A low pH-tolerant Escherichia coli and its application

Abstract

The application belongs to the technical field of microorganisms, and particularly relates to an Escherichia coli resistant to low pH and application thereof. The Escherichia coli LZ1 has been sent to the China Center for Type Culture Collection, and the preservation date is November 11, 2024, and the preservation number is CCTCC NO: M 20242513. The mutS gene coding a DNA mismatch repair protein in the genome of the Escherichia coli MG1655 is knocked out, and based on the adaptive evolution breeding technology, the Escherichia coli with excellent low pH resistance is obtained. It is also accidentally found that the Escherichia coli also has good resistance in an alkaline environment, so a strain of Escherichia coli resistant to low pH and having broad-spectrum pH resistance is obtained. Therefore, the Escherichia coli LZ1 can be used as a potential chassis cell for synthesis of different compounds, and has good practical application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to an Escherichia coli resistant to low pH and application thereof. BACKGROUND

[0002] The information disclosed in this Background section is only for the purpose of increasing the understanding of the background of the application and should not be taken as an acknowledgement or any form of suggestion that this information forms prior art that is already known in this field.

[0003] In the modern bio-fermentation industry, microorganisms often produce organic acids such as acetic acid and lactic acid as a result of metabolic overflow when they synthesize target products in large quantities using substrates such as sugar, thereby causing the pH of the culture medium to decrease. Most microorganisms cannot grow well in a low-pH environment, so reducing the pH can also be an effective strategy to reduce the risk of contamination by other microorganisms. However, most fermentation strains also have low pH tolerance. Therefore, adjusting and controlling the pH of the fermentation medium is an important and critical step, but the addition of alkaline substances increases the cost of product production. Therefore, if a fermentation strain that is resistant to low-pH environments can be obtained, on the one hand, it can take advantage of the low-pH environment to avoid contamination by other microorganisms, and on the other hand, it can reduce the cost of adding alkaline substances.

[0004] As the most commonly used microbial synthesis chassis cell, Escherichia coli generally grows well in a neutral environment with a pH of 6.5-7.5, but its growth is inhibited to some extent in an acidic environment, especially in an environment with a pH of less than 5.0, and it cannot be normally used for fermentation production. Therefore, growth in a low-pH environment is a great challenge for Escherichia coli. SUMMARY

[0005] In view of the above prior art, the present application provides an Escherichia coli resistant to low pH and application thereof. The present application knocks out the mutS gene encoding a DNA mismatch repair protein in the genome of Escherichia coli MG1655, and based on adaptive evolution breeding technology, an Escherichia coli with excellent low-pH resistance is obtained. It is also unexpectedly found that it also has good resistance in an alkaline environment, thereby obtaining an Escherichia coli resistant to low pH and also having broad-spectrum pH resistance, thereby effectively expanding its application field and application range. Based on the above research results, the present application is completed.

[0006] The present application is realized by the following technical solutions:

[0007] In a first aspect of the present application, an Escherichia coli LZ1 is provided, which has been deposited with the China Center for Type Culture Collection (address: Wuhan University, Luojia Hill, Wuchang, Wuhan, Hubei Province) on November 11, 2024, and has been assigned the accession number CCTCC NO: M 20242513. The strain can grow normally in a low-pH (such as pH 4.0) environment, and can also grow normally in a neutral environment, and has a faster growth rate in a neutral environment, and also has good growth performance in an alkaline environment.

[0008] In a second aspect of the present application, a construction method of the above-mentioned Escherichia coli LZ1 is provided, and the construction method comprises the following steps:

[0009] The mutS gene encoding a DNA mismatch repair protein in the genome of the Escherichia coli MG1655 is knocked out to increase the probability of gene mutation in the continuous evolution process, and the Escherichia coli cells are continuously subcultured in an acidic medium with gradually decreasing pH based on an adaptive evolution breeding technology to obtain the Escherichia coli LZ1.

[0010] In the present application, the mutS gene can be knocked out by Red homologous recombination technology, which is not specifically limited herein.

[0011] In a third aspect of the present application, a culture method of the above-mentioned Escherichia coli is provided, and the culture method comprises the following step: inoculating the Escherichia coli LZ1 into a fermentation medium to obtain the Escherichia coli LZ1 by fermentation culture.

