G8P [8] type A rotavirus CZ-23 and application thereof

By providing G8P[8] Group A rotavirus CZ-23, the problem of insufficient protection effect of existing vaccines on new rotavirus strains is solved, and the purpose of providing new vaccine strains for rotavirus vaccine development and evaluating the immunity effect of existing vaccines is achieved.

CN120210133AActive Publication Date: 2025-06-27STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510704296.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-06-27
Estimated Expiration
2045-05-29

AI Technical Summary

Technical Problem

The existing rotavirus vaccines have insufficient protective effect on the new rotavirus strain, which has led to the challenge of the protective effect of the vaccine. More types of human rotavirus strains are needed to support the development of the vaccine.

Method used

A strain of G8P[8] Group A rotavirus CZ-23 is provided. This strain has good genetic stability and is used to evaluate the immune effect of existing vaccines and to provide a new vaccine strain for the development of rotavirus vaccines.

Benefits of technology

This strain can be used to develop an attenuated rotavirus oral vaccine to improve the protective effect of the vaccine, is suitable for evaluating the immune effect of existing vaccines, and provides genetic materials for new vaccine strains.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210133A_ABST
    Figure CN120210133A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of rotaviruses, in particular to a G8P [8] type group A rotavirus CZ-23 and application thereof. The invention relates to a G8P [8] type group A rotavirus CZ-23, which is preserved in China General Microbiological Culture Collection Center (CGMCC) on April 11, 2023, and the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the preservation number is CGMCC (China General Microbiological Culture Collection Center) The invention provides a novel human rotavirus wild strain which is reported and separated for the first time in China, and the strain is strong in virus replication capability and good in hereditary stability, can be applied to development of vaccine strains of human rotavirus vaccines, and is suitable for attenuated rotavirus oral vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of rotavirus, and in particular to a group A rotavirus CZ-23 of G8P[8] type and its application. Background Art

[0002] Rotavirus is an unenveloped double-stranded RNA virus. Its genome consists of 11 segments of double-stranded RNA wrapped by three concentric capsid proteins, encoding six structural proteins (VP1, VP2, VP3, VP4, VP6, and VP7) and six non-structural proteins (NSP1, NSP2, NSP3, NSP4, NSP5, and NSP6) respectively. According to the VP6 gene sequence and antigenic differences, rotavirus is divided into 10 groups (A-J), among which group A rotavirus (RVA) is one of the main pathogens causing acute gastroenteritis in infants and young children under 5 years old.

[0003] So far, there is no specific therapeutic drug for rotavirus gastroenteritis (RVGE). Clinical treatment mainly relies on supportive treatment, and vaccination with RVA vaccine has become the most effective measure to reduce the incidence of RVGE. Currently, the 6 main rotavirus vaccines used globally have good protective effects against the currently prevalent strains. With the widespread use of vaccines, the selection pressure of vaccines on rotavirus strains has led to a downward trend in the prevalence of traditional prevalent strains. At the same time, natural reassortment between viruses has led to the continuous emergence of new rotavirus strains and an upward trend in the prevalence in some regions. This poses a huge challenge to the protective effect of vaccines. Therefore, how to provide more types of human rotavirus strains in order to provide more virus sources for the preparation of rotavirus vaccines is an urgent problem for those skilled in the art. Summary of the Invention

[0004] The present invention provides a novel human rotavirus strain, which has good genetic stability, can be used to evaluate the immune effect of existing vaccines against it, and provide new vaccine strains for the development of rotavirus vaccines.

[0005] In order to achieve the above invention objectives, the present invention provides the following technical solutions: The present invention provides a group A rotavirus CZ-23 of G8P[8] type, which was deposited on April 11, 2023 at the China General Microbiological Culture Collection Center (CGMCC), with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit number is CGMCC NO. 45559.

[0006] Preferably, the G8P[8] type group A rotavirus CZ-23 encodes six structural proteins: VP1, VP2, VP3, VP4, VP6 and VP7, and six non-structural proteins: NSP1, NSP2, NSP3, NSP4, NSP5 and NSP6, and the nucleotide sequences are as shown in SEQ ID NO. 1-11.

