CmACS11 gene promoter structure variation SV352 and application thereof in regulation and control of female development of muskmelon

Abstract

The invention discloses a muskmelon CmACS11 gene promoter structure variation SV352 and application thereof in regulation and control of female development of muskmelons, and relates to the technical field of biology. It is found for the first time that insertion of 352bp exists on the CmACS11 promoter, the CmACS11 promoter is named as SV352, the nucleotide sequence of the CmACS11 promoter is shown as SEQ ID No: 3, and the CmACS11 promoter is closely linked with female complete development characters of muskmelons and has dominant inheritance. Furthermore, through in-situ hybridization and transgenosis verification, the SV352 causes the loss of selective expression characteristics of the CmACS11, so that the CmACS11 is expressed in all flower buds, and the expression is advanced, which is a key variation for controlling complete development of female organs of muskmelons. The SV352 variation provides a new variation resource for creating a muskmelon female line breeding material.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a CmACS11 gene promoter structural variation SV_352 and its application in regulating female development of melons. Background Art

[0002] Melons (Cucumis melo L.) are annual vine herbaceous crops of the Cucurbitaceae family, widely cultivated worldwide. China is the largest producer and consumer of melons, ranking first in the world in terms of cultivation area and output, with important industrial value. Currently, most commercially cultivated melon varieties are first-generation hybrids, and the seed production method is mainly emasculation at the bud stage. This method is time-consuming and laborious, and the seed purity cannot be guaranteed due to incomplete emasculation. Therefore, the creation and utilization of melon female lines are urgent.

[0003] Flowers are important reproductive organs of flowering plants, with three physiological types: male flowers, female flowers, and bisexual flowers. Different types of flowers combine to form different sexual types of plants. Melons have a rich sexual type system, such as monoecious lines, andromonoecious lines, gynoecious lines, dioecious lines, and hermaphrodite lines, etc., and are model crops for studying sex determination. In production cultivation, andromonoecious lines (all axils of main branches are male flowers, the first 1-3 nodes of lateral branches are bisexual flowers, and subsequent nodes are male flowers) are dominant, followed by monoecious lines (all axils of main branches are male flowers, the first 1-3 nodes of lateral branches are female flowers, and subsequent nodes are male flowers), and the other sexual types are relatively rare. The flower development process of melons is the same as that of cucumbers, divided into 12 stages. In the first 5 stages, floral bud primordia, sepal primordia, petal primordia, stamen primordia, and carpel primordia are differentiated respectively, which is the bisexual flower stage; subsequently, the development of stamen primordia and carpel primordia is inhibited respectively, and they develop into female flowers and male flowers respectively; if the development of both is not inhibited, they develop into bisexual flowers.

[0004] The regulatory network of melon sex determination is complex and involves the regulation of multiple genes. The cultivation of female lines is of great significance for the cross-breeding and production of melons. Among them, CmACS11 is located at the uppermost reaches of the regulatory network and is a key rate-limiting enzyme for ethylene synthesis. It regulates the expression of the female development inhibitory gene CmWIP1 through its selective expression characteristics, and further precisely determines the female sex fate of flowers and plants.

[0005] Currently, the discovered natural variations in the function of CmACS11 are located in its protein coding region, and the research on its promoter selective expression characteristics is very limited. Therefore, aiming at the cumbersome breeding problem of melon seed production methods, strengthening the research on melon sex regulation genes and exploring the key variations of melon female development genes can provide a theoretical basis and practical guidance for creating melon female lines. Summary of the Invention

[0006] The present invention constructs F1 and F2 genetic populations using a hermaphroditic melon material mp_ol and a male-flower hermaphroditic melon material 13C. Genetic analysis reveals that the female control factor in mp_ol is dominantly inherited, and further map-based cloning identifies the gene CmACS11 that controls female development in melons. Through population haplotype analysis, the inventors found that there is a 352-bp insertion (named SV_352) in the promoter of CmACS11 that is tightly linked to the trait of complete female development in melons. The inventors further verified through in situ hybridization and transgenic experiments that SV_352 leads to the loss of the selective expression characteristics of CmACS11, causing it to be expressed in all flower buds and with earlier expression, which is the key variation controlling the complete development of female organs in melons.