[0012] The fermentation medium can be any known bacterial culture medium, and in a specific embodiment of the present application, the culture medium is an LBG culture medium.

[0013] The pH of the fermentation medium can be acidic, neutral or alkaline.

[0014] In a fourth aspect of the present application, a microbial inoculant is provided, which contains the Escherichia coli LZ1 or a fermentation product or a metabolic product thereof.

[0015] In a fifth aspect of the present application, the above-mentioned Escherichia coli LZ1 or the above-mentioned microbial inoculant is used as a chassis microorganism in the synthesis of a compound based on microorganisms.

[0016] Further, in the application, the application environment of the compound synthesis can be an acidic environment, a neutral environment or an alkaline environment.

[0017] The beneficial effects of the above-mentioned one or more technical solutions are as follows:

[0018] The acid-resistant E.coli LZ1 provided by the technical scheme can grow in acid, neutral and alkaline environment conditions, especially, it can grow normally in an environment with pH=4.4-7.0, on the one hand, the low-pH environment can avoid pollution of other microorganisms, and on the other hand, the addition cost of alkaline substances is reduced. The E.coli LZ1 can be used as a potential chassis cell for synthesis of different compounds, and therefore has good practical application value. BRIEF DESCRIPTION OF DRAWINGS

[0019] The accompanying drawings, which form a part of the present description, illustrate the present application and, together with the written description, serve to explain the principles of the present application.

[0020] Figure 1 Growth of the starting strain MG1655ΔmutS (A) and the final evolved strain LZ1 (B) in LBG medium with pH=6.5, 6.0, 5.5, 5.0, 4.5 and 4.0.

[0021] Figure 2 Growth of the final evolved strain LZ1 and the starting strain MG1655ΔmutS in LBG medium with pH=4.0-7.0.

[0022] Figure 3 Growth of the final evolved strain LZ1, the starting strain MG1655ΔmutS and the wild strain MG1655 in LBG medium with pH=7.0.

[0023] Figure 4 Growth of the final evolved strain LZ1 and the starting strain MG1655ΔmutS in LBG medium with pH=8-12. DETAILED DESCRIPTION

[0024] It should be noted that the following detailed description is illustrative only and is intended to provide further description of the present application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains.

[0025] It is to be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments in accordance with the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, steps, operations, elements, components, and / or groups thereof, but do not preclude the presence or addition of one or more other features, steps, operations, elements, components, and / or groups thereof. It is to be understood that the scope of the present application is not limited to the specific specific embodiments described below; it is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the scope of the present application.

[0026] In one exemplary embodiment of the present application, an Escherichia coli LZ1 is provided, which has been deposited with the China Center for Type Culture Collection (address: Wuhan University, Luojia Hill, Wuchang, Wuhan, Hubei Province, China) on November 11, 2024, and has the accession number CCTCC NO: M 20242513. The strain can grow normally in a low-pH (e.g., pH 4.0) environment, can also grow normally in a neutral environment, and has a faster growth rate in a neutral environment. The strain also has good growth performance in an alkaline environment.

[0027] In another exemplary embodiment of the present application, a method for constructing the above-mentioned Escherichia coli LZ1 is provided, which comprises:

[0028] The mutS gene encoding a DNA mismatch repair protein in the genome of Escherichia coli MG1655 is knocked out to increase the probability of gene mutation in the continuous evolution process, and then the continuous subculture of the Escherichia coli strain in an acidic medium with gradually decreasing pH is performed based on the adaptive evolution breeding technology.

[0029] In the present application, the mutS gene can be knocked out by Red homologous recombination technology, which is not specifically limited herein.

[0030] In another exemplary embodiment of the present application, a method for culturing the above-mentioned Escherichia coli is provided, which comprises inoculating the Escherichia coli LZ1 into a fermentation medium for fermentation culture.

[0031] In the present application, the fermentation medium can be any common bacterial culture medium. In one exemplary embodiment of the present application, the culture medium is LBG culture medium. In the present application, the culture method is not specifically limited, and any conventional bacterial fermentation culture method can be used.

[0032] The pH of the fermentation medium can be acidic, neutral or alkaline, and the specific pH is 4.0-10.0, further the pH is 4.0-7.0, and more further the pH can be 4.4-7.0.