[0007] VP1 VP2 VP3 VP4 VP6 VP7 TGTATGGTATTGAATATACCCCAACTCTAATCTTCTTGATATTGCTTGTATTATTAAATTATATACTAAAATCAATAACTCGAATTATGGACTATATACTCTACAGATTTTTGTTGTTTATTGTAATTATTACGCCATTTGTAAATTCACAGAACTATGGCATAAATTTACCAATTACTGGATCTATGGACGCAAACTACCAGAACGTATCGACTTCAGAACCATTTCTAACATCAACATTATGTCTTTATTATCCAACAGAGGCTGAAACAGAGATTGCTGACAGTTCATGGAAAGATACGCTATCACAGTTATTTTTAACAAAAGGGTGGCCAACTGGTTCTGTTTATCTTAGAAGCTACACAGATATTTCAACTTTTTCAATAAATCCTCAGTTGTATTGCGATTACAACATAGTTCTAATGAAATATAACGCCGATTCGGAACTAGATATGTCAGAGTTAGCAGACTTGATACTCAATGAATGGCTATGTAATCCAATGGATATAACGTTGTACTATTATCAGCAGACGGATGAAACAAATAAATGGATATCAATGGGAGATTCGTGTACTATTAAAGTGTGTCCATTAAATACGCAGACATTAGGCATTGGATGTCTCACCACTGACACTACGACTTTTGAAGAAGTTGCGACAGCAGAAAAATTAGCAATAACGGATGTTGTTGATGGGGTGAACTACAAAATAAATGTTACTACTACTACATGTACAATTAGAAACTGTAAAAAACTGGGACCTAGAGAGAATGTTGCAGTCATCCAAGTAGGTGGTTCAAACATTTTAGATATTACAGCAGATCCTACGACAGCACCACAAACTGAAAGAATGATGAGAGTTAATTGGAAAAAATGGTGGCAAGTTTTCTATACTGTTGTTGATTATGTAAATCAAATAATTCAAGCAATGTCCAAAAGATCGCGAT NSP1 NSP2 GGCTGAGCTAGCTTGCTTTTGCTATCCCCATTTGGAGAACGATAGCTATAGATTTATTCCTTTTAACAATTTGGCTATAAAATGTATGTTGACAGCAAAAGTAGAGAAAAAAGATCAAGATAAATTTTACAACTCGATAATCTATGGTATTGCGCCGCCACCACAATTTAAAAAACGCTATAATACAAATGATAATTCAAGAGGAATGAATTATGAGACTGCAATGTTTAACAAGGTGGCGGTGCTAATTTGTGAAGCATTGAATTCAATTAAAGTCACACAGTCTGATGTTGCAAGTGTACTTTCAAGAGTAGTTTCTGTGAGACATCTTGAGAATTTAGTATTAAGAAGAGAAAATCATCAGGACGTTCTTTTTCACTCAAAGGAATTACTACTCAAATCAGTTTTAATAGCTATTGGTCATTCAAAAGAGATTGAAACAACTGCCACTGCTGAAGGGGGAGAAATCGTTTTTCAAAATGCAGCATTTACAATGTGGAAATTGACATACTTAGAACATAAACTAATGCCAATTCTTGATCAAAACTTCATTGAATATAAAATTACAGTAAATGAAGATAAACCGATTTCAGAGTCACACGTAAAAGAACTTATTGCTGAATTACGGTGGCAATACAATAAATTTGCAGTAATTACGCATGGTAAAGGTCACTATAGAGTTGTAAAATACTCGTCAGTTGCAAATCATGCAGACAGAGTTTATGCTACTTTTAAGAGTAATAACAAAAACGGAGGTTCACTGGAGTTTAATTTGCTTGATCAGAGAATAATATGGCAAAATTGGTACGCATTTACGTCTTCAATGAAACAAGGTAATACTCTTGATGTGTGCAAAAAACTACTTTTCCAAAAATGAAGCGAGAAAGCAATCCATTTAAGGGGCTGTCAACTGATAGAAAAATGGATGAAGTTTCTCAAGTAGGAATCTAGTTCG NSP3 GGCATCTTCTATTATTAACTCTTCTTTTGAAGCTGCAGTTGTCGCTGCAACTTCTACATTGGAATTAATGGGTATTCAATATGATTATAATGAAGTATATACTAGAGTTAAAAGTAAGTTTGATTTTGTAATGGATGATTCTGGTGTTAAGAATAATTTAATAGGTAAGGCAGTTACAATTGATCAGGCTTTGAATGGTAAGTTTAGTTCATCTATTAGAAATAGAAATTGGATGACTGATTCAAAAACTGTAGCAAGATTAGATGAAGATGTGAATAAACTTAGATTATTATTGTCATCGAAAGGAATTGATCAAAAAATGAGAGTTCTTAATGCATGCTTTAGTGTTAAGAGAATACCTGGAAAATCGTCATCTATCATTAAATGTACTAGGTTAATGAAAGAAAAAATAGAACGTGGAGAAGTCGAAGTAGATGATACATTCATTGAAGAAAAAATGGAAATTGATACTATAGATTGGAAATCCAGATATGATCAGCTTGAAAGACGATTTGAGTCGTTAAAACAGCGAGTTAATGAAAAGTATAATAATTGGGTTATTAAGGCAAGGAAAGTAAACGAAAACATGAACTCTCTTCAGAATGTTATTTCACAACAGCAAGCTCATATCAATGAATTACAAATATATAATAATAAACTAGAGCGTGATTTACAATCAAAAATAGGATCAGTTGTTTCATCCATTGAATGGTACTTAAGGTCTATGGAACTATCAGATGACATTAAATCAGATATTGAACAACAACTCAATTCAATAGATCATATTAATCCAGCTAATGCTTTCGATGATTTCGAATCTATTCTTCGTAATTTAATATCTGATTATGATAGAATTTTTATTATGTTTAAAGGATTGTTGCAGCAAAGTAATTACACTTATACTTATGAATAGACATAGCATATTACCATCTTCACGTAACCCTCTATGAGCACAATAGTTAAAAGC NSP4 GAGAGAGCGCGTGCGGAAAGATGGAAAAGCTTACCGACCTCAACTACACATTGAGTGTAATCACTCTAATGAACAGTACACTACATACAATACTGGAGGATCCAGGGATGGCGTATTTTCCCTATATTGCATCTGTCCTAACGGTTTTGTTCACATTGCATAAAGCATCAATTCCAACAATGAAAATAGCGTTGAAAACGTCAAAATGTTCGTATAAAGTAATAAAGTATTGTGTTGTAACAATTTTTAACACGTTACTGAAACTAGCAGGTTATAAAGAGCAGATAACTACTAAAGATGAAATAGAAAAACAAATGGACAGAGTCGTTAAAGAAATGAGACGTCAATTGGAAATGATTGATAAACTGACTACACGTGAAATCGAGCAAGTAGAGCTACTTAAACGTATATATGATAAATTGATGGTGCAATCAATTGGCGAGATAGATATGACGAAAGAAATTAATCAAAAGAACGTGAAAACGCTAGAAGAATGGGAAAGTGGAAGAAATCCTTATGAACCGAAAGAAGTGACTGCAGCAATGTAAGAGGTTGAGCTGCCGTCGACTGTCTTCGGAAGCGGCGGAGTTCTTCACAGTAAGCCCCATCGGACCTGATGGCTGGCTGAGAAGCCACAGTCAGCCATATCGCGTGTGGCTCAAGCCTTAATCCCGTTTAACCAATCCGGTCAGCACCGGA NSP5 / 6 TATTGATGTGACTAGTCTTCCTTCAATTTCTTCTAGTGTTTATAAAAATGAATCGTTTTCAACAACGTCAACTATTTCTGGAAAATCTATTGGTAGGAGTGAACAGTACATTTCACCAGATGCAGAAGCTTTCAATAAGTACATGTTATCAAAATCTCCAGAAGATATTGGACCTTCTGATTCTGCATCGAACGATCCACTCACCAGCTTTTCGATTAGATCGAATGCAGTTAAGACAAATGCAGATGCTGGCGTGTCTATGGATTCATCAGCACAATCACGACCATCTAGCGACATTGGATACGATCAAATGGATTTCTCCTTAAGTAAAGGTATTAAAATTGATGCTACAATGGATTCCTCAATATCAATATCCACTACATCAAAGAAGGAGAAATCTAAACAAGAGAACAAAAATAAATATAAAAAATGTTATCCAAAAATTGAAGCAGAATCTGATTCTGATGAATACGTATTAGATGATTCAGATAGTGATGATGGAAAATGTAAAAATTGCAAGTATAAAAAGAAATATTTTGCACTTCGTTTAAGAATGAAACAGGTTGCAATGCAATTGATTAAAGATTTGTGAAAATTTTCTGATTACTCTTATTATTAACTGTTAAATATTTACTTAATGTACGGATGATAAATGTTGTTTAATTATATTATATAATAAGATTACTATGTCGAGTTATTGAATTTAACAACTTTTTAACGAGAGAAGATTAATGCGTCTACCCTAAGA The present invention also provides the use of the G8P[8] group A rotavirus CZ-23 as described above in the preparation of a rotavirus vaccine.

