Efficient homologous recombination method suitable for bifidobacteria and application of efficient homologous recombination method

By constructing and screening the SSAP-SSB recombinase combination, the problem of low gene editing efficiency of Bifidobacterium was solved, and efficient homologous recombination of Bifidobacterium longum was achieved, which significantly improved the genome editing efficiency.

CN120192981APending Publication Date: 2025-06-24SHANDONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510236035.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-28
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

In the prior art, the gene editing efficiency of Bifidobacterium is relatively low, which limits its application in the medical field.

Method used

By constructing a recombinase tool library of single-strand annealed protein (SSAP) and single-strand binding protein (SSB), recombinase combinations with efficient homologous recombination capabilities were screened out, such as the combination of BiSSAP1 and SSB9, and constructed on the E. coli-Bifibacterium shuttle vector to achieve its co-expression in Bifidobacterium longus.

Benefits of technology

The homologous recombination capability of Bifidobacterium longum has been significantly improved, and the absolute editing efficiency of genomes has been increased from an almost undetectable level to 0.00121576%, which has promoted the research and application progress of genome engineering of this strain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192981A_ABST
    Figure CN120192981A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of microbial genetic engineering, and particularly relates to an efficient homologous recombination method suitable for bifidobacteria and application of the efficient homologous recombination method. Specifically, the invention discloses a method for constructing and screening the combination of the single-chain annealing protein and the single-chain binding protein for the first time. According to the method, a single-chain annealing protein and a single-chain binding protein are jointly constructed in an escherichia coli-bifidobacterium shuttle expression vector, and co-expression of the single-chain annealing protein and the single-chain binding protein in bifidobacterium longum is realized, so that the homologous recombination capability of the bifidobacterium longum is remarkably improved. According to the method disclosed by the invention, the homologous recombination efficiency of genome editing of the bifidobacterium longum is greatly improved, the absolute genome editing efficiency of the bifidobacterium longum is improved to 0.00009792% from the original level which is almost undetectable, and the research and application progress of genome engineering of the strain is remarkably promoted, so that the method has a good practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial genetic engineering, and particularly relates to an efficient homologous recombination method applicable to Bifidobacterium and its application. Background Art

[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention, and is not necessarily to be regarded as an admission or any form of implication that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Bifidobacterium is a kind of intestinal probiotic, which has multiple probiotic functions for maintaining human health, has high food and medical safety, can regulate the balance of intestinal flora, prevent intestinal pathogenic infections by producing short-chain fatty acids or prebiotic oligosaccharides, inhibit pathogens, prevent inflammation, and has an anti-tumor effect of inducing tumor-specific T cells, etc. However, the lack of understanding of the molecular mechanism of the probiotic effect of Bifidobacterium and the limited genetic manipulation techniques available for Bifidobacterium have hindered the application of these bacteria in the medical field. It has been reported that the genomes of Bifidobacterium are edited by endogenous and exogenous CRISPR-Cas of Bifidobacterium, and the Cas protein is used to generate DNA double-strand breaks at specific positions to initiate the SOS repair mechanism of Bifidobacterium itself, and homologous recombination repair is carried out using the artificially added DNA as a template. However, this recombination method relying on the SOS repair mechanism will inevitably have a relatively low

[0004] editing efficiency. Red / ET recombineering is one of the main techniques widely used in current bacterial genome editing techniques. Red / ET recombineering is a homologous recombination technique mediated by the recombination proteins Redα / Redβ derived from Escherichia coli λ phage or the recombination proteins RecE / RecT derived from Escherichia coli Rac prophage, which can solve the problems that cannot be solved by traditional DNA cloning techniques. It can perform deletion, insertion, replacement, point mutation and cloning of target DNA by short-chain homologous arm homologous recombination mediated by phage recombinases Redαβγ or RecET, and has the advantages of not relying on restriction enzyme sites, not being restricted by positions, high accuracy and no off-target effects. Therefore, homologous recombination is one of the most precise methods for changing DNA genes. Currently, Red / ET recombineering has been widely applied to the genetic engineering and heterologous expression of various biosynthetic gene clusters. There have been studies using Red / ET recombineering to successfully heterologously express biosynthetic gene clusters from Pseudomonas in Escherichia coli, and using Red / ET recombineering to perform site-directed mutagenesis on plasmids, etc. However, at present, there are still relatively few reports on the study of the genome editing efficiency using homologous recombinases for Gram-positive bacteria with relatively difficult genetic manipulation such as Bifidobacterium.