[0007] Based on this, the present invention provides the following technical solutions:

[0008] In the first aspect, the present invention provides a DNA molecule, the nucleotide sequence of which is as shown in SEQ ID No.3.

[0009] In the second aspect, the present invention provides a promoter containing the above-mentioned DNA molecule.

[0010] The promoter provided by the present invention is the promoter of the important gene CmACS11 that regulates female development in melons, and the gene ID of CmACS11 is MELO3C010779.

[0011] Specifically, the present invention provides a structural variation SV_352 that is closely related to the complete development of female organs in melons. The structural variation is an insertion structural variation at position 28,521,091 on chromosome 3 of melons, named SV_352. SEQ ID No.1 is the promoter sequence (3255 bp) of CmACS11 in mp_ol, which contains the inserted 352-bp sequence, and the nucleotide sequence is as shown in SEQ ID No.3; SEQ ID No.2 is the promoter sequence (2903 bp) of CmACS11 in 13C.

[0012] In the third aspect, the present invention provides the application of the above-mentioned DNA molecule or the above-mentioned promoter in enhancing the expression and / or advancing the expression of the CmACS11 gene in melons.

[0013] In the fourth aspect, the present invention provides a primer pair for amplifying the above-mentioned promoter, characterized in that the sequences of the primer pair are as shown in SEQ ID No.4-5.

[0014] In the fifth aspect, the present invention provides a recombinant vector, expression cassette, and transgenic recombinant bacterium containing the above-mentioned DNA molecule or the above-mentioned promoter.

[0015] Sixth aspect, the present invention provides the application of the DNA molecule described above, or the promoter described above, or the recombinant vector, expression cassette, transgenic recombinant bacterium described above in at least one of the following:

[0016] 1) Application in regulating female development of melons;

[0017] 2) Application in breeding female melons;

[0018] 3) Application in increasing the yield of melons.

[0019] The SV_352 variation affects the expression pattern of CmACS11, making CmACS11 expressed in each flower bud of melons and expressed in advance, thereby affecting the female development of melons.

[0020] The SV_352 variation is a natural variation related to the sex type of melons discovered from natural germplasm resources.

[0021] Seventh aspect, the present invention also provides a method for studying the expression characteristics of a promoter in melons, including using the Agrobacterium-mediated method to transfer the recombinant vector, expression cassette, transgenic recombinant bacterium described above into plants to obtain transgenic plants in which the GUS is expressed under the control of different forms of promoters of the target gene; wherein, the plant is a melon, and the target gene is the CmACS11 gene.

[0022] Eighth aspect, the present invention also provides a method for detecting whether a melon is fully developed female, which is determined by detecting whether the promoter of the CmACS11 gene of the melon contains the DNA molecule described above; if it contains, the melon is fully developed female.

[0023] That is, by detecting the SV variation type at position 28,521,091 on chromosome 3 of the melon, whether the genotype is SV_352 insertion or not, the corresponding sex-type melons are obtained. If inserted, it is fully developed female, if not, it is not fully developed female.

[0024] The beneficial effects of the present invention at least include:

[0025] The present invention uses a melon association population to locate a variation locus (SV_352, insertion position is 28,521,091) that controls the female development trait of melons, which can be used as a tightly linked variation. Using the variation provided by the present invention, female line parents and F1 hybrids of melons can be created, thereby saving the cost of manual emasculation and improving the seed purity and yield. Description of the Drawings

[0026] Figure 1 To identify the candidate interval for melon female development variation using the BSA method.

[0027] Figure 2To further identify the candidate intervals for melon female development variation using the KASP method.