[0008] The present invention also provides a rotavirus vaccine comprising the G8P[8] group A rotavirus CZ-23 as described above.

[0009] Preferably, the G8P[8] group A rotavirus CZ-23 is attenuated.

[0010] The present invention also provides the use of a reagent for detecting the G8P[8] group A rotavirus CZ-23 as described above in the preparation of a rotavirus detection reagent.

[0011] The present invention also provides a detection reagent, including a reagent for detecting the G8P[8] group A rotavirus CZ-23.

[0012] The present invention also provides a method for isolating and culturing the G8P[8] group A rotavirus CZ-23, including the following steps: (1) Obtaining a virus sample infected with rotavirus; (2) Using trypsin-EDTA to digest MA104 cells that have formed a monolayer. After the cells are digested into single cells, resuspend the cells with DEME-10% FBS, dilute to (3-4)×10 5 cells / ml, inoculate into a roller tube at (6-7)×10 5 cells / tube, and obtain a monolayer of MA104 cells after culturing for 1-2 days; (3) Mix the dilution of the virus sample obtained in step (1), trypsin and CaCl2, activate for 1.5-2 h, inoculate onto the monolayer of MA104 cells obtained in step (2), adsorb for 2-3 h, then add trypsin-free serum DMEM cell maintenance fluid, culture until MA104 cell lesions occur, harvest the culture and continue to inoculate onto MA104 cells for passage or freeze for later use in the same method.

[0013] Preferably, the method for obtaining the virus sample in step (1) is: collecting the diarrhea excrement specimens of diarrheal patients' young children, resuspending in a solution of 0.01-0.02 M PBS, pH 7.2-7.4, centrifuging at 13000-14000 g for 10-12 min to take the supernatant, and filtering through a 0.22 μm filter to remove bacteria to obtain a virus sample infected with rotavirus.

[0014] Preferably, during the operation processes of steps (2) and (3), the environmental temperature needs to be maintained at 36-38°C; the volume concentration of the trypsin is 0.23-0.27%; the ratio of the dilution of the virus sample, trypsin and CaCl2 in step (2) is 200-240 μl: 1.2-1.4 μl: 0.4-0.6 μl.

[0015] The present invention provides a newly discovered human-derived rotavirus wild-type strain, which is the first reported isolation in China. This strain has strong virus replication ability and good genetic stability, and can be applied to develop a vaccine strain for human rotavirus vaccine, including attenuated rotavirus oral vaccine. Description of the Drawings

[0016] Figure 1Microscopic photograph (×40) of CPE produced by CZ-23 strain in MA104 cells; (A: MA104 cells 3 days after inoculation with the 7th generation strain, with CPE within the red square; B: normal MA104 cells).

[0017] Figure 2 Colloidal gold detection results of the 1st to 10th generations of CZ-23 strain on MA104 cells.

[0018] Figure 3 Mycoplasma detection results of cells and different generations of CZ-23 strain.

[0019] Figure 4 Genomic nucleic acid band patterns of different generations of CZ-23 strain; (P0: stock solution of G8P[8] type RVA fecal specimen; P3, P5, P8, P10: genomic nucleic acid band patterns of CZ-23 strain).

[0020] Figure 5 Graph of plaque growth of CZ-23 strain.

[0021] Figure 6 RT-PCR rapid genotyping results of the purified strain.

[0022] Figure 7 Detection of MAl04 cells infected with CZ-23 strain by indirect immunofluorescence assay (40×); (A: 10 -1 ; B: 10 -2 ; C: 10 -3 ; D: 10 -4 ; E: 10 -5 ; F: uninfected MA104 cells).

[0023] Figure 8 Electron micrograph of CZ-23 strain; (A: 100 nm; B: 200 nm).

[0024] Figure 9 Growth kinetic curves of CZ-23 strain on MA104 cells before and after purification.

[0025] Figure 10 Phylogenetic trees of VP7 gene of the original specimen and different generations of CZ-23 strain; (the original specimen is marked with a solid triangle; different generations of CZ-23 strain: CZ-23-P2, CZ-23-P9, CZ-23-P16, CZ-23-P23 are marked with solid squares; the vaccine strain is marked with a solid circle; Bootstrap is the confidence level for 1000 cycles, the same below).