[0005] The genus Bifidobacterium has been proven to be the host probiotic group in the intestines of breastfed infants, and it significantly improves host health by accelerating the maturation of the immune response, inhibiting inflammation, and improving intestinal barrier function. Among them, Bifidobacterium longum can efficiently uptake complex carbohydrates in breast milk due to its excellent adaptability in the infant intestine, providing nutritional support for the intestine before weaning. As the focus of research, Bifidobacterium longum has been awarded the QPS (Qualified Presumption of Safety) status by the European Food Safety Authority (EFSA) and incorporated into food production, showing great potential in medicine and food. However, the research progress on its probiotic mechanism and function modification is slow, and one of the main reasons is limited by the inefficiency of existing gene editing methods. Although there have been studies exploring the use of the endogenous CRISPR system, temperature-sensitive plasmids, and conditionally self-destructing plasmids of Bifidobacterium longum to achieve homologous recombination, these methods all rely on the homologous recombination system of Bifidobacterium longum itself, and this homologous recombination will inevitably be strictly controlled by its own various regulatory systems, which may lead to low editing efficiency. In contrast, the externally used SSAP-SSB system may evade this strict regulatory mechanism of Bifidobacterium longum, thus achieving more efficient gene editing.

[0006] Red / ET recombineering is the most effective method to promote bacterial homologous recombination. Therefore, the homologous recombination system has the potential to improve the editing efficiency and precise editing ability of Bifidobacterium. During the recombination process mediated by Red / ET recombineering, the single-strand annealing protein SSAP plays an important role. SSAP can bind to single-stranded DNA (ssDNA) substrates and promote strand exchange between homologous DNA sequences by stimulating the annealing of complementary single-stranded regions, enabling the exogenous substrate to finally enter the genome in the form of ssDNA from the replication fork to complete editing. Studies have shown that SSAPs can increase homologous recombination in host cells by 1000 times compared to endogenous homologous recombination; in addition, during DNA repair, SSAP can stabilize single-stranded DNA regions by binding to SSB. In theory, the use of SSB can improve the stability of ssDNA in bacteria and thus improve the recombination efficiency. However, the SSB and SSAP proteins from different species of Bifidobacterium may have different working intensities and there is a certain mutual adaptation relationship between them. Therefore, by testing the recombination functions of combinations of SSAP and SSB from different species of Bifidobacterium in Bifidobacterium longum, an efficient SSAP-SSB recombination system can be obtained. Summary of the Invention

[0007] In view of the above-mentioned prior art, the object of the present invention is to provide an efficient homologous recombination method applicable to Bifidobacterium and its application. Specifically, the present invention constructs a library of recombinase tools of single-strand annealing protein (SSAP)-single-strand binding protein (SSB) from the genus Bifidobacterium, and screens for a combination of recombinases with high homologous recombination ability, thereby establishing a method for improving the genome editing efficiency of Bifidobacterium and other related strains. Based on the above research results, the present invention is completed.

[0008] In order to achieve the above technical objectives, the technical solutions provided by the present invention are as follows:

[0009] In the first aspect of the present invention, a combination of recombinases is provided, and the combination of recombinases includes a single-strand annealing protein (BiSSAP) and a single-strand binding protein (SSB).

[0010] Among them, the single-strand annealing protein (BiSSAP) includes BiSSAP1 - BiSSAP 16 , preferably BiSSAP1, BiSSAP2 and BiSSAP 11 ; more preferably BiSSAP1, and the nucleotide sequence of BiSSAP1 is as shown in SEQ ID NO.1;

[0011] The single-strand binding protein (SSB) includes SSB1 - SSB 50 , more preferably SSB9, and the nucleotide sequence of SSB9 is as shown in SEQ ID NO.2.

[0012] Furthermore, the combination of recombinases is a combination of BiSSAP1 and SSB9.

[0013] In the second aspect of the present invention, an application of the above combination of recombinases in homologous recombination of Bifidobacterium is provided.