[0028] Figure 3 This is an IGV analysis graph. There is a 352bp insertion at the CmACS11 promoter in mp_ol.

[0029] Figure 4 To identify that the SV_352 variation on the CmACS11 promoter is closely linked to melon female organ development using the population haplotype analysis method. Among them, A is the gene structure diagram of CmACS11, and S1-7 are the variations occurring at 7 positions; B is the 5 haplotype types; C is the distribution of the 5 haplotypes in different sexual types. Herma is the hermaphrodite line, Mono is the monoecious line, and Andro is the andromonoecious line.

[0030] Figure 5 To identify by DNA that the SV_352 variation on the CmACS11 promoter is closely linked to melon female organ development. Among them, A is the schematic diagram of the primer positions for identification; B is the gel diagram of the identification with JD-1s\JD-1a primers; C is the gel diagram of the identification with JD-1s\JD-2a primers.

[0031] Figure 6 The expression pattern of CmACS11 in the candidate interval has changed. Among them, A-F are the in-situ hybridization results of CmACS11 in the 13C material; H-N are the in-situ hybridization results of CmACS11 in the mp_ol material; G is the signal of the sense probe SP6 in the mp_ol material. mf (male flower), hermaphrodite flower; hf (hermaphrodite flower), bisexual flower; fvb (flower vascular bundle), flower vascular bundle; se (sepal), sepal; pe (petal), petal; st (stamen), stamen; ca (carpel), carpel; le (leaf), leaf; bvb (branch vascular bundle), lateral branch vascular bundle; fm (flower meristem), flower meristem; fb (flower bud), flower bud. The scale bar is 100μm.

[0032] Figure 7 The SV_352 variation leads to the change of the CmACS11 expression pattern. Among them, A-E are the GUS staining results of the flower buds of the proMP::GUS transgenic plants; F-H are the GUS staining results of the flower buds of the proMP::GUS△352::GUS transgenic lines. Detailed implementation methods

[0033] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0034] In addition, the technical solutions between the various embodiments of the present invention can be combined with each other, but it must be based on the ability of those of ordinary skill in the art to implement. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the protection scope required by the present invention.

[0035] The following specifically illustrates the solutions proposed by the present invention through specific embodiments:

[0036] Example 1. Obtaining of the SV_352 Mutation on the CmACS11 Promoter

[0037] 1. Constructing an F2 Genetic Population Using the Hermaphrodite Line Material mp_ol and the Andromonoecious Line Material 13C

[0038] In this study, the andromonoecious line material 13C and the hermaphrodite line material mp_ol were used as the female parent and male parent respectively for hybridization to obtain the F1 generation, and the F1 was self-crossed to obtain the F2 generation. The parent 13C showed that all the main branch flowers were male flowers, the 1-3 nodes of the lateral branches were hermaphrodite flowers, and the rest of the nodes were male flowers; the parent mp_ol showed that all the flowers on the main branch and lateral branches of the plant were hermaphrodite flowers. The results of genetic analysis (Table 1) showed that the F1 showed that the female organs of all the flowers of the melon plants were developed; among the 117 plants in the F2 lines, the female organs of all the flowers were developed, showing hermaphrodite flowers or female flowers, and 41 plants had hermaphrodite flowers or female flowers only at the first 1-3 nodes of the lateral branches, and the rest were male flowers. The fully developed female phenotype of F1 and the ratio of fully developed female: only partially developed female flowers on the lateral branches in F2 (117:41) were consistent with the expected segregation ratio of 3:1, indicating that in this population, fully developed female was a dominant trait controlled by a single gene. At the same time, we used mp_ol and 13C to hybridize and created a material with fully developed female, namely the F1 hybrid.