[0026] Figure 11 Phylogenetic trees of VP4 gene of the original specimen and different generations of CZ-23 strain.

[0027] Figure 12 It is the phylogenetic tree of the VP1 gene of the original specimen and CZ-23 strains of different passages.

[0028] Figure 13 It is the phylogenetic tree of the VP2 gene of the original specimen and CZ-23 strains of different passages.

[0029] Figure 14 It is the phylogenetic tree of the VP3 gene of the original specimen and CZ-23 strains of different passages.

[0030] Figure 15 It is the phylogenetic tree of the VP6 gene of the original specimen and CZ-23 strains of different passages.

[0031] Figure 16 It is the phylogenetic tree of the NSP1 gene of the original specimen and CZ-23 strains of different passages.

[0032] Figure 17 It is the phylogenetic tree of the NSP2 gene of the original specimen and CZ-23 strains of different passages.

[0033] Figure 18 It is the phylogenetic tree of the NSP3 gene of the original specimen and CZ-23 strains of different passages.

[0034] Figure 19 It is the phylogenetic tree of the NSP4 gene of the original specimen and CZ-23 strains of different passages.

[0035] Figure 20 It is the phylogenetic tree of the NSP5 / 6 gene of the original specimen and CZ-23 strains of different passages.

[0036] Biological deposit description The biological material G8P[8] group A rotavirus CZ-23 involved in the present invention was deposited on April 11, 2023 at the China General Microbiological Culture Collection Center (CGMCC), with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit number is CGMCC NO. 45559. Detailed implementation manners

[0037] Example 1

[0038] 1. Isolation method of CZ-23 strain: (1) Obtaining virus samples Select a G8P[8] rotavirus-positive specimen from a hospitalized child under 5 years old with acute gastroenteritis in a certain hospital in Chenzhou City, Hunan Province, stored at the Institute of Viral Diseases, Chinese Center for Disease Control and Prevention. Prepare the fecal sample into a 10% fecal suspension with phosphate buffer solution (PBS, 0.01 mol / L, PH: 7.4), centrifuge at 2500×g for 5 min, take the supernatant and filter it through a 0.22 μm filter membrane to obtain the specimen, aliquot it into EP tubes, and store it at -80 °C for later use.

[0039] (2) Adaptation and culture of CZ-23 strain in MA104 cells Digest the MA104 cells in good growth state with 0.25% Trypsin-EDTA. Resuspend and dilute the digested cells with DEME-10% FBS to 3×10 5 cells / ml, inoculate into tubes at 6×10 5 cells / tube, place in an incubator at 37 °C and 5% CO2 for 24 h. After the cells cover the monolayer, wash them twice with DMEM and add 2 ml of DMEM, and incubate them in a CO2 incubator for 1.5 h for starvation for later use; take 200 μl of the specimen processed in step (1) and add 0.25% trypsin stock solution to maintain its final concentration at 15 μg / ml, and add CaCl2 with a concentration of 300 g / L (the ratio of the specimen, trypsin (trypsin concentration is 0.25%, here trypsin is Gibco, catalog number 15050-065, 0.25% Trypsin) and CaCl2 is 200 μl: 1.2 μl: 0.4 μl), water bath at 37 °C for 60 min; add the activated virus solution to the cultured cells, adsorb at 37 °C for 2 h; discard the supernatant containing the virus, wash the cells three times with PBS, supplement with serum-free DMEM medium maintenance solution (containing 20 μg / ml of trypsin), place in an incubator at 37 °C and 5% CO2, and observe the cytopathic effect of the cells daily. After obvious cytopathic effect appears after 4 d ( Figure 1 ), harvest the virus solution and continue to passage, Figure 2 shows the RVA colloidal gold detection results of the 1st to 10th generations after the CZ-23 strain is cultured and the virus is harvested on MAl04 cells, indicating the stability of its passage.

[0040] The colloidal gold test was performed on the 1st to 3rd passages of MA104 cells after virus inoculation and virus harvest, and the results were all positive. The colloidal gold test results for the 4th to 6th passages after virus inoculation showed weak positivity, and almost no positive bands were observed with the naked eye. After blind passage to the 7th passage, the virus inoculation test results showed that the bands were significantly brighter, and obvious cytopathic effects (CPE) occurred after MA104 cells were inoculated with the virus. Moreover, the time of cell lesion and cell fragmentation was significantly earlier than that in the 3rd to 6th passages. The earlier occurrence of the colloidal gold test results and CPE indicates that the adaptability of RVA to MA104 cells has increased, and RVA can replicate in large quantities in MA104 cells, leading to obvious CPE in MA104 cells.

[0041] Mycoplasma contamination is the most common problem in cell experiments. To ensure the reliability and stability of cell experiments and avoid the influence of mycoplasma contamination on experimental results, mycoplasma detection was performed on MA104 cells and the 3rd, 6th, and 9th generations of the virus strain. A mycoplasma detection kit was used for mycoplasma detection, and the specific operation steps are as follows: (1)Sample preparation: After culturing cells and virus for 3 days, take 40 μL of cell or virus culture medium and place it in a clean PCR tube. Heat-treat it at 95 °C for 10 min in a PCR instrument and use it as a PCR template.

[0042] (2)System configuration: Table 1 PCR reaction system

[0043] Set up negative control (MycoFree Water) and positive control (Myco Positive Control Template), and operate strictly to prevent exogenous mycoplasma contamination.

[0044] (3)Reaction program: Table 2 PCR reaction program

[0045] (4)Gel electrophoresis: Take 10 μL of PCR product and perform electrophoresis on a 1.5% agarose gel to detect the PCR results. The size of the positive band is approximately 350 bp.