[0014] Among them, the Bifidobacterium includes Bifidobacterium longum, Bifidobacterium animalis, etc., and among them, Bifidobacterium longum is preferred.

[0015] In the third aspect of the present invention, an efficient homologous recombination method applicable to Bifidobacterium is provided, and the method includes using the above combination of recombinases to improve the homologous recombination efficiency.

[0016] Furthermore, the method includes: designing homologous arms, constructing the above combination of recombinases on an Escherichia coli - Bifidobacterium shuttle vector, and electrotransforming Bifidobacterium to obtain corresponding transformants.

[0017] Furthermore, the Escherichia coli - Bifidobacterium shuttle vector can be the p15A-cm-BBori-cat plasmid, and the nucleotide sequence of the p15A-cm-BBori-cat plasmid is as shown in SEQ ID NO.3.

[0018] Furthermore, the specific method for constructing the above-mentioned recombinase combination on the Escherichia coli - Bifidobacterium shuttle vector is as follows: BiSSAP and SSB are respectively constructed downstream of the P tac promoter for co-expression, and then placed on the above-mentioned Escherichia coli - Bifidobacterium shuttle vector to obtain p15A-cm-BBori-cat-Ptac-BiSSAP1-SSB.

[0019] In the fourth aspect of the present invention, there is provided the use of the above-mentioned recombinase combination or the efficient homologous recombination method in the gene editing of Bifidobacterium.

[0020] Among them, the Bifidobacterium includes Bifidobacterium longum, Bifidobacterium animalis, etc., and among them, Bifidobacterium longum is preferred.

[0021] The beneficial technical effects of the above one or more technical solutions:

[0022] The above technical solution first discloses a method for constructing and screening a combination of single-strand annealing protein and single-strand binding protein. This method realizes their co-expression in Bifidobacterium longum by co-constructing the single-strand annealing protein and the single-strand binding protein in the Escherichia coli - Bifidobacterium shuttle expression vector, thereby significantly improving the homologous recombination ability of Bifidobacterium longum. Through the method of the present invention, the homologous recombination efficiency of Bifidobacterium longum genome editing has been greatly improved, and its absolute genome editing efficiency has been increased from an almost undetectable level to 0.00121576%, significantly promoting the research and application progress of the genome engineering of this strain. Brief Description of the Drawings

[0023] Figure 1 : Construction of the BiSSAP expression vector and verification of its recombinant function.

[0024] A, Schematic diagram of the BiSSAP expression vector. BiSSAP is constructed downstream of the P tac promoter and placed on the Escherichia coli - Bifidobacterium shuttle vector (p15A-cm-BBori-cat-Ptac-BiSSAP).

[0025] B and C, Schematic diagram of Bifidobacterium longum genome editing. By electrotransforming single-stranded DNA with a spectinomycin resistance gene and 160 bp homologous arms into Bifidobacterium longum to replace the 317 bp DNA sequence on the genome, and detecting positive colonies with two pairs of primers (P1 / P2 and P2 / P3).

[0026] D. Functional test of BiSSAP homologous recombination in Bifidobacterium longum. The experimental results showed that the wild-type Bifidobacterium longum did not obtain the positive bacteria after homologous recombination. However, Bifidobacterium longum expressing BiSSAP1, BiSSAP2, BiSSAP3, and BiSSAP 11 recombinases produced positive bacteria after genome editing. Among them, BiSSAP1 and BiSSAP1 had strong homologous recombination ability in Bifidobacterium longum, while BiSSAP3 and BiSSAP 11 had weaker homologous recombination ability.

[0027] Figure 2 : Construction of BiSSAP1-SSB expression vector and functional test of recombination.

[0028] A. Schematic diagram of BiSSAP1-SSB expression vector. BiSSAP1 and various SSBs were respectively constructed downstream of the P tac promoter for co-expression, and placed on the Escherichia coli-Bifidobacterium shuttle vector (p15A-cm-BBori-cat-Ptac-BiSSAP1-SSB), and electro-transformed into Bifidobacterium longum to obtain Bifidobacterium longum transformants expressing various BiSSAP1-SSBs.