[0033] In another embodiment of the present application, a microbial agent containing the E. coli LZ1 or a fermentation product thereof or a metabolite thereof is provided.

[0034] In the present application, the term "fermentation product" is used to refer to a fermentation product. The corresponding fermentation product can be a liquid obtained from the process of fermenting the E. coli LZ1, and thus, can also be referred to as a fermentation broth. The liquid can contain bacteria (bacterial cells), but does not necessarily need to contain bacteria. The liquid preferably contains metabolites produced by the E. coli LZ1 of the present application.

[0035] In addition, in an embodiment of the present application, the fermentation broth or culture broth containing bacterial cells is separated from the liquid by centrifugation, filtration, sedimentation or other means known in the art to obtain bacterial cells grown in the fermentation broth or culture broth, and the liquid remaining after the removal of the bacterial cells is "supernatant", and in the present application, the supernatant contains extracellular metabolites of the E. coli LZ1. In an embodiment of the present application, the microbial agent can also contain the supernatant.

[0036] In addition, in an embodiment of the present application, the fermentation broth or culture broth containing bacterial cells is separated from the liquid by centrifugation, filtration, sedimentation or other means known in the art to obtain bacterial cells grown in the fermentation broth or culture broth, and the liquid remaining after the removal of the bacterial cells is "supernatant", and in the present application, the supernatant contains extracellular metabolites of the E. coli LZ1. In an embodiment of the present application, the microbial agent can also contain the supernatant.

[0037] In addition, in an embodiment of the present application, for the convenience of storage, transportation, and improvement of survival rate of the strain, the microbial agent can also be a solid, and further preferably a freeze-dried powder. That is, the freeze-drying of the above-mentioned E. coli LZ1 or a fermentation product thereof or a metabolite thereof is performed to obtain the freeze-dried powder. The freeze-drying technique (including vacuum freeze-drying technique) can be performed by a conventional method, and thus, will not be described here.

[0038] In another embodiment of the present application, the microbial agent can further include an excipient acceptable for the microbial agent.

[0039] In another embodiment of the present application, the excipient is selected from one or more of a dispersing agent, a wetting agent, a disintegrating agent, a binder, an anti-freezing agent, a thickening agent, a filler and a solvent. The present application does not have a special limitation on the source of the excipient acceptable for the microbial agent, and a commercially available product can be used.

[0040] In still another specific embodiment of the present application, the above-mentioned Escherichia coli LZ1 or the above-mentioned microbial inoculant is provided as a chassis microorganism in the application of microbial-based compound synthesis.

[0041] In still another specific embodiment of the present application, in the application, the application environment of compound synthesis can be an acidic environment, a neutral environment or an alkaline environment, and the specific pH is 4.0-10.0, further the pH is 4.0-7.0, and still further the pH can be 4.4-7.0.

[0042] In order to better illustrate the purpose, technical scheme and advantages of the present application, the present application will be further described below in combination with specific examples. The raw reagents used in the examples of the present application are all commercially available goods unless otherwise specified, and the experimental methods and instrument devices adopted are all conventional laboratory techniques. The starting strain in the examples is Escherichia coli K-12 MG1655 strain, and the ATCC number is 700926. The Addgene numbers of pTKRed used are 41062 respectively, and the pCP20 plasmid can refer to the literature "Genedisruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic resistance determinant" (Gene, 1995, 158(1): 9-14.).

[0043] Example 1 Knocking out mutS gene encoding DNA mismatch repair protein in wild-type Escherichia coli K-12 MG1655