[0046] Results: Mycoplasma detection was performed on MA104 cells and the 3rd, 6th, and 9th generations of the virus. Except for the obvious band in the positive control, no obvious bands were observed in the others, indicating that the cells and virus were not contaminated with mycoplasma, and the experimental results were reliable (see Figure 3 ).

[0047] 2. Identification of CZ-23 strain (1)RT-PCR typing identification of CZ-23 strain The universal primers in the "National Viral Diarrhea Surveillance Program (2021 Edition)" were used to amplify VP7 / VP4 of the strain, and the sequencing was sent to Beijing Qingke Biotechnology Co., Ltd. The RVA genotype was identified through NCBI, and it was identified as G8 genotype RVA.

[0048] (2)Polyacrylamide gel electrophoresis was used to detect the nucleic acid band pattern of CZ-23 strain Take 200 μL of virus fluids of different passages of CZ-23 strain, as well as virus fluids of RRV, SA11, and G4P[6] type RVA respectively. Use the Biospin Virus RNA Extraction Kit (BioFlux) to extract viral RNA. Prepare polyacrylamide gel according to the standard. Mix the extracted RNA samples with 10×Loading Buffe at a ratio of 9:1 and add them to each well. Electrophorese at 90 V for 8 h at room temperature. Use the Nucleic Acid Rapid Silver Staining Kit (Zhongke Ta Rui, product number: RTS5101) to stain the PAGE gel, and use Tanon-4800Multi to take pictures. Compare and analyze the nucleic acid band pattern characteristics to judge genetic stability.

[0049] Results: RVA is a dsRNA virus, and its genome is composed of 11 segments. The typical characteristics of the dsRNA-PAGE electrophoresis pattern of CZ-23 strain are 4:2:3:2 ( Figure 4 ). There were no obvious differences in the genomic band patterns between the G8P[8] type RVA specimen (P8) and different passages of CZ-23 strain, indicating that CZ-23 strain maintained good genetic stability during the adaptation culture process on MAl04 cells. The genomic band pattern of CZ-23 strain was significantly different from that of RRV, SA11, and G4P[6] strains, and it had a short RNA electrophoretic type.

[0050] (3)Plaque purification of CZ-23 strain The plaque culture operation method is as follows: 1) Seed MA104 cells in a 6-well plate at a density of 3×10 5 cells / mL, add 2000 μL of cell suspension to each well, and culture in an incubator at 37℃ and 5% CO2 for 2 days before inoculating the virus.

[0051] 2) Before virus inoculation, aspirate the culture medium in the cell wells, wash MA104-03 once with DMEM, replace it with DMEM, and incubate at 37℃ for 1 h.

[0052] 3) After centrifugation, aspirate the supernatant of each venom sample, aliquot 1000 μL of the sample solution for virus inoculation. Add 6 μL of DT (trypsin) and 2 μL of CaCl2 to every 1000 μL of venom, and incubate in a water bath at 37℃ for 1 h.

[0053] 4) Preparation of 2% low melting point agarose: Accurately weigh 2.0 g of low melting point agarose powder, add it into a sterile conical flask after autoclaving, and quantitatively add 100 mL of ultrapure water; autoclave for 2 hours.

[0054] 5) After the time is up, dilute the activated virus according to the gradient, and the dilution gradient is 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , aspirate the DMEM in each well (leave 100-200 μL of DMEM in each well), slowly add 200 μL of venom sample to each well, and incubate at 37°C for 2 h (shake gently every 20 min, for a total of 3 times).

[0055] 6) Prepare the first layer of low-melting-point agarose gel before the end of the adsorption time: 8 mL of 2% low-melting-point agarose; 8 mL of MEM (2×); 64 μL of 0.25% EDTA-free trypsin.

[0056] 7) Aspirate the sample solution in each well, then spread 1 mL of the prepared low-melting-point agarose solution on each well, and shake the solution crosswise to ensure that the liquid surface is flat after the low-melting-point agarose solution solidifies.

[0057] 8) After the low-melting-point agarose gel solidifies, turn the 6-well plate over to prevent water droplets from flowing on the agar surface to prevent cross-fusion of plaques. Then culture the 6-well plate in an incubator and observe the virus growth in the 6-well plate after 24 hours.

[0058] 9) After 5 days, it was observed that some cells had CPE, and they were covered with the upper layer of glue; 10) Prepare the upper layer of low melting point agarose gel: 8 mL of 2% low melting point agarose.

[0059] 11) Then spread 1 mL of the prepared upper layer of low-melting-point agarose solution in each well and shake it crosswise to ensure that the liquid surface is flat after the low-melting-point agarose solution solidifies.

[0060] 12) After the upper layer of low-melting-point agarose gel solidifies, flip the 6-well plate over and begin observing the plaques after 24 hours.

[0061] 13) After staining the living cells, mark the plaques with a black marker pen, use a sterile pipette tip after high pressure to pick out the larger unstained plaques, put them into an EP tube, add 200μL DMEM, use the pipette tip to fully mix the plaques and DMEM, shake, freeze and thaw repeatedly at "-80℃~room temperature" for 4 times, and centrifuge.

[0062] 14) Collect the supernatant. After completion, aspirate the supernatant, filter it through a 0.22-μm filter membrane, and dispense it into 1.5-mL EP tubes. Then, inoculate and culture the processed venom.

[0063] 15) Perform RT-PCR rapid genotyping on the supernatant obtained after virus amplification to identify the type of the virus strain.

[0064] Results: Obvious CPE could be observed for the CZ-23 virus strain within 72 h. The low-melting-point agarose gel fixed the plaques produced by the virus strain within a certain area, and 10 -1 ~10 -6 plaques were observed. As the concentration decreased with the increase of the dilution factor, the size and number of the plaques produced by the virus gradually decreased ( Figure 5 ). For the rapidly genotyped purified virus strain, through agarose gel electrophoresis, a G8-type specific fragment with a size of 754 bp was visible, and no other G-type specific fragments were seen; a P8-type specific fragment with a size of 224 bp was visible, and no other P-type specific fragments were seen. See Figure 6 . It was determined that the genotype of the purified virus strain was G8P[8].