[0039] Table 1. Genetic Analysis of the F2 Population (13C×mp_ol)

[0040] Population Number Fully developed female a Only partial flowers on lateral branches with female development b Expected segregation ratio Chi-square value P value mp_ol 18 18 / / / / 13C 18 / 18 / / / F1 18 18 / / / / F2 158 117 41 3:1 0.0759 0.7829

[0041] Note: a indicates that the female organs of all the flowers on the main branch and lateral branches of the melon plant are developed, being hermaphrodite flowers or female flowers; b indicates that the female organs of the flowers only at the first 1-3 nodes of the lateral branches of the melon plant are developed, being hermaphrodite flowers or female flowers, and the flowers at the rest of the positions of the plant are male flowers. P>0.05 is considered a significant difference.

[0042] 2. Preliminary mapping of candidate genes for female development using BSA

[0043] The F2 population was planted in the greenhouse of the Agricultural High-tech Zone Base in Jimo District, Qingdao City, Shandong Province in 2022. Starting from the initial flowering of the plants, the sex of the flowers at the first 30 nodes of the main branch and the first 8 nodes of the lateral branches at the 10-20th nodes were investigated. In the F2 population, 24 lines with fully developed females and 17 lines with female development only at the first few nodes of the lateral branches were respectively selected, as well as 10 plants of each of the two parents. Genomic DNA was extracted from the young leaves of the melon lines using the CTAB method, and four DNA pools (F2_mp_ol, F2_13C, P_mp_ol, P_13C) were constructed respectively. The DNA concentration was diluted to 30 ng / μL with ddH2O, and 30 μL of each was added to synthesize a DNA pool, which was sent to Annoroad Gene Technology (Beijing) Co., Ltd. for library construction and sequencing. Paired-End 150 sequencing was performed using the Illumina HiSeq sequencing platform. The obtained raw data was quality-controlled to obtain clean data, which was aligned with the melon reference genome DHL92 using the BWA software, and SNPs were screened using the GenomeAnalysis Toolkit v4.1.4.0 software. The candidate region was mapped using a sliding window method with a window size of 1000 Kb and a step size of 10 Kb, and determined by calculating SNP-index and ΔSNP-index. The analysis of the BSA sequencing results was as follows Figure 1 , and the gene controlling the complete development of females in melons was preliminarily mapped within the interval of 26.38 Mb to 31.28 Mb at the end of chromosome 3.

[0044] 3. Further narrowing down of candidate genes for female development using KASP

[0045] The F2 population was expanded to 1303 plants. DNA from young leaves of plants was extracted by CTAB method and diluted to 80-100 ng / μL. The sexual phenotype (sex of main branch flowers) was investigated. 15 SNP loci (KF1-KF10, KS1-KS5) were selected in the candidate interval and primers with HEX, FAM tags and universal primers were designed (Table 2). Genotyping analysis was performed using a high-throughput genotyping system (GeneMatrix011022, HCSCI, China). The components were mixed according to the proportions in Table 3. A 96-well plate was used to add 2 μL of the above mixture to each well, and the DNA sample volume was 0.2 μL. PCR cycles were set up, including an initial hot start (95°C for 10 min), 10 drop cycles (95°C for 20 s; starting from 65°C, each cycle decreased by 0.6°C for 40 s), and then 25 cycles (95°C for 20 s; 54°C for 40 s). Combined with the phenotypes of individual plants, the candidate interval was eventually narrowed down to 28473819-28563989 bp, a total of 92.8 kb. This interval contained 10 candidate genes, such as Figure 2 Among them, there is the gene CmACS11 that regulates the sex development of melon flower organs, and its gene ID is MELO3C010779.