[0044] 1) Knocking out the gene of E. coli by Red homologous recombination technology, first activating the culture of the starting strain MG1655, the culture medium is LB medium (5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride), the culture temperature is 37℃, and the activation culture time is 12 h; then the pTKred plasmid is transferred into the starting strain MG1655 to obtain the MG1655-pTKred strain, the primers mutS-QF and mutS-QR with 50 bp homologous arms are designed with the MG1655 genome as the template, the recombinant fragment mutS-del containing the upstream and downstream 50 bp homologous sequences of the mutS gene, the FRT site and the Kan resistance gene is obtained by PCR with the plasmid pKD4 as the template, the DNA fragment mutS-del is transferred into MG1655-pTKRed by electroporation, the recombinant enzyme expressed by the pTKRed plasmid occurs homologous recombination under the selection pressure of Kan to obtain the transformant, the colony PCR is verified by the primers mutS-JF and mutS-JR, the strain with Kan replacing the genome mutS is obtained, then the pCP20 plasmid is transferred, the Flp enzyme expressed by the pCP20 plasmid causes homologous recombination of the FRT sites on both sides of the Kan resistance gene to remove the Kan resistance, the endA knockout strain without Kan resistance is obtained by streaking on Kan and non-antibiotic plates, and is named as MG1655ΔmutS; the primer sequences involved in knocking out the gene mutS are as follows:

[0045] mutS-QF: CCATCACACCCCATTTAATATCAGGGAACCGGACATAACCCCGTGTAGGCTGGAGCTGCTTCG

[0046] mutS-QR: GTCAGTTGTCGTTAATATTCCCGATAGCAAAAGACTATCGGGAATTGTTAATGGGAATTAGCCATGGTCC

[0047] mutS-JF: CAAAGAAGAAGGGTTAGCCAACCGATACAATTTTGCG

[0048] mutS-JR: GGTCCACGATCAATATTATCGCCGACAGAAATAAG

[0049] DETAILED DESCRIPTION: Gene knockout procedure: pTKRed was transformed into strain MG1655 to obtain strain MG1655-pTKRed; the strain MG1655-pTKRed was inoculated into a test tube and cultured at 30°C for 12 h; it was then transferred into 50 mL of LB medium containing spectinomycin, and the initial OD 600 of inoculation was adjusted to 0.05; after 30 min of culture, 20 μL of 1 M IPTG was added for induction; the culture was continued until the OD 600 reached 0.5-0.6; at this time, the bacteria were collected in a 50 mL centrifuge tube by centrifugation at 4000 rpm for 10 min, and the medium was carefully poured out; the bacteria were transferred into a 1.5 mL Eppendorf tube, resuspended with 1 mL of sterile ultrapure water, and collected by centrifugation at 12000 g for 1 min; the resuspension- centrifugation step was repeated 4-5 times, and finally the bacteria were resuspended with 50-100 μL of sterile ultrapure water; 20-30 μL of the DNA fragment mutS-del with homologous ends was added to the electrotransformation competent cells and transferred into a pre-cooled clean 0.2 cm electrotransformation cup; the electrotransformation was performed using an electrotransformation instrument with the following parameters: 2.5 kV, 5 ms; after the electrotransformation, 800 μL of LB medium was quickly added to the electrotransformation cup to mix with the competent cells; the above 1 mL volume of bacterial solution was transferred into a 1.5 mL Eppendorf tube and incubated at 37°C for about 2 h; 500 μL of the incubated solution was collected and spread on an LB plate containing kanamycin, and incubated at 37°C for 16 h; if colonies grew, colony PCR was performed using the primers mutS-JF and mutS-JR to find the positive clones; the positive clones were made into competent cells, and the pCP20 plasmid was transformed into the positive strain; a single colony was picked and streaked on an antibiotic-free plate and incubated at 42°C for 12 h; the grown single colony was picked and streaked on LB+Kan, LB and LB+Amp plates and incubated at 37°C for 12 h; the colony that grew only on the antibiotic-free LB plate was picked and subjected to colony PCR again; the colony PCR was successful, and the positive colony with successful knockout was obtained and named MG1655ΔmutS.

[0050] Example 2: Adaptive evolution of the MG1655ΔmutS strain

[0051] 1) Preparation of LBG liquid medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, 2% glucose, and the medium pH was adjusted to 5.0 using hydrochloric acid;

[0052] 2) TB-1 LB medium 37°C overnight culture, the strain TB-1 was inoculated into the LBG medium with pH=5.0 at a ratio of 1-2% and incubated at 37°C for 48 h;

[0053] 3) Take the bacteria liquid cultured for 48h, inoculate again in LBG medium with pH=5.0 at the same inoculation ratio, and culture at 37°C for 48h;

[0054] 4) Repeat the above steps until the OD 600 value of the bacteria liquid reaches 2.0, then reduce the pH of the medium by 0.1, and continue to repeat the process. Finally, the evolved strain LZ1 capable of growing at pH=4.0-7.0 is obtained, which can grow normally in the environment with pH=4.4-7.0.