[0065] (4) Determination of the virus titer of the CZ-23 strain Dilute the activated virus in a 10-fold gradient. Take 100 μL of the venom sample and add it to MA104 cells seeded in a 96-well plate at a density of 3×10 5 cells / mL. Incubate at 37 °C for 2 h. After 2 h, aspirate the venom, wash the 96-well plate twice with 100 μL / well of PBS, and then add a maintenance solution with a final concentration of 10 μg / mL of trypsin without EDTA (add 4 μL of 0.25% Trypsin to every 1 mL of DMEM) to the 96-well plate. Then, place the 96-well plate in an incubator at 37 °C and 5% CO2 for culture. Observe the virus growth after 24 h. The result determination criterion is: finding CPE in one replicate well is recorded as positive. The proportion of positive wells among 10 replicate wells at each dilution is expressed as a percentage. According to the Reed-Muench formula, calculate the TCID50 value using the two adjacent dilutions with a positive rate higher than 50% and lower than 50%. The calculation formula is as follows: Ratio distance = A - 50% / A - B LogTCID50 = log dilution of A + (ratio distance × log dilution factor) A: Positive rate higher than 50%; B: Positive rate lower than 50% Results: The CZ-23 strain can be stably cultured in MA104 cells. After continuous passage of the CZ-23 strain in MA104 for 10 generations, the titer of the CZ-23 strain reaches 7.2 LogTCID50 / mL. After purification and passage, the titer of the CZ-23 strain reaches 7.5 LogTCID50 / mL. It can be found that the virus titer and infectivity of the CZ-23 strain gradually increase during passage in MA104 cells and maintain a relatively high titer level.

[0066] IFA identification of CZ-23 strain Inoculate MA104 cells at 3×10 5 cells / ml on a 96-well plate and infect with the virus after 1 day. Discard the culture medium after 3 days and wash the cells three times with sterile PBS; add 100 μl of pre-cooled 4% tissue cell fixative to each well for fixation, and wash the cells three times with PBS; incubate the cells with 0.2% Triton X-100 for 15 min to make them permeable, and wash the cells three times with PBS; add 100 μl of rabbit anti-VP6 antibody and incubate at 37 °C for 1 h, wash three times with PBST and three times with PBS; add 100 μl of goat anti-rabbit fluorescent secondary antibody (FITC) and incubate at 37 °C in the dark for 30 min, wash the cells three times with PBS; add 100 μl of PBS and observe under a fluorescence microscope. Set up a negative control.

[0067] Results: After diluting the CZ-23 strain at a ratio of 10 -1 ~10 -5 and inoculating it into the 96-well plate cells, after IFA detection at 24 - 48 h, clear and bright green fluorescence can be observed in the cytoplasm ( Figure 7 ), and the nucleus is faint, indicating that the virus can infect MA104 cells well. It can also be observed that as the dilution ratio increases, the green fluorescence around the cells gradually decreases, indicating that the ability of the virus to infect cells gradually decreases with the increase of the dilution ratio; while the control group without virus inoculation shows no fluorescence.

[0068] (5) Collect the wells with complete cytopathic effect and 30% - 50% cytopathic effect of MA104 cells for electron microscopy observation.

[0069] The results are as Figure 8 follows: After culturing the strain in MA104 cells and collecting the infected and diseased cells for electron microscopy observation, it can be seen that the RVA particles are all round, in the shape of a wheel, without an envelope, about 70 nm in size, with a clear outline, and the morphological structure of the RVA particles is complete.

[0070] (6) Growth kinetic curve of CZ-23 strain on MA104 cells The virus solution after plaque purification was inoculated and cultured on MA104 cells, and the cells at the time points of 0 h, 12 h, 24 h, 48 h, 72 h, 96 h, 120 h, and 144 h after inoculation were harvested. After repeated freezing and thawing, centrifugation, and filtration, inoculation was carried out according to the TCID 50 operation method, and the virus titers at different time periods were calculated, and the growth kinetic curve of the strain on MA104 cells was plotted.

[0071] The results are as Figure 9 shown: The venom of the 5th generation after adaptation culture of the CZ-23 strain on MA104 cells after plaque purification was used as the virus seed for sampling at different time nodes, and TCID 50 was used for titer determination. It can be seen from Figure 9 that the titer and proliferation of the virus showed an obvious upward trend from 0 to 120 h after infecting the cells. The virus titer reached the highest value of 7.7 LogTCID 50 / mL at 120 h after inoculating the virus, and then the titer showed a slight downward trend. The virus titer decreased to 7.5 LogTCID 50 / mL at 144 h. The change trends of the growth kinetic curves of the CZ-23 strain before and after purification were basically the same, and the titers of the purified strains at different time nodes were higher than those of the strains before purification.

[0072] (7) According to the corresponding reference sequences in the GenBank database, using MEGA 7 software, the Clustal W method was used to align multiple nucleotide sequences, the Neighbor-joining (NJ) method was used to construct a phylogenetic tree, and the confidence level Bootstrap was set to 1000 cycles.

[0073] Table 3 Amino acid differences between the CZ-23 strain and the VP7 neutralizing epitope of the rotavirus vaccine

[0074] Table 4 Amino acid differences between the CZ-23 strain and the VP8 neutralizing epitope of the rotavirus vaccine

[0075] Table 5 Amino acid differences between the CZ-23 strain and the VP5 neutralizing epitope of the rotavirus vaccine

[0076] Among them, the italicized text is the differential protein.

