KASP molecular marker related to salt tolerance of sorghum, primer and application of KASP molecular marker

By developing the KASP molecular marker ST1.1 related to sorghum salt tolerance, the molecular mechanism problem of difficult to analyze sorghum salt tolerance traits in the prior art is solved, and early auxiliary prediction and identification of the sorghum seedling stage salt tolerance phenotype is achieved, which improves breeding efficiency and cost-effectiveness.

CN120193119AActive Publication Date: 2025-06-24LIAONING ACAD OF AGRI SCI

Patent Information

Application Number
CN202510441305.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-09
Publication Date
2025-06-24
Estimated Expiration
2045-04-09

AI Technical Summary

Technical Problem

The prior art is difficult to effectively analyze the molecular mechanism of sorghum's salt tolerance traits, resulting in low breeding efficiency and difficulty in quickly cultivating high-quality new varieties.

Method used

A KASP molecular marker ST1.1 related to sorghum salt tolerance was developed, and early auxiliary prediction and identification of the sorghum seedling salt tolerance phenotype was achieved through the design of specific primer sets and KASP genotyping detection.

Benefits of technology

This method can quickly identify potentially high-quality target single plants or large number of offspring, shorten the sorghum breeding cycle, improve breeding efficiency, and reduce detection costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120193119A_ABST
    Figure CN120193119A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular marker development and molecular marker assisted breeding, and particularly discloses a KASP molecular marker related to salt tolerance of sorghum, a primer and application of the KASP molecular marker and the primer, the KASP molecular marker is ST1.1 as shown in SEQ ID NO.1, and the molecular marker has T / C polymorphism at a basic group at 100bp of the sequence as shown in SEQ ID NO.1. The KASP molecular marker ST1.1 provided by the invention is used for identifying the salt tolerance of sorghum, through KASP genetic typing detection, the genotype of a sample with a strong FAM fluorescence signal is T / T, and the sample is a salt-tolerant germplasm; the genotype of the sample with strong HEX fluorescence signal is C / C, and the sample is a salt-sensitive germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical fields of molecular marker development and molecular marker-assisted breeding, and particularly relates to a KASP molecular marker related to sorghum salt tolerance, primers thereof, and applications thereof. Background Art

[0002] Sorghum (Sorghum bicolor L.), as an efficient C4 crop, has become a strategic "pioneer crop" for the development of marginal saline-alkali lands globally due to its outstanding drought tolerance, salt-alkali tolerance, and barren tolerance characteristics. Under saline-alkali stress environments, plants face severe challenges throughout the entire growth period from seed germination to reproductive growth: the seed germination rate is significantly reduced, root development is inhibited, resulting in weakened absorption function, ion homeostasis imbalance triggers metabolic disorders, leaf photosynthetic efficiency decays, accelerating the senescence process, and ultimately manifested as a sharp reduction in biomass and yield loss. It is worth noting that some sweet sorghum varieties exhibit strong adaptability in saline-alkali lands, with a biomass yield per mu reaching 7 tons, providing an important solution for ensuring food security and bioenergy supply. However, there are still obvious shortcomings in current research - the molecular mechanism of salt tolerance traits co-regulated by multi-gene networks has not been clarified, and the excavation and analysis of key functional genes urgently need to be broken through. Although traditional breeding has achieved stage results, limited by the genetic characteristics of complex quantitative traits, it is urgent to combine molecular marker-assisted breeding and genome editing technologies to accelerate the cultivation of new varieties with high resistance and high quality, which has strategic significance for improving the production efficiency of marginal lands and coping with the increasing trend of global soil salinization.

[0003] Molecular marker technology is the core tool for crop genetic improvement. Although the first-generation markers (such as RFLP) and the second-generation markers (such as SSR) have been widely used, they have limitations such as high cost, low throughput, and complex operation. With the rapid popularization of high-throughput sequencing technology, the development efficiency of molecular markers based on single nucleotide polymorphisms (SNPs) has been significantly improved, and their quantity has shown exponential growth. In this context, the third-generation marker KASP (Kompetitive Allele-Specific PCR) has become the mainstream technology for crop molecular breeding due to its advantages of high throughput, low cost, and high accuracy. The KASP technology takes SNP loci as the core detection targets, and through optimizing primer design and fluorescence detection systems, realizes the efficient genotyping of a large number of SNP markers, perfectly meeting the application requirements of high throughput and low cost of molecular markers in the genomics era. Compared with traditional markers, the KASP technology does not require complex electrophoresis equipment, the cost per single reaction is reduced by more than 50%, and it is applicable to the screening of populations on the scale of tens of thousands, with a daily detection throughput reaching the level of tens of thousands of samples, significantly improving the breeding efficiency. It is necessary to develop a KASP molecular marker related to sorghum salt tolerance. Summary of the Invention

