 4 There were obvious phenotypic differences between transgenic plants and wild-type plants. To determine the response of transgenic plants to CLas infection, the vein DNA of transgenic plants and wild-type plants was extracted at 40d, 60d, and 80d after graft inoculation, and the growth of CLas in the veins was detected by qPCR. Compared with the wild-type control, the growth of CLas in transgenic plants was slow. At 80d, although the pathogen content in the roots increased, it was still significantly lower than that of the wild-type. Symptom observation found that after 80d of virus transmission, the wild-type control showed symptoms such as severe leaf yellowing and vein bulging, while only slight yellowing appeared at the leaf tip in transgenic plants.

[0106] It can be seen that overexpression of CsALD1-1 can enhance the resistance to Huanglongbing in citrus.

[0107] In the present invention, the media used for Agrobacterium rhizogenes transformation are as follows:

[0108] LB medium: 5 g / L yeast extract + 10 g / L peptone + 10 g / L NaCl, PH 5.8.

[0109] MS infection solution: 4.43 g / L MS, PH 5.4.

[0110] The specific embodiments described above further elaborate on the object, technical solution and beneficial effects of the present invention. It should be understood that the above description is only the specific embodiments of the present invention and is not used to limit the protection scope of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A protein CsALD1-1 for resisting citrus Huanglongbing, characterized in that: The amino acid sequence of CsALD1-1 protein is shown in SEQ ID NO:

1.

2. A nucleotide sequence encoding the CsALD1-1 protein against citrus Huanglongbing as claimed in claim 1 is shown in SEQ ID NO:

2.

3. A method for improving the resistance of citrus plants to citrus Huanglongbing, characterized in that: The ALD1 gene encodes lysine aminotransferase protein to promote the NHP content of citrus, thereby activating the systemic immunity of citrus and enhancing resistance to Huanglongbing; The ALD1 gene is the CsALD1-1 gene encoding the CsALD1-1 protein according to claim 1.

4. The method for improving the resistance of citrus plants to citrus Huanglongbing according to claim 3, characterized in that: The expression level of the CsALD1-1 protein is upregulated, and the relevant signaling pathways for systemic acquired resistance are activated.

5. The method for improving the resistance of citrus plants to citrus Huanglongbing according to claim 3, characterized in that: Agrobacterium rhizogenes was used to mediate the transformation of citrus, thereby increasing the expression level of CsALD1-1 protein in citrus roots and thus increasing the NHP content in citrus plants.

6. The method for improving the resistance of citrus plants to citrus Huanglongbing according to claim 3, characterized in that: The following steps are involved: (1) Cloning the coding sequence of the citrus CsALD1-1 gene; (2) constructing an overexpression vector; (3) The overexpression vector was used to transform citrus branches through Agrobacterium rhizogenes to obtain transgenic plants.

7. The method for improving the resistance of citrus plants to citrus Huanglongbing according to claim 6, characterized in that: In step (1), the cloning method of the citrus CsALD1-1 gene coding sequence is: extracting citrus total RNA, then reverse transcribing it into cDNA, and finally amplifying the CsALD1-1 gene coding sequence DNA fragment using high-fidelity enzyme PCR; The PCR primers used to clone the coding sequence of the citrus CsALD1-1 gene were OE-F and OE-R, and their nucleotide sequences were shown in SEQ ID No: 3 and SEQ ID No: 4, respectively.

8. The method for improving the resistance of citrus plants to citrus Huanglongbing according to claim 6, characterized in that: In step (2), the overexpression vector construction method is: using pNmGFPer as a vector, the pNmGFPer vector carries a CaMV 35S promoter, the CaMV 35S promoter is a cauliflower mosaic virus promoter, and has a nucleotide sequence shown in SEQ ID NO: 5, and the target fragment is cut with SalⅠ and BamHI and then connected to the vector recovered by SalⅠ and BamHI to construct the overexpression vector pNmGFPer-CsALD1-1.

9. The method for improving the resistance of citrus plants to citrus Huanglongbing according to claim 6, characterized in that: In step (3), the method for transforming citrus with the overexpression vector is as follows: the overexpression vector is transformed into Agrobacterium rhizogenes by heat shock method, and then the citrus explants are transformed by Agrobacterium rhizogenes. The explants after genetic transformation are cultured with vermiculite and identified by GFP fluorescence to obtain transgenic plants.

10. The method for improving the resistance of citrus plants to citrus Huanglongbing according to claim 6, characterized in that: It also includes verifying transgenic plants through PCR and detecting the expression level of CsALD1-1 gene using real-time fluorescence quantitative PCR.

Images