[0077] Results: The nucleotide homology of the VP7 gene of the original specimen and different passage CZ-23 strains with the VP7 gene of G8P[8] genotype RVA epidemic strains in Guangzhou, China was the highest, including strains GZ-0013 (GenBank accession number: OK349192.1) and GZ-0005 (GenBank accession number: OK349181.1), with homologies of 99.4% and 99.6% respectively; the homology with the VP7 gene of Indian bovine strain 79 was slightly lower (92.9%), suggesting a bovine origin. The nucleotide homology of the VP7 gene of the original specimen and different passage CZ-23 strains with the VP7 gene of globally marketed RVA vaccine strains was low (<80% nucleotide homology). The homology of the VP7 gene of the original specimen and different passage CZ-23 strains with the VP7 gene of RVA vaccine strains was 73.6% - 76.0%. In the phylogenetic tree of the VP7 gene, the original specimen and different passage CZ-23 strains clustered with G8-type DS-1 like strains previously reported in countries such as China, Singapore, Japan, Thailand, Argentina, Vietnam, and India in lineage I. In addition, several bovine-derived G8 genotype RVA strains in India (BE4 / IND / G8P[1], 68 / IND / G8P

[14] , 79 / IND / G8P

[14] ) were also located in lineage I. Several human-derived G8 genotype RVA strains reported in Africa (Mali-119 / mLI / G8P[6], GH019-08 / GHA / G8P[6], KisB565 / COD / G8P[6], DRC88 / COD / G8P[8], KDH1629 / KEN / G8P[4], KDH1111 / KEN / G8P[4], MUL-13-160 / UGA / G8P[4]) were all located in lineage II. Other G8 genotype RVA strains from the United States (2009727045 / USA / G8P[4], 2009727137 / USA / G8P[4]), Croatia (CR2006 / Croatia / G8P[8]), and Turkey (Amasya-1 / TUR / G8P[5]) clustered to form lineage III. G8 genotype RVA strains from India (69M / IND / G8P

[10] ), Hungary (182-02 / HUN / G8P

[14] ), Morocco (ma31 / MAR / G8P

[14] ), and South Korea (KJ11 / KOR / G8P[7]) formed a new genotype cluster in lineage IV. In the VP4 gene, the nucleotide homology of domestic Guangzhou epidemic strains GZ-0005 and GZ-0013 with the CZ-23 strain was the highest (99.6 - 99.7%). The VP4 gene of the CZ-23 strain detected in Chenzhou City, Hunan Province was closest to the genetic relationship with two Guangzhou G8P[8] genotype RVA epidemic strains. The CZ-23 strain, epidemic strains GZ-0005 and GZ-0013 in Guangzhou, China, and many RVA in Asian countries were all located in lineage III.The P[8] genotype RVA strains from Brazil (IAL28 / BRA / G5P[8]), Australia (CK20039 / AUS / G1P[8]), the United States (WI61 / USA / G9P[8]), and the vaccine strain (RotaTeq-WI79-4 / Vaccine / G6P[8]) formed lineage II. Three RVA strains reported from Russia (Nov10-N53 / RUS / G4P[8], Nov09-D386 / RUS / G1P[8]) and Pakistan (PAK56 / PAK / G9P[8]) constituted lineage IV. Several RVA strains from the United States (DC23 / USA / G3P[8], Wa / USA / G1P[8], VU06-07-29 / Vanderbilt / G1P[8]), Belgium (BE1520 / BEL / G1P[8]), and the vaccine strain (Rotarix-A41CB052A / Vaccine / G1P[8]) together formed lineage I. The sequence homology between the P[8] genotype RVA vaccine strain and the CZ-23 strain was 92.6% - 98.4%, which was lower than the sequence homology between the CZ-23 strain and two Guangzhou G8P[8] genotype RVA strains (>99%). Through comparison, it was found that the VP1, VP2, VP3, VP6, NSP1, NSP2, NSP3, NSP4, and NSP5 / 6 genes of the CZ-23 strain had the highest nucleotide homology with two Guangzhou DS-1 like G8P[8] genotype RVA epidemic strains, and their genetic relationship was also the closest. The results showed that the CZ-23 strain clustered together with the G8P[8] type RVA epidemic strains in Guangzhou, China and other Asian countries in any branch of the 11 segments. Generally speaking, the CZ-23 strain had a relatively short genetic distance and a relatively close genetic relationship with the 11 genomic segments of the DS-1 like G8P[8] type RVA epidemic strains in Guangzhou, China and other Asian countries.