[0004] To develop a KASP molecular marker related to sorghum salt tolerance, the present invention provides a KASP molecular marker related to sorghum salt tolerance, primers thereof, and their applications. The KASP molecular marker provided by the present invention can achieve early auxiliary prediction and identification of the salt tolerance phenotype of sorghum seedlings, and can quickly identify potential high-quality target individual plants or a large number of offspring, thereby shortening the sorghum breeding cycle and improving breeding efficiency.

[0005] The present invention provides a KASP molecular marker related to sorghum salt tolerance, and the KASP molecular marker is ST1.1;

[0006] The nucleotide sequence of the molecular marker ST1.1 is shown in SEQ ID NO.1, and the base at the 100bp of the molecular marker ST1.1 has T / C polymorphism.

[0007] The KASP molecular marker ST1.1 provided by the present invention is used to identify sorghum salt tolerance. Through KASP genotyping detection, the genotype of the sample with strong FAM fluorescence signal is T / T, which is a salt-tolerant germplasm; the genotype of the sample with strong HEX fluorescence signal is C / C, which is a salt-sensitive germplasm.

[0008] The present invention also provides a primer set, which is used to amplify the KASP molecular marker, and the primer set includes two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and a universal reverse primer shown in SEQ ID NO.4.

[0009] The present invention also provides a kit, which contains the primer set.

[0010] The present invention also provides a chip, which contains the primer set.

[0011] Furthermore, the primer set is a solid powder or a liquid reagent.

[0012] The present invention also provides a method for identifying sorghum salt-tolerant varieties, including the following steps:

[0013] Extract the DNA of the sorghum to be tested;

[0014] Perform KASP reaction on the extracted DNA of the sorghum to be tested using the primer set or the kit to obtain a reaction product;

[0015] Put the reaction product into a KASP genotyping detection device to read the fluorescence signal, and perform cluster analysis according to the FAM and HEX fluorescence intensities to obtain the genotyping at the polymorphic locus. Among them, the genotype of the sample with strong FAM fluorescence signal is T / T, which is a salt-tolerant germplasm; the genotype of the sample with strong HEX fluorescence signal is C / C, which is a salt-sensitive germplasm.

[0016] The present invention also provides an application of the KASP molecular marker related to sorghum salt tolerance, the primer set or the kit in identifying sorghum salt-tolerant varieties.

[0017] Further, using the DNA of the sorghum to be tested as a template, PCR amplification is carried out with two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and a universal reverse primer shown in SEQ ID NO.4 to obtain a reaction product;

[0018] The reaction product is put into a KASP genotyping detection device for fluorescence signal reading. The determination standard for sorghum salt-tolerant varieties is as follows: when the fluorescence signal of the PCR product is close to the Y-axis representing the HEX fluorescence signal, the genotype is C / C, and it is determined that the sorghum sample to be tested is a salt-sensitive germplasm; when the fluorescence signal of the PCR product is close to the X-axis representing the FAM fluorescence signal, the genotype is T / T, and it is determined that the sorghum sample to be tested is a salt-tolerant germplasm.

[0019] Further, the PCR amplification system includes: 5 μL of 50 ng / μL DNA template, 10 μL of 2×KASP Master mix, 0.2 μL of each of the two upstream primers at 10 μM, 0.6 μL of the downstream primer at 10 μM, and the volume is made up to 20 μL with water.