[0029] B. Effect of different SSBs on the homologous recombination function of BiSSAP1. The recombinase BiSSAP1 and SSB were both expressed under the control of the same promoter, and the recombination function of the combination of BiSSAP1 and various SSBs was detected. The results showed that the combination of BiSSAP1-SSB9 had a higher homologous recombination ability, and the recombination ability was increased to about 7 times compared with that of BiSSAP1 alone. Detailed implementation manners

[0030] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0031] It should be noted that the terms used herein are only for describing the specific implementation manners and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0032] The present invention will be further described below in conjunction with embodiments. The present invention will be further illustrated by way of examples, but the present invention is not limited to the scope of the described embodiments. Based on the embodiments of the present invention, any changes to the present invention made by those skilled in the art without creative efforts fall within the protection scope of the present invention. At the same time, in the embodiments of the present invention, unless otherwise specified, all preparation raw materials are commercially available products well-known to those skilled in the art.

[0033] Reagents and Instruments:

[0034] In this embodiment, the reagents are mainly molecular biology experimental reagents. The primers required for plasmid construction are synthesized from Shanghai Sangon Biotech Co., Ltd. The BiSSAP and SSB genes are synthesized by BGI Shenzhen Co., Ltd. The restriction endonucleases are from New England Biolabs, and the DNA polymerase is ApexHF HS DNA Polymerase FS Master Mix from ACCURATE BIOLOGY. The antibiotics are purchased from Invitrogen. The electroporator used is the Bio-Rad electroporator from the United States, and a 2 mm electroporation cuvette of the same brand. The Bifidobacterium longum (Bifidobacterium longum ATCC 15697) involved in the invention is purchased from the China Medical Bacteria Preservation Management Center, and the 0233 medium is the formula attached to the purchase of this strain.

[0035] Formula of 0233 medium: Soybean peptone 5.0 g / L, Tryptone 5.0 g / L, Yeast extract 10.0 g / L, Glucose 10.0 g / L, L-Cysteine 0.5 g / L, Salt solution 40 mL, Agar powder 15.0 g / L. (Formula of salt solution: Calcium chloride 0.2 g / L, Magnesium sulfate heptahydrate 0.48 g / L, Dipotassium hydrogen phosphate 1.0 g / L, Potassium dihydrogen phosphate 1.0 g / L, Sodium bicarbonate 10.0 g / L, Sodium chloride 2.0 g / L)

[0036] Plasmid transformation method of Bifidobacterium longum:

[0037] (1) Preparation of competent cells: Inoculate Bifidobacterium at an inoculation amount of 1 / 12 into 1.2 mL of 0233 medium supplemented with 0.2 M NaCl, and grow in an anaerobic chamber at 35 °C until the mid-logarithmic phase (OD 600 ≈0.3); Centrifuge the bacterial cells at 10,000 rpm for 1 min at 4 °C, discard the supernatant; Resuspend the bacterial cells with 1 mL of SA buffer pre-cooled on ice, centrifuge at 10,000 rpm for 1 min at 4 °C, discard the supernatant, and repeat this step once; Add 90 μL of 10% glycerol to the Ep tube.

[0038] (2) Electrotransformation of competent cells: Add 2 μL of absolute ethanol and 1 μg of plasmid to the competent cells, pipette and mix well; transfer the bacterial solution to a 2 mm electroporation cuvette at room temperature, set the electroporation parameters to 3000 V 200 Ω 25 μF, and perform electroporation; add 1 mL of 0233 medium without antibiotics to the electroporation cuvette, pipette and mix well, then transfer it to an EP tube. After puncturing the EP tube, resuscitate it in an anaerobic chamber at 35 °C for 10 h; appropriately dilute the bacterial solution and spread it on a 0233 agar plate with a chloramphenicol concentration of 10 μg / mL; culture it in an anaerobic chamber at 35 °C until single colonies grow out (36 - 48 h).