[0078] (8)Amino acid sequence analysis of the VP7 and VP4 genes of the CZ-23 strain Results: Sequence alignment showed five differences in the amino acid sequences between the original fecal specimens and the virus cultures. After culturing for 2, 9, 16, and 23 passages in MA104 cells, amino acid differences (A181T) were detected in the VP7 gene between the original specimen and the CZ-23 strain at different passages, and amino acid changes occurred at four positions (N267D; D385N; A46T; F176S) in the VP4 gene. The homology of the VP7 gene sequence of the CZ-23 strain with GZ-0013 and GZ-0005 in Guangzhou, China was 99.4% - 99.8%, and the homology of the VP8 gene sequence with GZ-0013 and GZ-0005 in Guangzhou, China was 99.4% - 99.9%. The homology of the CZ-23 strain with the VP7 gene of Asian RVA was 98.9% - 99.3%, and the homology with the VP8 gene of Asian RVA was 96.9% - 99.5%. The homology of the amino acid sequence of the CZ-23 strain with the VP7 gene of the RVA vaccine strain was 67.9% - 73.0%, and the homology with the amino acid sequence of the VP8 gene of the RVA vaccine strain was 31.9% - 94.2%. To determine whether the fecal samples and the CZ-23 strain during and after adaptation represent the current G8 epidemic strains in China, the neutralizing epitopes of the VP7 and VP8 proteins of the fecal samples and the CZ-23 strain, other G8 genotype RVA epidemic strains, and vaccine strains during and after adaptation were compared. The amino acid sequences of the RVA strains involved in this study were compared with the vaccine strains. The amino acid sequence of VP7 contains nine variable regions (VRs): 9 - 20, 25 - 32, 37 - 53, 65 - 76, 87 - 100, 119 - 132, 141 - 150, 208 - 224, and 235 - 242. The variable regions are VR-1, VR-2, VR-3, VR-4, VR-5, VR-6, VR-7, VR-8, and VR-9 respectively. The results of VP7 neutralizing epitope analysis showed that there were significant differences between CZ-23 and MA104 cells during and after adaptation and other G8 epidemic strains in China, and there were 23 amino acid differences between CZ-23 and the four vaccines, namely LLR, Rotateq, Rotarix, and 116E.There are amino acid differences in the VP7 antigen region: (T9F, I, V), (L15S), and (L16I, V, F) from VR1; (F40I, V, M), (T45S, F, A), and (S50A, T) from VR3; (N66S, V, A, T), (Q68V, A, T), (V70A, S), and (T72K, Q, S, R) from VR4; (E90R, S, K, A, P), and (S96N, G, D, T) from VR5; (R119K), (S120E, D), (T122D, S, Y), and (S125A, V, T, L) from VR6; (D147S, N, T, G) from VR7; (T213G, D, S, N, A) from VR8; (Y235H) from VR9; (L34I), (L118F), and (D189Q, S, T) from other regions. At the same time, there are 4 amino acid site differences between different passages of the CZ-23 strain and the original specimen in the VP4 gene, and the antigenic epitopes of the two subunits VP8 and VP5 of the VP4 gene of the CZ-23 strain were analyzed. The antigenic epitope analysis results of VP8 of the CZ-23 strain showed that 4 regions (8-1, 8-2, 8-3, 8-4) were basically the same as the Chinese G8P[8] epidemic strains, and there were 7 and 4 amino acid differences between the CZ-23 strain and the two P[8] genotype vaccines RV1 and RV5, respectively. The CZ-23 strain had a large difference from other P genotype vaccines. The neutralizing epitope analysis results of VP5 of the CZ-23 strain showed that 5 regions (5-1, 5-2, 5-3, 5-4, 5-5) were basically consistent with the strains in China in recent years, and there were 2 and 3 amino acid differences between the CZ-23 strain and the two P[8] genotype vaccines RV1 and RV5, respectively, and 6 and 7 amino acid differences from LLR and 116E. The above description is only the preferred embodiment of the present invention.

Claims

1. A group A rotavirus CZ-23 of G8P[8] type was deposited on April 11, 2023 at the China General Microbiological Culture Collection Center (CGMCC), with the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit number is CGMCC NO. 45559.

2. The G8P[8] group A rotavirus CZ-23 according to claim 1, characterized in that, The group A rotavirus CZ-23 of G8P[8] type encodes six structural proteins: VP1, VP2, VP3, VP4, VP6 and VP7 and six non-structural proteins: NSP1, NSP2, NSP3, NSP4, NSP5 and NSP6, and the nucleotide sequences are as shown in SEQ ID NO.1 - 11.

3. Use of the group A rotavirus CZ-23 of G8P[8] type according to claim 1 or 2 in the preparation of a rotavirus vaccine.

4. A rotavirus vaccine comprising the group A rotavirus CZ-23 of G8P[8] type according to claim 1 or 2.

5. The rotavirus vaccine according to claim 4, characterized in that, The group A rotavirus CZ-23 of G8P[8] type has been attenuated.

6. Use of a reagent for detecting the group A rotavirus CZ-23 of G8P[8] type according to claim 1 or 2 in the preparation of a rotavirus detection reagent.

7. A detection reagent comprising a reagent for detecting the group A rotavirus CZ-23 of G8P[8] type according to claim 1 or 2.

8. The method for isolation and culture of G8P[8] type group A rotavirus CZ-23 according to claim 1 or 2, characterized in that, Comprising the following steps: (1) Obtain a virus sample infected with rotavirus; (2) Trypsin-EDTA was used to digest the MA104 cells that had formed a monolayer. After the cells were digested into single cells, they were resuspended with DEME-10% FBS and diluted to (3-4)×10 5 cells / ml. The cells were inoculated into roller tubes at (6-7)×10 5 cells / tube, and a monolayer of MA104 cells was obtained after culturing for 1-2 days. (3) Mix the dilution of the virus sample obtained in step (1), trypsin and CaCl2, activate for 1.5 - 2 h, inoculate onto the monolayer of MA104 cells obtained in step (2), adsorb for 2 - 3 h, then add trypsin - serum - free DMEM cell maintenance medium, and after culturing until cytopathic effect of MA104 cells occurs, harvest the culture and continue to inoculate onto MA104 cells for passage or freeze for later use in the same method.

9. The separation and culture method according to claim 8, characterized in that, The method for obtaining the virus sample in step (1) is: collect the diarrhea excrement specimens of diarrheal infants and young children, resuspend in PBS solution with a concentration of 0.01 - 0.02 M and pH 7.2 - 7.4, centrifuge at 13000 - 14000 g for 10 - 12 min to take the supernatant, and filter through a 0.22 μm filter to remove bacteria to obtain a virus sample infected with rotavirus.

10. The separation and culture method according to claim 8, characterized in that, During the operation processes of steps (2) and (3), the environmental temperature needs to be maintained at 36 - 38 °C; the volume concentration of the trypsin is 0.23 - 0.27%; the ratio of the dilution of the virus sample, trypsin and CaCl2 in step (2) is 200 - 240 μl: 1.2 - 1.4 μl: 0.4 - 0.6 μl.

Citation Information

Patent Citations

  • Adaptive culture method of rotavirus P(2) G3 strain and P(8) G1 strain on KMB17 cells and immunogenicity

    CN101899422A

  • Human rotavirus strain and separation, culture and identification method thereof

    CN102618506A

  • Vaccine against rotavirus

    KR1020010016600A