[0055] Example 3

[0056] 1) Preparation of LBG fermentation medium: 5g / L yeast extract, 10g / L tryptone, 10g / L sodium chloride, 2% glucose, and adjust the pH of the medium to 4.0-7.0 with hydrochloric acid solution;

[0057] 2) The final evolved strain LZ1 and the starting strain MG1655ΔmutS are inoculated in the prepared medium at an inoculation amount of 5%, and fermented for 24h. The growth of the strains is shown in Figure 1 and Figure 2 It can be seen from the figure that in the pH 4.0-6.5 range, the final evolved strain LZ1 shows better growth than the initial strain MG1655ΔmutS. The growth of the evolved strain LZ1 in the pH 4.4-7.0 range is similar, and the maximum OD 600 value of the culture for 24h in the environment with pH 4.0-4.3 is reduced to below 2.0, but it is still significantly better than the growth of MG1655ΔmutS.

[0058] Example 4

[0059] 1) Preparation of LBG fermentation medium: 5g / L yeast extract, 10g / L tryptone, 10g / L sodium chloride, 2% glucose, and adjust the pH of the medium to 7.0;

[0060] 2) The final evolved strain LZ1, the starting strain MG1655ΔmutS, and the wild-type Escherichia coli K-12 MG1655 are inoculated in the prepared LBG fermentation medium at an inoculation amount of 5%, and fermented for 24h. The growth of the strains is shown in Figure 3 It can be seen from the figure that under the condition of pH 7.0, the final evolved strain LZ1 shows faster growth and higher maximum OD 600 value, which fully shows that LZ1 not only has the acid-resistant property of growing at pH=4.0-7.0, but also obtains a faster growth speed under the neutral condition of pH=7.0.

[0061] Example 5

[0062] 1) Preparation of LBG fermentation medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L sodium chloride, 2% glucose, adjust the pH of the medium to 8.0-12.0 with sodium hydroxide solution;

[0063] 2) The final evolved strain LZ1 and the starting strain MG1655ΔmutS were inoculated into the prepared medium respectively, the inoculation amount was 5%, and the fermentation culture was carried out for 24 h, and the growth of the strains was shown in Figure 4 It can be seen from the figure that in the pH 8.0-12.0 range, the final evolved strain LZ1 all showed better growth than the initial strain MG1655ΔmutS. Among them, the growth of the evolved strain LZ1 in pH 8.0-10.0 was similar, and the maximum OD 600 value of the 24 h culture in the pH 11.0-12.0 environment decreased to below 1.0, but was still significantly better than the growth of MG1655ΔmutS. It shows that LZ-1 has the ability to maintain its growth in the weak alkaline environment of pH 8.0-10.0.

[0064] It should be noted that the above examples are only used to illustrate the technical solutions of the present application but not to limit it. Although the present application has been described in detail with reference to the examples given, ordinary skilled in the art can modify or equivalently replace the technical solutions of the present application according to the needs without departing from the spirit and scope of the present application.

Claims

1. A strain of Escherichia coli ( Escherichia coli ) LZ1, the strain has been sent to the China Center for Type Culture Collection, the preservation date is November 11, 2024, and the preservation number is CCTCC NO: M 20242513.

2. The method for culturing Escherichia coli according to claim 1, wherein The culture method comprises the steps of inoculating the Escherichia coli LZ1 into a fermentation medium for fermentation culture; the pH of the fermentation medium is 4.0-10.

0.

3. The culture method according to claim 2, wherein The culture medium is LBG culture medium.

4. A microbial agent, characterized in that: The microbial agent contains the Escherichia coli LZ1 according to claim 1.

5. The microbial agent according to claim 4, wherein The microbial agent also includes auxiliary materials acceptable to the agent.

6. Use of the Escherichia coli LZ1 according to claim 1 or the microbial agent according to any one of claims 4 to 5 as a chassis microorganism in microbial-based compound synthesis; the pH of the application environment of the compound synthesis is 4.0-10.0.

Images