[0046] Table 2. SNP primer sequences

[0047]

[0048]

[0049] Table 3. Mixed systems

[0050] Component Volume Common primer 1.12 μL Competitive primer Each 0.48 μL 2×MasterMix 240 μl

[0051] 4. Cloning of SV_352 variant on CmACS11 promoter

[0052] Using IGV to check the resequencing data of two hermaphroditic materials mp_ol and mp_35, as well as the male-flowered hermaphroditic material 13C, we found that in the hermaphroditic materials, there was a 352 bp insertion at the position -2564 of the promoter of CmACS11, but not in 13C ( Figure 3 ). The DNA of mp_ol and 13C was extracted by CTAB method, and primers pro-clone-s and pro-clone-a were designed based on this as a template to clone the promoter sequence of CmACS11 in mp_ol and 13C, and SEQ ID No.1 and SEQ ID No.2 were obtained. A 352bp sequence was inserted into sequence 1, named SV_352, and its nucleotide sequence is shown in SEQ ID No.3.

[0053] Among them, the nucleotide sequence of pro-clone-s is shown in SEQ ID No.4, specifically: TCTTTACGTAGGAATTTACG; the nucleotide sequence of pro-clone-a is shown in SEQ ID No.5, specifically: ATATGAGAGTACAGTATGTAGGT.

[0054] Example 2: The SV_352 variation on the CmACS11 promoter is closely linked to the complete development of melon femaleness

[0055] 1. The results of population haplotype typing indicate that the SV_352 variation is closely linked to the complete development of melon femaleness

[0056] Haplotype analysis of the CmACS11 gene was performed on the resequencing data of 250 melon materials, and 5 haplotypes (H1-H5) were found. Among them, haplotype H1 has the SV_352 insertion variation and is completely linked to the hermaphrodite line ( Figure 4 ), indicating that the SV_352 variation is closely linked to the complete development of melon femaleness.

[0057] 2. The PCR identification results further prove that the SV_352 variation is closely related to the trait of complete development of melon femaleness

[0058] Thirty natural germplasm materials of melon were selected, including 4 hermaphrodite lines with male flowers (13, 14, 26, 31), 1 monoecious line (25), and the remaining 25 were all hermaphrodite materials. DNA was extracted using the CTAB method, and identification primers were designed near the SV_352 variation. DNA identification was performed using JD-1s / JD-1a and JD-1s\JD-2a respectively. The identification results showed that the 352bp insertion was present in all 25 hermaphrodite materials, and the remaining sexual type materials did not contain the 352bp insertion ( Figure 5 ), indicating that the SV_352 variation is closely related to the complete development of melon femaleness.

[0059] Among them, the nucleotide sequence of JD-1s is shown in SEQ ID No.53, specifically: GTGTATGGATCGATTCATCTAAC; the nucleotide sequence of JD-1a is shown in SEQ ID No.54, specifically: CTAAGATCGTAGAAGTCGAAAGC; the nucleotide sequence of JD-2a is shown in SEQ ID No.55, specifically: CCAATATTAGCATTTGCCTGTCC.

[0060] Example 3: The SV_352 variation promotes the complete development of melon female organs by changing the expression pattern of CmACS11

[0061] 1. The expression pattern of CmACS11 is altered in the mp_ol material

[0062] The promoter is a determinant of gene expression. Therefore, further detection was carried out to determine whether the expression pattern of CmACS11 was altered in the mp_ol material (genotype +SV_352). Specific fragments of the CmACS11 gene were selected to design mRNA in situ hybridization probe primers CmACS11-sp6 and CmACS11-t7 (the nucleotide sequence of CmACS11-sp6 is shown in SEQ ID No.6, specifically: GATTTAGGTGACACTATAGaatGCTATGATGGCAATGTTGTCTACTAAAG; the nucleotide sequence of CmACS11-t7 is shown in SEQ ID No.7, specifically: TGTAATACGACTCACTATAGGGGAGTTCGTAGGCATTGAGAG). Digoxigenin-labeled sense / antisense RNA probes were synthesized using an mRNA probe kit (Roche, 11175025910) and stored in a -20 °C refrigerator. Under RNase-free conditions, the apical and lateral branch apices of 13C and mp_ol were fixed with FAA fixative, embedded in paraffin, and sectioned (8 μm). Under RNase-free conditions, the dewaxed samples were incubated and hybridized with the probes, washed and blocked, and then hybridized with digoxigenin antibody (Roche, 11093274910). After washing off the excess antibody, staining was performed using NBT (Roche, 11383213001) and BCIP (Roche, 11383221001).