[0020] Further, the PCR reaction procedure includes: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 62°C for 1 min, for 10 cycles; denaturation at 95°C for 15 s, annealing and extension at 57°C for 1 min, for 32 cycles.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] The KASP molecular marker ST1.1 provided by the present invention is used to identify sorghum salt tolerance. Using the DNA of the sorghum to be tested as a template, PCR amplification is carried out with two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and a universal reverse primer shown in SEQ ID NO.4 to obtain a reaction product; the reaction product is put into a KASP genotyping detection device for fluorescence signal reading. The determination standard for sorghum salt-tolerant varieties is as follows: when the fluorescence signal of the PCR product is close to the Y-axis representing the HEX fluorescence signal, the genotype is C / C, and it is determined that the sorghum sample to be tested is a salt-sensitive germplasm; when the fluorescence signal of the PCR product is close to the X-axis representing the FAM fluorescence signal, the genotype is T / T, and it is determined that the sorghum sample to be tested is a salt-tolerant germplasm

[0023] The present invention only needs to perform PCR amplification on the leaf DNA of salt-tolerant germplasm using the KASP primer set developed by the present invention and detect its fluorescence signal, then it can realize the early auxiliary prediction and identification of the salt tolerance phenotype of sorghum seedlings. This method is simple to operate, economical and practical, and has high screening efficiency, and can quickly identify potential high-quality target individual plants or a large number of offspring, thereby shortening the sorghum breeding cycle and improving the breeding efficiency.

[0024] The KASP molecular marker provided by the present invention, compared with the identification methods of other marker types such as SSR and InDel, only needs to perform PCR for detection, without operations such as sequencing, silver staining, and band reading. It is simple to operate, fast, and has low cost. Brief Description of the Drawings

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0026] Figure 1 It is the correlation analysis between the chlorophyll decline amount and propylene glycol.

[0027] Figure 2 It is the QTL mapping diagram of the F2 population of Bayeqi / PL212.

[0028] Figure 3 It is the genotyping result of the F2 population of Bayeqi / PL212;

[0029] In the figure, a is the genotyping diagram of the KASP molecular marker ST1.1 in 172 sorghum individual plants;

[0030] b is the chlorophyll decline amount of individual plants with different genotypes under salt treatment.

[0031] Figure 4 It is the genotyping result of 70 natural resources;

[0032] In the figure, a is the genotyping diagram of the KASP molecular marker ST1.1 in 70 sorghum individual plants;

[0033] b is the chlorophyll decline amount of individual plants with different genotypes under salt treatment. Detailed Embodiments

[0034] The following is a detailed description of the specific embodiments of the present invention. It should be understood that the protection scope of the present invention is not limited by the specific embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the protection scope of the present invention. In the experimental methods described in the embodiments of the present invention, unless otherwise specified, they are all conventional methods. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0035] Example 1: A KASP molecular marker, primer related to sorghum salt tolerance and its application.

[0036] I. Evaluation method for sorghum seedling salt tolerance

[0037] Select a circular pot with a diameter of 0.50 m and a height of 0.40 m. Fill each pot with 8.00 kg of air-dried soil. Add 4 L of sodium chloride (NaCl) with a concentration of 240 mM to the salt treatment group and 4 L of water to the control group. Add distilled water to adjust the soil moisture content to 28% (weight percentage), and let it stand for 2 hours. After the moist soil dries, sow the seeds.

[0038] Sow 40 sorghum seeds in each pot, and measure the indicators at about the 7-leaf stage, 40 days after sowing.

[0039] Collect the uppermost fully expanded leaves of the surviving plants in each pot. Take 0.5 g of leaf samples, add 95% ethanol, grind, and centrifuge to collect the supernatant. After the precipitate is washed twice with ethanol and centrifuged, the two supernatants are combined and made up to 25 mL. Use a spectrophotometer to measure the absorbance at wavelengths of 470 nm, 663 nm, and 646 nm, and calculate the chlorophyll content according to the Lichtenthaler&Wellburn (1983) formula.

[0040] Based on the absolute value of the percentage reduction in the chlorophyll content of the plants in the salt treatment group compared to the control group, a five-level salt tolerance evaluation standard is established: a reduction rate > 45% is level 5 (salt-sensitive type), 35 - 45% is level 4, 25% - 35% is level 3, 15% - 25% is level 2, and ≤ 15% is level 1 (salt-tolerant type).