[0039] Electrotransformation method of recombinant substrate of Bifidobacterium longum:

[0040] Use a pair of primers modified by thiophosphorylation and phosphorylation to perform PCR amplification of double-stranded DNA carrying a 160 bp homologous arm and a spectinomycin selection marker, and recover the single-stranded DNA after digestion with λexo exonuclease. Culture the Bifidobacterium longum transformants carrying different BiSSAP / BiSSAP-SSB to the mid-logarithmic growth phase (OD 600 ≈0.3), wash it twice with sterile water and once with 10% glycerol. After discarding the supernatant, add 90 μL of 10% glycerol, add 4 μL of absolute ethanol and 500 ng of single-stranded DNA, and mix well. Transfer it to a 2 mm electroporation cuvette, perform electroporation at 3000 V 200 Ω 25 μF, resuscitate it with 1 mL of medium with a chloramphenicol concentration of 5 μg / mL, resuscitate it at 35 °C for 10 h, and spread it on an agar plate with a spectinomycin concentration of 100 μg / mL. Count the number of single colonies on the plate and detect the positive rate. Determine the recombination efficiency of different BiSSAP by comparing the number of successfully edited single colonies on the agar plate.

[0041] Calculation method of absolute genome editing efficiency: After transforming the recombinant substrate into Bifidobacterium and completing resuscitation, dilute it 10 5 times and spread it on an agar plate with a chloramphenicol concentration of 10 μg / mL. Calculate the total number of viable bacteria according to the number of colonies growing on the plate; take 1 / 2 of the Bifidobacterium in the same EP tube and spread it on an agar plate with a spectinomycin concentration of 100 μg / mL, and calculate the total number of positive bacteria according to the number of colonies growing on the plate; absolute genome editing efficiency = total number of positive bacteria / total number of viable bacteria × 100%.

[0042] Detection of positive colonies by colony PCR of bacterial solution:

[0043] Detection primer P1(F): CGTCGACGTCTGCGGCAATT

[0044] Detection primer P2(R): GCCATGTCCGATTCCTACGA

[0045] Detection primer P3(R): TACCGTGGAATCATCCTCCC

[0046]

[0047] PCR reaction procedure:

[0048]

[0049]

[0050] Example 1: Screening for BiSSAP that promotes homologous recombination in Bifidobacterium longum.

[0051] We screened for BiSSAP with homologous recombination function in Bifidobacterium longum. The BiSSAP was placed on an Escherichia coli - Bifidobacterium shuttle vector (p15A-cm-BBori-cat-Ptac-BiSSAP) ( Figure 1 A), and various Bifidobacterium longum transformants expressing BiSSAP were obtained after electrotransformation into Bifidobacterium longum. Genomic editing of Bifidobacterium longum was performed using recombinant substrates, and two pairs of primers P1 / P2 and P2 / P3 were used to detect positive colonies ( Figure 1 B and 1C). The results showed that BiSSAP1, BiSSAP2, BiSSAP3, BiSSAP 11 had homologous recombination function in Bifidobacterium longum. Among them, BiSSAP1 and BiSSAP2 had stronger homologous recombination ability compared to BiSSAP3 and BiSSAP 11 . The genomic editing efficiency of BiSSAP1 in Bifidobacterium longum was the highest, reaching 0.00009792%, and no colonies with successful genomic editing were observed in wild-type Bifidobacterium longum ( Figure 1 D).

[0052] Example 2: Screening for the BiSSAP1-SSB combination with high-efficiency homologous recombination in Bifidobacterium longum.

[0053] We selected the BiSSAP1 with the strongest homologous recombination ability described above and combined it with various SSBs, and constructed them on the corresponding Escherichia coli - Bifidobacterium shuttle vectors to obtain expression vectors of BiSSAP1 and 50 different SSBs (p15A-cm-BBori-cat-Ptac-BiSSAP1-SSB) ( Figure 2 A). After electrotransformation into Bifidobacterium longum, genomic editing of the corresponding transformants was performed to detect the differences in the homologous recombination function of the BiSSAP1 and different SSB combinations. The results showed that the BiSSAP1-SSB9 combination had the highest homologous recombination ability, and the recombination efficiency reached 0.000931%, which was about 7 times higher than that of the single SSAP1 ( Figure 2B).

[0054] In this example, BiSSAP1 with high-efficiency homologous recombination in Bifidobacterium longum was successfully screened. By co-expressing BiSSAP1 and SSB to detect the homologous recombination function, we successfully improved the homologous recombination ability of BiSSAP1 in Bifidobacterium longum.