[0063] The in situ hybridization results showed that in the male flower and hermaphrodite line material 13C, CmACS11 was selectively not expressed in male flowers and was only expressed in the vascular bundles at the base of the flower buds in the 4th and 8th stages of hermaphrodite flower buds. In the hermaphrodite line mp_ol, strong signals were detected in the sepals, petals, carpels, and the base of the carpels in all flower buds starting from the 2nd stage, and were also expressed in the vascular bundles at the base of the leaves and lateral branches ( Figure 6 ). This result indicates that the selective expression pattern of CmACS11 is lost in mp_ol, suggesting that the SV_352 variation at the CmACS11 promoter in mp_ol may be the reason for the change in its expression pattern.

[0064] 2. GUS staining analysis shows that the SV_352 variation is the reason for the altered expression of CmACS11

[0065] (1) Construction of proMP::GUS and proMP△352::GUS vectors

[0066] To identify whether the SV_352 mutation in mp_ol is the root cause of the change in the CmACS11 expression pattern, in the present invention, the promoter of the CmACS11 gene (SEQ ID NO: 1) in mp_ol was ligated between XbaⅠ and SalⅠ in the pCAMBIA1305.4 vector to construct the proMP::GUS vector; similarly, the promoter of the CmACS11 gene in mp_ol with the inserted 352 bp sequence removed (SEQ ID NO: 2) was ligated between XbaⅠ and SalⅠ in the 1305.4-GUS vector to construct the proMPΔ352bp::GUS vector. The recombinant plasmids were transformed into Escherichia coli and sent to Qingke Biotechnology Company for sequencing.

[0067] (2) Agrobacterium-mediated genetic transformation of melons and screening of transgenic positive plants

[0068] Plasmids were extracted from the strains with correct sequencing and transformed into Agrobacterium tumefaciens competent cells GV3101 by chemical transformation. Positive plants were obtained using the Agrobacterium-mediated genetic transformation system of melons. The genetic background was the P147 germplasm with high genetic transformation efficiency screened by the research group. The genetic transformation system was successively divided into steps such as sowing, preparation of Agrobacterium, preparation of explants, Agrobacterium infection, co-culture, recovery, screening and differentiation, rooting, and transplantation. The genetic transformation plants were screened and identified using the GFP fluorescence screening method to obtain T0 generation positive plants, and GFP fluorescence seedlings T1 generation were obtained after self-crossing.

[0069] Among them, sowing: soak the seeds in warm water (50 - 60°C) for 30 min, after removing the outer seed coat, sterilize them with 70% alcohol and 10% NaClO for 1 min and 15 min in sequence, then sow them in the sowing medium and place them in a 28°C incubator for dark culture for 24 h; Agrobacterium preparation: shake the Agrobacterium containing the target vector in LB medium until the OD value reaches 0.6 - 0.8, centrifuge at 4000 rpm / min, and resuspend it with the liquid infection medium until the OD value is about 0.3 to obtain the Agrobacterium infection solution; explant preparation: remove the inner seed coat from the seeds after 24 h of culture, cut off the distal end of the cotyledons at the middle position of the cotyledons, cut off the connection between the proximal end of the cotyledons and the radicle to form a V-shaped opening, and the remaining cotyledon part is the explant; Agrobacterium infection: place the prepared explants and the Agrobacterium infection solution in a 20 mL syringe, with the total volume of the explants and the Agrobacterium infection solution being 10 mL, block the syringe mouth with a rubber stopper, slowly pull the piston to 20 mL, gently shake for about 5 s, and then slowly release the piston, repeating 10 times; co-culture: place the explants horizontally on the surface of the co-culture medium and culture them in the dark at 25°C for 3 d; recovery: transfer the explants to the recovery medium, insert the V-shaped opening obliquely into the medium, and culture for 7 d; screening and differentiation: transfer the explants to the differentiation medium, insert the V-shaped opening obliquely into the medium, and culture for about 2 - 3 weeks; rooting: cut off the buds with GFP fluorescence and insert them into the rooting medium; transplanting: transplant the rooted transgenic seedlings into the soil. The formulations of the plant culture-related media used above are shown in Table 4. After adjusting the pH to 5.8 and autoclaving at high temperature and pressure for 20 min, they are dispensed into corresponding containers for storage.