[0041] To verify the reliability of the newly constructed salt tolerance evaluation standard, through correlation analysis, it was found that the chlorophyll reduction amount was significantly positively correlated with the salt tolerance identified by malondialdehyde in the traditional method ( Figure 1 ). Therefore, the chlorophyll reduction amount can characterize the salt tolerance of sorghum seedlings. The newly established method is simple and reliable, without the need for kits or multiple reagents, and only requires alcohol and a spectrophotometer to quickly evaluate the salt tolerance of sorghum seedlings.

[0042] II. QTL mapping and determination of molecular markers

[0043] 1. Construction of the population

[0044] Using the salt-tolerant germplasm Bayeqi as the male parent and the salt-sensitive germplasm PL212 as the female parent, and their chlorophyll contents at the seedling stage are close. In 2018, a hybrid combination was configured, and Table 1 shows the process of obtaining the families.

[0045] Table 1 Process of obtaining the families

[0046]

[0047]

[0048] 2. Field experiment and phenotype statistics

[0049] The F2 population was planted in the potted plant field of the Shenyang experimental base in May 2019. The specific planting method refers to the aforementioned planting method, and the phenotype identification method refers to the aforementioned detection and evaluation criteria for the reduction of chlorophyll content.

[0050] 3. QTL mapping

[0051] Based on the five-level salt tolerance evaluation system, the present invention respectively selected extreme phenotype populations (30 progenies with salt tolerance level 1 and 30 progenies with salt tolerance level 5) to construct a salt-tolerant pool and a salt-sensitive pool, and carried out whole-genome resequencing analysis in combination with the parental materials. After sequencing on the Illumina platform and strict quality control, 49.807 Gb of high-quality Clean data was finally obtained. The sequencing data was aligned to the sorghum reference genome Sorghum bicolor v3.1.1 using Burrows-Wheeler Aligner (BWA v0.7.17). The results showed that the average sequencing depth of the two parents reached more than 10×, the coverage of the pools was close to 20×, and the 1× genome coverage of the samples exceeded 90% (Table 2).

[0052] Variant detection was carried out using Genome Analysis Toolkit (GATK v4.2.6.1), and a total of 903,025 single nucleotide polymorphisms (SNPs) and 438,453 insertion-deletion markers (InDels) were identified. Based on the parental homozygous difference screening strategy, 327,929 SNPs and 236,111 InDel polymorphic markers were obtained for subsequent analysis. By calculating the SNP-index and InDel-index of the progeny population between the two parents, the distribution maps of Δ(SNP-index) and Δ(InDel-index) were constructed. After 1000 permutation tests to determine the 95% confidence threshold (P<0.05), the key QTL regulating salt tolerance at the seedling stage was finally mapped to the interval of 26.78-27.26 Mb on chromosome 9, named the ST1 (Salt Tolerance 1) locus ( Figure 2)。

[0053] Table 2 Mapping of QTL

[0054] Sample Number of aligned reads Average depth 1× coverage 4× coverage Bayeqi 52,423,964(97.25%) 10.05 93.33% 85.10% PL212 58,042,182(96.88%) 10.72 96.79% 91.72% Salt-tolerant mixed pool 114,783,898(97.43%) 20.78 99.06% 96.17% Salt-sensitive mixed pool 97,757,509(97.36%) 17.98 98.39% 95.31%

[0055] 4. Marker Development

[0056] Based on the physical location information of the ST1 locus, the variations in the interval were searched using the VCF file. Finally, a SNP variation was found between the two parents at Chr09:26,790,518, which can be used to develop a KASP molecular marker named ST1.1.

[0057] The nucleotide sequence of the molecular marker ST1.1 is shown in SEQ ID NO.1, and the base at the 100bp position of this sequence has T / C polymorphism.

[0058] SEQ ID NO.1:

[0059] CTTGGAATCAGCGCGATCAAGTGCTCGGAGAAGATCCGAGCCGTCGATCTTCTTTCCCTTGTAGCGCGGGAGCGGTGGTCGGGTGCTCGGTGCCAGTATCCATGTGGTCGGAACCGGCGCCGCCGCAGATTGGATCTGGGTTCCTTCCGAAACCGTGGTCGTGAGACCGCCGCCGTGCATCGTCCACGTGATCTGGCCGA, where N represents "T" or "C".