[0055] Nucleotide sequence of SEQ ID NO.1:

[0056]

[0057]

[0058] Nucleotide sequence of SEQ ID NO.2:

[0059] Nucleotide sequence of SEQ ID NO.3:

[0060]

[0061]

[0062]

[0063] GGAGATGCTTATGAACTTTAATAAAATTGATTTAGACAATTGGAAGAGAAAAGAGA

[0064] TATTTAATCATTATTTGAACCAACAAACGACTTTTAGTATAACCACAGAAATTGATA

[0065] TTAGTGTTTTATACCGAAACATAAAACAAGAAGGATATAAATTTTACCCTGCATTTA

[0066] TTTTCTTAGTGACAAGGGTGATAAACTCAAATACAGCTTTTAGAACTGGTTACAAT

[0067] AGCGACGGAGAGTTAGGTTATTGGGATAAGTTAGAGCCACTTTATACAATTTTTGA

[0068] TGGTGTATCTAAAACATTCTCTGGTATTTGGACTCCTGTAAAGAATGACTTCAAAG

[0069] AGTTTTATGATTTATACCTTTCTGATGTAGAGAAATATAATGGTTCGGGGAAATTGTT

[0070] TCCCAAAACACCTATACCTGAAAATGCTTTTTCTCTTTCTATTATTCCATGGACTTCA

[0071] TTTACTGGGTTTAACTTAAATATCAATAATAATAGTAATTACCTTCTACCCATTATTAC

[0072] AGCAGGAAAATTCATTAATAAAGGTAATTCAATATATTTACCGCTATCTTTACAGGT

[0073] ACATCATTCTGTTTGTGATGGTTATCATGCAGGATTGTTTATGAACTCTATTCAGGA

[0074] ATTGTCAGATAGGCCTAATGACTGGCTTTTATAATCGTCTTCAATCTAAAAACCAAA

[0075] AGCGGGCTTGCGAGCCCGCTTTTTTTATTACGTTCCA

[0076] It should be noted that the above examples are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the given examples, those of ordinary skill in the art can modify or make equivalent substitutions to the technical solution of the present invention according to needs, without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A recombinase combination, comprising a single-stranded annealing protein (BiSSAP) and a single-stranded binding protein (SSB).

2. The recombinase combination according to claim 1, characterized in that The single-stranded annealing protein (BiSSAP) includes BiSSAP1-BiSSAP 16 , preferably BiSSAP1, BiSSAP2 and BiSSAP 11 ; Further preferred is BiSSAP1.

3. The recombinase combination according to claim 1, characterized in that The single-stranded binding protein (SSB) includes SSB1-SSB 50 , further preferably SSB9.

4. The recombinase combination according to claim 1, characterized in that The recombinase combination is a combination of BiSSAP1 and SSB9.

5. Use of the recombinase combination according to any one of claims 1 to 4 in homologous recombination of bifidobacteria; further, the bifidobacteria include Bifidobacterium longum and Bifidobacterium animalis; preferably Bifidobacterium longum.

6. An efficient homologous recombination method suitable for Bifidobacterium, characterized in that: The method comprises using the recombinase combination according to any one of claims 1 to 4, thereby improving the efficiency of homologous recombination.

7. The efficient homologous recombination method according to claim 6, characterized in that: The method comprises: designing homology arms, constructing the recombinase combination on an Escherichia coli-Bifidobacterium shuttle vector, and electrotransforming Bifidobacterium to obtain corresponding transformants.

8. The efficient homologous recombination method according to claim 7, characterized in that: The Escherichia coli-Bifidobacterium shuttle vector is a p15A-cm-BBori-cat plasmid, and the nucleotide sequence of the p15A-cm-BBori-cat plasmid is shown in SEQ ID NO.

1.

9. The high-efficiency homologous recombination method according to claim 8, characterized in that: The specific method for constructing the recombinant enzyme combination on the Escherichia coli-Bifidobacterium shuttle vector is as follows: BiSSAP and SSB are constructed on P tac The promoter was co-expressed downstream and then placed on the E. coli-Bifidobacterium shuttle vector to obtain p15A-cm-BBori-cat-Ptac-BiSSAP1-SSB.

10. Use of the recombinase combination according to any one of claims 1 to 4 or the efficient homologous recombination method according to any one of claims 6 to 9 in gene editing of bifidobacteria; further, the bifidobacteria include Bifidobacterium longum and Bifidobacterium animalis; preferably Bifidobacterium longum.