[0070] Table 4. Formulations of the media for plant tissue culture

[0071]

[0072]

[0073] (3) Analysis of GUS staining results

[0074] Select the T1 generation transgenic lines proMP::GUS-3, proMP::GUS-14, proMP△352::GUS-5, and proMP△352::GUS-8 with GFP fluorescence, and immerse their early flower buds in the GUS staining solution (G3061, Solarbro, China) and perform vacuum staining. The results show that in the proMP::GUS lines, strong GUS signals start to appear in all flower buds at the second stage, and there are strong signals in the leaves and the bases of lateral branches; while in the proMP△352::GUS lines, only weak GUS signals are detected at the bases of bisexual flower buds in the later stage ( Figure 7)。This result is consistent with the in-situ hybridization result in the change of the expression pattern of CmACS11 in the mp_ol material in this example, indicating that the SV_352 variation in mp_ol is the reason for the change in the alternative expression pattern of CmACS11, thus causing the change in sexual type.

[0075] The above experimental data show that in the development of melon sexual type, the SV_352 variation on the CmACS11 promoter is a key variation that controls the development of female organs in melons by affecting its expression pattern, providing a new variation resource for creating breeding materials for melon female lines.

[0076] It should be noted that in this article, the terms "including", "comprising" or any other variant thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements not only includes those elements, but also includes other elements not explicitly listed, or also includes elements inherent in such process, method, article or device. Without further limitation, an element defined by the statement "including a..." does not exclude the existence of another identical element in the process, method, article or device including the element.

[0077] The serial numbers of the above embodiments of the present invention are only for description and do not represent the advantages or disadvantages of the embodiments.

[0078] The above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the purpose and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.

Claims

1. A DNA molecule, characterized in that The nucleotide sequence of the DNA molecule is shown in SEQ ID No.

3.

2. A promoter, characterized in that The promoter contains the DNA molecule according to claim 1.

3. Use of the DNA molecule according to claim 1 or the promoter according to claim 2 in increasing the expression and / or premature expression of the CmACS11 gene in melon.

4. A primer pair for amplifying the promoter according to claim 2, characterized in that: The sequences of the primer pairs are shown in SEQ ID No. 4-5.

5. A recombinant vector, expression cassette, or transgenic recombinant bacterium containing the DNA molecule of claim 1 or the promoter of claim 2.

6. Use of the DNA molecule according to claim 1, or the promoter according to claim 2, or the recombinant vector, expression cassette, or transgenic recombinant bacterium according to claim 5 in at least one of the following: 1) Application in regulating female development of melon; 2) Application in female melon breeding; 3) Application in increasing melon yield.

7. A method for studying promoter expression characteristics in melon, characterized in that: The method comprises adopting an Agrobacterium-mediated method to transfer the recombinant vector, expression cassette and transgenic recombinant bacteria according to claim 5 into plants to obtain transgenic plants in which GUS expression is driven by promoters of different forms of target genes; wherein the plant is melon and the target gene is CmACS11 gene.

8. A method for regulating female development of melon, characterized in that: The method comprises inserting the DNA molecule of claim 1 into the promoter of the melon CmACS11 gene.

9. A method for detecting whether a melon is fully developed female, characterized in that: The determination is made by detecting whether the promoter of the melon CmACS11 gene contains the DNA molecule of claim 1; if it does, the melon is fully developed female.

Images