[0060] Among them, when the genotype is TT or TC, sorghum is a salt-tolerant variety; when the genotype is CC, sorghum is a salt-sensitive variety.

[0061] III. Design of Molecular Marker Primer Sets

[0062] The molecular marker primer set consists of a forward primer Ft, a forward primer Fs, and a universal reverse primer R. Among them, the nucleotide sequence of the forward primer Ft is shown in SEQ ID NO.2; the nucleotide sequence of the forward primer Fs is shown in SEQ ID NO.3; the nucleotide sequence of the universal reverse primer R is shown in SEQ ID NO.4. The detailed sequences are shown in Table 3 below.

[0063] Table 3 Design of Molecular Marker Primer Sets

[0064] Primer name Primer sequence Forward primer Ft SEQ ID NO.2: gaaggtgaccaagttcatgctGGTGCTCGGTGCCAGTATT Forward primer Fs SEQ ID NO.3: gaaggtcggagtcaacggattGGTGCTCGGTGCCAGTATC Universal reverse primer R SEQ ID NO.4: AGATCACGTGGACGATGCAC

[0065] Note: The lowercase part is the linker sequence FAM and HEX.

[0066] IV. Correlation Analysis between KASP Fluorescence Detection Results and Salt Tolerance at the Seedling Stage of Sorghum

[0067] S1. At the seedling stage, select individual plants from the F2 population in Table 1, take sorghum germplasm leaf samples about 1 cm in length and width and place them in deep-well plates (96 wells, 2 mL). After freeze-drying, add steel beads and grind at 50 Hz until the samples are completely ground.

[0068] S2. Use the modified CTAB method to extract DNA to obtain genomic DNA of the samples.

[0069] S3. Use the primer set or kit for amplifying ST1.1 to perform PCR amplification on the extracted DNA to obtain PCR amplification products.

[0070] The PCR amplification system includes: 5 μL of 50 ng / μL DNA template, 10 μL of 2×KASP Master mix, 0.2 μL of each of the two upstream primers at 10 μM, 0.6 μL of the downstream primer at 10 μM, and make up the volume to 20 μL with water.

[0071] The PCR reaction program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 62°C for 1 min, 10 cycles; denaturation at 95°C for 15 s, annealing and extension at 57°C for 1 min, 32 cycles.

[0072] S4. Put the PCR reaction products into the KASP genotyping detection equipment to read the fluorescence signals. According to the FAM and HEX fluorescence intensities, perform cluster analysis to obtain the genotyping at the polymorphic loci. Among them, 34 samples are HEX fluorescence, and the genotype can be determined as C / C; 97 samples have comparable HEX and FAM fluorescence, and the genotype is determined as T / C; 41 samples are FAM fluorescence, and the genotype can be determined as T / T. Since the chlorophyll content of the two parents is close at the seedling stage, the method in Example 1 can be used to obtain the difference between the decrease in chlorophyll content per individual plant after salt treatment and the untreated parent. Through one-way ANOVA, it is found that the decrease in chlorophyll content of the materials carrying the T / T genotype is significantly lower than that of the materials carrying the T / C genotype, and the decrease in chlorophyll content of the materials carrying the T / C genotype is significantly lower than that of the CC genotype ( Figure 3 ), so the salt tolerance of the materials with the TT genotype is stronger than that of the T / C and C / C genotypes. It shows that the KASP primer set of the present invention is specific for the salt tolerance phenotype of sorghum.

[0073] V. Genotype Identification of Sorghum Natural Resources Using Molecular Markers

[0074] The genotypes of more than 70 sorghum natural germplasm resources were detected using the molecular marker ST1.1, and the decrease in chlorophyll content in sorghum leaves under salt stress was detected. The genotype results of more than 70 sorghum natural germplasm resources are shown in Table 4.

[0075] Table 4 Genotypes of More than 70 Natural Sorghum Germplasms

[0076]

[0077]

[0078] The results are as Figure 4 shown. According to the fluorescence intensities of FAM and HEX, cluster analysis was performed to obtain the genotyping at polymorphic loci. Among them, 35 samples had HEX fluorescence and the genotype could be determined as C / C; 3 samples had comparable HEX and FAM fluorescence, and the genotype was determined as T / C; 41 samples had FAM fluorescence and the genotype could be determined as T / T. Through one-way ANOVA, it was found that the chlorophyll decline of the materials carrying the T / T genotype was significantly lower than that of the materials carrying the C / C genotype. Therefore, the salt tolerance of the T / T genotype was significantly higher than that of the C / C genotype ( Figure 4 ). Since all the materials used were bagged and self-crossed, there were only 3 heterozygous materials at this locus, and there might be deviations in the statistics of salt tolerance traits, so they were not included in the statistics. In summary, ST1.1 is not only applicable to the offspring of Bayeqi / PL212, but also can be directly used for salt tolerance detection of natural sorghum populations, has universality, and can be widely used for screening salt-tolerant materials.

[0079] It should be noted that all sorghum germplasms in the present invention are provided by the Germplasm Resource Bank of the Sorghum Research Institute, Liaoning Academy of Agricultural Sciences.

[0080] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they know the basic creative concept.

[0081] Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and deformations.

Claims

1. A KASP molecular marker related to salt tolerance in sorghum, characterized in that: The KASP molecule is labeled as ST1.1; The nucleotide sequence of the molecular marker ST1.1 is shown in SEQ ID NO.

1. The base at 100 bp of the molecular marker ST1.1 has a T / C polymorphism.

2. A primer set, characterized in that: The primer set is used to amplify the KASP molecular marker described in claim 1, and the primer set includes two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and a universal reverse primer shown in SEQ ID NO.

4.

3. A kit, characterized in that: Comprising the primer set of claim 2.

4. A chip, characterized in that: Comprising the primer set of claim 2.

5. The kit according to claim 3 or the chip according to claim 4, characterized in that: The primer set is a solid powder or a liquid reagent.

6. A method for identifying salt-tolerant sorghum varieties, characterized in that: The following steps are involved: Extract the sorghum DNA to be tested; Using the primer set described in claim 2 or the kit described in claim 3 to perform a KASP reaction on the extracted sorghum DNA to be tested, to obtain a reaction product; The reaction product was placed in the KASP genotyping detection equipment for fluorescence signal reading. Cluster analysis was performed based on the FAM and HEX fluorescence intensities to obtain the genotyping at the polymorphic site. The genotype of the sample with a strong FAM fluorescence signal was T / T, which was a salt-tolerant germplasm; the genotype of the sample with a strong HEX fluorescence signal was C / C, which was a salt-sensitive germplasm.

7. Use of the KASP molecular marker associated with sorghum salt tolerance according to claim 1, the primer set according to claim 2 or the kit according to claim 3 in identifying sorghum salt-tolerant varieties.

8. The use according to claim 7, characterized in that: Using the sorghum DNA to be tested as a template, two specific forward primers shown in SEQ ID NO.2 to SEQ ID NO.3 and a universal reverse primer shown in SEQ ID NO.4 were used to perform PCR amplification to obtain a reaction product; The reaction product was placed in the KASP genotyping detection equipment for fluorescence signal reading. The criteria for determining the salt-tolerant sorghum variety were as follows: when the fluorescence signal of the PCR product was close to the Y-axis representing the HEX fluorescence signal, the genotype was C / C, and the sorghum sample to be tested was determined to be a salt-sensitive germplasm; when the fluorescence signal of the PCR product was close to the X-axis representing the FAM fluorescence signal, the genotype was T / T, and the sorghum sample to be tested was determined to be a salt-tolerant germplasm.

9. The use according to claim 8, characterized in that: The PCR amplification system included: 5 μL of 50 ng / μL DNA template, 10 μL of 2×KASP Master mix, 0.2 μL of each of two 10 μM upstream primers, 0.6 μL of 10 μM downstream primer, and water was added to 20 μL.

10. The use according to claim 8, characterized in that: The PCR reaction program included: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 62°C for 1 min, 10 cycles; denaturation at 95°C for 15 s, annealing and extension at 57°C for 1 min, 32 cycles.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker of sorghum SbDW3 gene and application

    CN115820914A

  • CAPS molecular marker for identifying sorghum leaf sheath color, primer and application

    CN117144048A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to salt tolerance of sorghum and application of SNP molecular marker

    CN118028518A

Cited By

  • KASP molecular marker related to drought resistance of sorghum, primer and application of KASP molecular marker

    CN120905436A